ID: 906144825

View in Genome Browser
Species Human (GRCh38)
Location 1:43553749-43553771
Sequence CAGGCTCCTGTGTCCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906144821_906144825 10 Left 906144821 1:43553716-43553738 CCTTTTGGAGGTGGGAGGACAAC 0: 1
1: 0
2: 2
3: 21
4: 148
Right 906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
906144814_906144825 23 Left 906144814 1:43553703-43553725 CCCTCCTCATGGACCTTTTGGAG 0: 1
1: 0
2: 0
3: 10
4: 202
Right 906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
906144817_906144825 19 Left 906144817 1:43553707-43553729 CCTCATGGACCTTTTGGAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG 0: 1
1: 0
2: 2
3: 26
4: 223
906144815_906144825 22 Left 906144815 1:43553704-43553726 CCTCCTCATGGACCTTTTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 133
Right 906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG 0: 1
1: 0
2: 2
3: 26
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906144825 Original CRISPR CAGGCTCCTGTGTCCTGAGT AGG Intronic
901023514 1:6267170-6267192 CTGGCTCCTGTGGGCTGGGTGGG - Intronic
901357183 1:8661251-8661273 TGGTCTCCTGTGTCTTGAGTGGG - Intronic
901463194 1:9404048-9404070 CAGACTCCTGTGGGCTGAGCAGG + Intergenic
901553606 1:10014496-10014518 CTGTCTCAAGTGTCCTGAGTAGG + Intronic
901779949 1:11587312-11587334 CAGGCTCCCCTGTCCTGATAAGG - Intergenic
901881159 1:12194521-12194543 CAGGCACATCTGTCCTAAGTAGG - Intronic
902443750 1:16448412-16448434 CAGGCTCCTGTGGCCTTTCTGGG + Intronic
903675830 1:25063948-25063970 CAGCCTCCTGTCCCCTCAGTTGG - Intergenic
903809750 1:26028709-26028731 AAGGCTCCTCTGTCATGAGGTGG - Intronic
904392636 1:30196023-30196045 CTGGCACCCGGGTCCTGAGTGGG - Intergenic
904525633 1:31131752-31131774 GAGGCTACAGTGACCTGAGTTGG + Intergenic
906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG + Intronic
906787698 1:48630290-48630312 CAGGCTCCTGTTTCCAGGTTAGG + Intronic
907544780 1:55250243-55250265 CCTGCACCTGTGCCCTGAGTGGG + Intergenic
908575897 1:65459640-65459662 CACGCTTCTTTGTCCTGGGTTGG - Intronic
910984580 1:92993086-92993