ID: 906144467

View in Genome Browser
Species Human (GRCh38)
Location 1:43551630-43551652
Sequence CTGGCAAGTCAGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906144467_906144477 22 Left 906144467 1:43551630-43551652 CCTGCATCCCTCTGACTTGCCAG 0: 1
1: 0
2: 6
3: 21
4: 250
Right 906144477 1:43551675-43551697 ATTTCCCCACCTCTTAAATGGGG 0: 1
1: 2
2: 32
3: 333
4: 1819
906144467_906144476 21 Left 906144467 1:43551630-43551652 CCTGCATCCCTCTGACTTGCCAG 0: 1
1: 0
2: 6
3: 21
4: 250
Right 906144476 1:43551674-43551696 TATTTCCCCACCTCTTAAATGGG 0: 1
1: 0
2: 18
3: 131
4: 839
906144467_906144475 20 Left 906144467 1:43551630-43551652 CCTGCATCCCTCTGACTTGCCAG 0: 1
1: 0
2: 6
3: 21
4: 250
Right 906144475 1:43551673-43551695 CTATTTCCCCACCTCTTAAATGG 0: 1
1: 0
2: 6
3: 114
4: 882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906144467 Original CRISPR CTGGCAAGTCAGAGGGATGC AGG (reversed) Intronic
901254279 1:7807815-7807837 CTGGCAGGTAAGGGGGAAGCAGG - Intronic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
905691407 1:39945837-39945859 CTGGCAAGTGAGACTGATGTTGG - Intergenic
905888240 1:41503189-41503211 CTGACAAGTCAGGAGGCTGCTGG + Intergenic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906445999 1:45898632-45898654 CTGGCAAATGAGACTGATGCCGG - Intronic
910880712 1:91920191-91920213 CTGGCAAGTGAGACTGATGCCGG - Intergenic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
916425567 1:164676666-164676688 CTAGCAAGTTAGGGGGCTGCAGG - Intronic
917942960 1:179941624-179941646 CTGGCAAGTCTGACGTCTGCAGG - Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
922799106 1:228356239-228356261 CAGGCAGGTCAGTGGCATGCAGG - Intronic
924535185 1:244929620-244929642 CTGGCAAATCTAAGGGATGTGGG - Intergenic
1063114816 10:3066562-3066584 CTGGAAAGTCAGAGTGGGGCAGG - Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064346477 10:14537236-14537258 CTGGCCATTCTGAGAGATGCAGG + Intronic
1065114570 10:22472087-22472109 CTGCCAAGACTGAGGGGTGCAGG - Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1067478661 10:46581852-46581874 CTGGCAGGCCAGAGGAAGGCAGG - Intronic
1067616076 10:47759949-47759971 CTGGCAGGCCAGAGGAAGGCAGG + Intergenic
1068591531 10:58857523-58857545 CTGGCCAGTCTTAGGGATGAGGG - Intergenic
1069589612 10:69633809-69633831 CTGGCATCTCAGAGTGAGGCTGG - Intergenic
1069777474 10:70935344-70935366 CTGGCACCTCGGATGGATGCAGG + Intergenic
1070395647 10:76009499-76009521 CTCACATGTCAGAGGGATGCAGG - Intronic
1073349987 10:102812830-102812852 CTGGTAGGTCAGAGGGATCAGGG - Exonic
1075809630 10:125215574-125215596 CTGCCAAGTCAGGGTGGTGCAGG - Intergenic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076445268 10:130509906-130509928 TTGGCAAACCTGAGGGATGCAGG + Intergenic
1076563510 10:131382531-131382553 CCGGCAGGTCAGAGGGAGGGAGG - Intergenic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077494656 11:2881010-2881032 TTGGCAGGGCAGAGGGATGTTGG - Intergenic
1078758523 11:14233603-14233625 CTGGCTTGTGAGAGGTATGCAGG - Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1081864294 11:46351193-46351215 CTGGCAGGTCACAGGGCTTCTGG + Intronic
1083631768 11:64099115-64099137 GTGGCAATCCAGAGGGAGGCAGG - Intronic
1083996793 11:66276902-66276924 CTGGCAGGGCAGAGGGCGGCAGG - Exonic
1084233493 11:67770369-67770391 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1085135919 11:74087973-74087995 CTGGCAGGTAAGATGGAGGCTGG + Intronic
1085749629 11:79150086-79150108 GAGGCGAGTCAGAGGGATCCTGG - Intronic
1088032807 11:105272489-105272511 CTAGCAAGTCAGAGATTTGCAGG - Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1088757649 11:112899503-112899525 CAGGCAAGTCAGTGTGAAGCCGG + Intergenic
1088866134 11:113849812-113849834 CTGGCCAGTGAGACTGATGCTGG + Intronic
1090147378 11:124339978-124340000 CTGGAAAGACAAAGGGATACGGG + Intergenic
1090304206 11:125676387-125676409 CTGGGAATTCTGAGTGATGCAGG + Exonic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1094249947 12:28348217-28348239 CTGGCAAATGAGACCGATGCTGG - Intronic
1094368793 12:29713225-29713247 CTGGCAAGTCTGAAGCCTGCAGG - Intronic
1094674480 12:32605496-32605518 CTGGCAAGTTAAAGGCATGTGGG - Intronic
1095748998 12:45690279-45690301 CTGGCAAGGGAGACTGATGCTGG + Intergenic
1102175762 12:110873312-110873334 CTGGGAAGTCACAAGGATGGAGG + Intronic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1102912579 12:116728828-116728850 CGGCCAAGTCAGACGCATGCAGG + Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1104282546 12:127391148-127391170 CTGGGAAGTCAGAGAGCAGCAGG - Intergenic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105894838 13:24709130-24709152 CTGGCAGTTCTGAAGGATGCTGG - Intronic
1107611209 13:42114989-42115011 CTGACAAGTCTGAGGAATACAGG + Intronic
1108391862 13:49954872-49954894 CTGGCAAGTGAGACTGATGCTGG - Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112311653 13:98322524-98322546 CTGACAAGTGAGAGGGATGATGG - Intronic
1113957217 13:114105271-114105293 CTGGCATCTCAGAGGGCTGGCGG - Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117965107 14:61198972-61198994 CTTGCAAGGCTGAGGGATGGGGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119048786 14:71345447-71345469 GTGCCAAGTTAGAGGGAAGCTGG + Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1121108327 14:91295426-91295448 GTGGCAAGTCAGCGGTCTGCAGG + Intronic
1125355013 15:38808199-38808221 CAGGAAAGACAGAGGCATGCAGG + Intergenic
1125785712 15:42315904-42315926 CTGGCAAGTCTGAGTTTTGCAGG - Intronic
1128465493 15:67907387-67907409 CTGGCAAGTGGGAGTGATGCTGG + Intergenic
1132289718 15:100691234-100691256 CAGGCAAGTCAGAGAGGAGCTGG - Intergenic
1132699380 16:1215855-1215877 GTGGAGAGCCAGAGGGATGCAGG + Intronic
1132994104 16:2814075-2814097 CCTGAAAGTCAGAGGAATGCTGG - Intergenic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1138273976 16:55717634-55717656 CTGGCAAGTGAGACTGATGGTGG + Intergenic
1138807127 16:60103339-60103361 CTGGCAAATCTTAGGGATGATGG + Intergenic
1139510988 16:67428515-67428537 CTGGCAGGGCAGAGGAATGAAGG - Intergenic
1139728456 16:68921841-68921863 CTGCAAAGTCAGAGGAATGCCGG - Intronic
1141677192 16:85524077-85524099 CCCGGAAGTCAGAGGGATGAGGG - Intergenic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1142065071 16:88057715-88057737 CTGACAAGTAAGAGAGATGGCGG + Intronic
1142408967 16:89906702-89906724 CCAGCAAGTCAGAGGGTCGCAGG + Intronic
1142984554 17:3688097-3688119 CTGGCAAATCTGAGGGAGACAGG + Exonic
1144821213 17:18076049-18076071 CCAGCAAGCCAGATGGATGCTGG - Intergenic
1150480420 17:65504665-65504687 GGTGCAAGTGAGAGGGATGCGGG - Intergenic
1151690791 17:75683961-75683983 CTAGCAGGTCAGAGTGAAGCAGG - Intronic
1151741380 17:75984794-75984816 CTGGCAAGTGAGACTCATGCTGG - Intronic
1152254152 17:79227704-79227726 CTGACCAGCCTGAGGGATGCAGG + Intronic
1152836605 17:82537146-82537168 CTGACCAGTGAGTGGGATGCTGG + Intronic
1155344722 18:24847074-24847096 CTGGCCAGGCAGAGGGCAGCTGG - Intergenic
1155891730 18:31278645-31278667 ATGGCAAGTTAGAGGAAAGCAGG + Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1158416693 18:57255066-57255088 CTGGAAACTCAGAGTGATTCAGG - Intergenic
1159472056 18:68869445-68869467 GTGGAAAGTCTGAGGAATGCTGG + Intronic
1160337017 18:78051200-78051222 CTGGCAGGTGAGAGGGACCCAGG + Intergenic
1160773566 19:844364-844386 CGGGCAAGGGAGAGGCATGCAGG - Intronic
1163650363 19:18514118-18514140 CTGCCAGGTCAGATGGAGGCGGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1165039611 19:33059793-33059815 GTGACAAGTCAGAAGAATGCTGG - Intronic
1165858219 19:38893009-38893031 CTGGCCAATCAGAGGCATGGGGG + Intronic
1167737578 19:51305661-51305683 CTGGCAAGTGAGGCTGATGCTGG - Intergenic
1168580819 19:57554347-57554369 CTGGCTCCTCATAGGGATGCTGG - Intronic
926308553 2:11657921-11657943 CTGGAAAGCCAGTGGGCTGCTGG - Intergenic
926366032 2:12133828-12133850 CTGGGAAGTCAGAGGGGCTCAGG + Intergenic
927419637 2:22916716-22916738 CTGGCAAGGCAGAGGGTAGCAGG + Intergenic
929061697 2:37930934-37930956 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
931139222 2:59438588-59438610 CTGGCAAAGCAGAGAGATGTAGG - Intergenic
933702953 2:85268849-85268871 CTGGAAAGTCAGCGGGCAGCAGG + Intronic
936018451 2:108977016-108977038 CTGGGAAGTCAGAGGTATTTGGG - Intronic
936113186 2:109681918-109681940 CAGGCAAGTCTGGGAGATGCTGG - Intergenic
938773059 2:134517329-134517351 CTGACAAGTCAGAAGGCTGATGG + Intronic
939995572 2:148916095-148916117 CTAGCCAGGCAGAGAGATGCAGG + Intronic
940131461 2:150387618-150387640 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
945771781 2:214052471-214052493 CAGGCAAGTCAGAGTTTTGCAGG - Intronic
946987588 2:225290438-225290460 TTGTCAAGGAAGAGGGATGCAGG + Intergenic
947720989 2:232369236-232369258 TTGGCCACTCAGGGGGATGCTGG - Intergenic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
948361588 2:237424872-237424894 CAGGAAAGACAGAGGGTTGCTGG + Intronic
1173526562 20:43737397-43737419 CTGAAAAGTCACAGGGATACAGG + Intergenic
1173715242 20:45198452-45198474 CTGGTTAGTCAGAGGGGTACAGG - Intergenic
1173961205 20:47073923-47073945 CGGGGAAGTGAGAGAGATGCGGG - Intronic
1174737008 20:52973682-52973704 CTGACCACGCAGAGGGATGCAGG - Intronic
1175391228 20:58628640-58628662 CCTAGAAGTCAGAGGGATGCAGG - Intergenic
1175527280 20:59644046-59644068 TTGGCAAGTCCGACGGATGCAGG - Intronic
1175575899 20:60060593-60060615 CTGGCAAGTGTGAGCCATGCAGG + Intronic
1175813120 20:61869597-61869619 ATGGGAAGTCAGCGGGAGGCTGG - Intronic
1176947266 21:14997980-14998002 CTTACAAGTCATAGGGATGGTGG - Intronic
1177281200 21:18985138-18985160 CTGGCAAGTAAGACTAATGCTGG - Intergenic
1178804147 21:35824516-35824538 CTGGCTAGTGAGTGGGATGGTGG - Intronic
1179500168 21:41803656-41803678 TTGGCAAGTCACAGGCATGGGGG - Intronic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180198226 21:46209860-46209882 CTGGCCAGGCAGGGGGGTGCTGG - Intronic
1181179068 22:21054651-21054673 CTGAGAAGTCAGAGAGAAGCGGG + Intronic
1181419158 22:22785884-22785906 CTGGCGAGTCAGAGGAGCGCAGG + Intronic
1182576248 22:31275076-31275098 TTGGCAAGGGAAAGGGATGCTGG - Intronic
1183244979 22:36686473-36686495 CTGGCATGTAAGAGGGAGGAAGG + Intronic
1183259590 22:36785887-36785909 CAAGCAAGGCAGAGGAATGCCGG - Intergenic
1183977906 22:41523807-41523829 CTGCCAGGTCAGAGGGATCAGGG - Intronic
1184212506 22:43044136-43044158 ATGGCAAGACAGAGGGCAGCGGG - Intronic
1184372029 22:44088766-44088788 CTAACAAGTCTGAGGGAGGCCGG - Intronic
1184976172 22:48064005-48064027 CTGGCATGGCAAAGGCATGCAGG + Intergenic
1185245528 22:49771019-49771041 CGGGGAAGTCAGTGGGGTGCGGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
953455353 3:43036304-43036326 TTGGCAAGGCAGAGAGAGGCAGG + Intronic
953470825 3:43164376-43164398 CTGGCTTGTCCGAGGGGTGCAGG - Intergenic
956258035 3:67305153-67305175 CTGGCAAATAAGATGCATGCAGG + Intergenic
957050779 3:75410268-75410290 CTGGCAAGTGAGATGGATGCTGG + Intergenic
958686956 3:97410757-97410779 CTGACAACTCAGAGGAATGCTGG - Intronic
961883072 3:130076698-130076720 CTGGCAAATGAGTTGGATGCTGG + Intergenic
962700126 3:137989582-137989604 CTGGCAAGTAGGAGGGCTGATGG - Intergenic
963294937 3:143536168-143536190 CTGGAAAGTGAGAGGTAAGCTGG + Intronic
964031507 3:152144471-152144493 CTGGCAAGTAGGACTGATGCTGG - Intergenic
965769660 3:172168451-172168473 CTGACATGTCAGTGGTATGCTGG + Intronic
966423624 3:179758240-179758262 CTGGCATGTGAGAGGTTTGCTGG + Intronic
966923102 3:184627298-184627320 CTGGCTACTTGGAGGGATGCAGG - Intronic
967113936 3:186319603-186319625 CTGGAAAGTCAGTGCCATGCAGG + Intronic
967863353 3:194170148-194170170 TTGGCAAGGCGGAGGGATGGGGG + Intergenic
968628540 4:1638613-1638635 GTGGCAAGTCCAAGGGTTGCAGG + Intronic
969821658 4:9725399-9725421 GTGGCAAGTGAGATGGATGCTGG - Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
972999421 4:44927468-44927490 CTGGCTAGTCTCAGGCATGCAGG + Intergenic
975475838 4:74822224-74822246 CAAGCATTTCAGAGGGATGCTGG + Intergenic
975875120 4:78827355-78827377 CTGGCAAGTGAGACTGATGCTGG - Intronic
976766675 4:88605152-88605174 TAGACATGTCAGAGGGATGCAGG + Intronic
976823454 4:89233426-89233448 CTGACAAGTCAAAGGGAAGGAGG + Intergenic
979990395 4:127368066-127368088 CTGGCAAGTGAGACTGATGCTGG - Intergenic
980252193 4:130331890-130331912 CTGGCAAGTCAGAAATTTGCAGG + Intergenic
981258968 4:142696632-142696654 ATGGCAAGGCAGAGGGACGCAGG - Intronic
981298750 4:143163299-143163321 CTGGTAGGTCAGAGGGTTGTTGG - Intergenic
981391149 4:144193255-144193277 TTGGCAAGTCATATGGAAGCTGG + Intergenic
981821210 4:148889525-148889547 CTGGTAAGTTGGAGGAATGCAGG + Intergenic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
987039305 5:14046789-14046811 TTTGCAAGACAGATGGATGCAGG - Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
989365349 5:40649856-40649878 CTGGCAAGTGAGACTGATGCTGG + Intergenic
990487893 5:56277193-56277215 CTGGCAAGTCTGAAGCCTGCAGG - Intergenic
992712100 5:79469402-79469424 CTTCCAAGTCTGAGGGATGTTGG - Intronic
992983476 5:82202424-82202446 CTGGCAAGTCAAAAGTCTGCAGG - Intronic
996205618 5:120731940-120731962 CTGGCAAGACAGACTGGTGCTGG + Intergenic
997803285 5:136888500-136888522 CTTGCCAGGCAGAGGGATGAGGG - Intergenic
998447846 5:142212083-142212105 CTGGCCACTCACAGGGATCCTGG - Intergenic
999222597 5:149993473-149993495 CTGGAAAGTGAGAGGCACGCTGG + Exonic
1000339445 5:160266083-160266105 CTGGCGGGTCAGAGGGATCAAGG + Intronic
1001073973 5:168610417-168610439 CTAGCTAGTAAGAGGCATGCTGG + Intergenic
1001233026 5:170006138-170006160 CTGCTAAGTCACTGGGATGCCGG + Intronic
1002466186 5:179410048-179410070 CTGGAAAGTCACAGAGATGGTGG + Intergenic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1002989274 6:2223047-2223069 CTGGCAAGTCTGAGATTTGCAGG - Intronic
1003168264 6:3700164-3700186 CTGGGAAGGCTGAGGGATGTGGG - Intergenic
1003923979 6:10859674-10859696 CTGGCAAGTCAGAAATATGCAGG - Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005527230 6:26662893-26662915 CAAGCAAGTCAGAGGCATGCAGG + Intergenic
1006359228 6:33578180-33578202 CTGGCCAGCCAGAGGGAAGTAGG - Intronic
1006380095 6:33692326-33692348 CTGGCCAGACAGAGGGTTTCTGG + Intronic
1007109441 6:39304479-39304501 CTGGCAGGTGAGGGGGCTGCTGG - Exonic
1007114827 6:39336012-39336034 CAGGCAAGGCAGTGGAATGCAGG - Exonic
1007123349 6:39401743-39401765 CTGGCATGTGGAAGGGATGCAGG + Intronic
1007376702 6:41461899-41461921 GTGGCATCTCAGAGGGGTGCTGG - Intergenic
1007540636 6:42640512-42640534 CTGGCAAGTCTGAAATATGCAGG + Intronic
1007772127 6:44200732-44200754 CTGGACAGTGAGAGGGATGAGGG - Intergenic
1010933570 6:81833666-81833688 ATGGAATGTCAGAGGCATGCAGG - Intergenic
1011065258 6:83319374-83319396 CTGGCATGTCAGAGTGATGCGGG - Intronic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1015798401 6:137035866-137035888 TTGGAAAGGGAGAGGGATGCTGG + Intronic
1015948530 6:138527526-138527548 ATGGCAAGTCAGAGAGCAGCCGG + Intronic
1016263023 6:142196847-142196869 CTGGCAAGTCAATGGTCTGCTGG - Intronic
1016334504 6:142989987-142990009 CTGGCAAGTTGGAAGAATGCAGG - Intergenic
1016918806 6:149270944-149270966 CTGGGTAGTCAGAGGGTTACGGG + Intronic
1017669101 6:156752923-156752945 CTGGCAAGGCCGAGGGTGGCAGG + Intergenic
1017939808 6:159041826-159041848 CTGTGAAGTCAGAGGAATGGCGG + Intronic
1018993401 6:168692044-168692066 CTGGCATCTCAGAGGCTTGCAGG + Intergenic
1019478628 7:1255956-1255978 CTGGCAGATCAGAGGCAGGCGGG + Intergenic
1020317095 7:6913432-6913454 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1020317853 7:6919295-6919317 CTGGCAAGTGAGATGGATGCTGG - Intergenic
1021325618 7:19263735-19263757 CTTGCAAGTCACAGGAATTCTGG + Intergenic
1022093449 7:27123304-27123326 CTGGAAACTGAGAGGGACGCCGG + Intronic
1023563522 7:41500542-41500564 TTGGCAAGACAGAGGAGTGCTGG + Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024702001 7:51913773-51913795 ATGGCAAGACAGAGGGTTGACGG + Intergenic
1026362936 7:69619384-69619406 CTTGGAAGTCAGGGGGATGCAGG + Intronic
1028797828 7:94925108-94925130 CTGGCAAGTCAAAAAGCTGCAGG + Intronic
1030326696 7:108227219-108227241 CTGGAAAGTCAGAGTGCTGATGG - Intronic
1030593579 7:111509922-111509944 CTGCTAGTTCAGAGGGATGCTGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032806213 7:135357270-135357292 TTTGCAAGTCAGATGGATGTGGG - Intergenic
1032933756 7:136704817-136704839 CTGGCAAGGAAAAGGGCTGCAGG + Intergenic
1033347918 7:140539971-140539993 CCGGAAAGTCAGAGCCATGCGGG + Intronic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1036713899 8:11102226-11102248 CAGGCAAGTCCTCGGGATGCTGG - Intronic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1039436355 8:37562015-37562037 ATGGCAAGGCAGATGGATGTGGG + Intergenic
1039587462 8:38719256-38719278 CTGGCAAATCAGAGAAATCCCGG - Intergenic
1042148702 8:65758872-65758894 CTGGCAAGTGAGACTGATGCTGG - Intronic
1042858933 8:73294610-73294632 CTTGCAAGTCAGAGCGCTCCGGG - Exonic
1043468812 8:80541067-80541089 ATGGCAAATCACAGAGATGCAGG - Intergenic
1045260606 8:100570206-100570228 CTGGCAAGTGAAACTGATGCTGG - Intergenic
1045989918 8:108295072-108295094 CTTTCAAGTCAGAGGACTGCAGG + Intronic
1046362946 8:113185893-113185915 CTTGCAAGTGAGACAGATGCTGG - Intronic
1048880784 8:138870985-138871007 CAGGCCAGGCAGAGGGATGTGGG + Intronic
1049744685 8:144258286-144258308 CTGGCAAGTGAGCGGGAGGATGG - Intronic
1051413762 9:16817635-16817657 CTGGCAAGGGAGAGGAATGAAGG - Intronic
1052494781 9:29212769-29212791 CTGGCAAGTCAGGGAGTAGCCGG - Intergenic
1053379307 9:37636009-37636031 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
1056432950 9:86546858-86546880 CTGCCAACTGAGAGGGGTGCAGG - Intergenic
1057167841 9:92942368-92942390 CTGGCAGGTCAGAGTGCTGGTGG - Intergenic
1057705522 9:97392431-97392453 CTGGGAAGTGAAAGGGAGGCTGG - Intergenic
1059891977 9:118814017-118814039 CTGGGAAGTGAGACTGATGCTGG - Intergenic
1061855356 9:133439115-133439137 GGGGCAAGCCAGAGGGAGGCAGG - Intronic
1061949943 9:133930548-133930570 CTTGCTAGTCAGAGGGAAGAGGG + Intronic
1062203547 9:135321871-135321893 CTTCCAAGTCAGAGGGAAGATGG - Intergenic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1185992493 X:4907108-4907130 CTGGCAAGTCTCAAAGATGCAGG + Intergenic
1187361127 X:18628581-18628603 CTGCCAGGTCAGATGGATCCTGG + Exonic
1188199102 X:27277777-27277799 CTGGCAAGTGGGACTGATGCTGG + Intergenic
1188934363 X:36155017-36155039 CTGGGAAGTCCAAGGGATCCAGG + Intergenic
1189510426 X:41656304-41656326 CTGGCAAGTGAGGCTGATGCTGG + Intronic
1189516242 X:41715896-41715918 CTGGCAAGTGAGGCTGATGCTGG + Intronic
1190464120 X:50708725-50708747 TTGGCAAGTCAGATACATGCGGG + Intronic
1192200309 X:69062295-69062317 CTGGCAAGGAAAAGGGATTCTGG + Intergenic
1193265504 X:79463917-79463939 CTGGCTAGCCAGAGTGGTGCAGG - Intergenic
1193579963 X:83252233-83252255 CTGGCTAGTCAGGGTGATGCAGG - Intergenic
1195383422 X:104291714-104291736 CTGGCAAGTGAGGCTGATGCTGG + Intergenic
1197030065 X:121802760-121802782 CTGGTAGTTCAGAGGAATGCAGG - Intergenic
1197049987 X:122046298-122046320 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
1197089605 X:122521155-122521177 GTGTCCAGGCAGAGGGATGCTGG - Intergenic
1197111365 X:122778892-122778914 CTGGCAAGTGACACTGATGCTGG + Intergenic
1197686656 X:129446158-129446180 CATGCAGGTCAGAGGGATGTGGG - Intergenic
1199651004 X:149945938-149945960 CCGGCAAGTCCCAGGGAAGCAGG - Intergenic
1199800579 X:151247318-151247340 CTGGCAAGTAAGAGGTTTGATGG + Intergenic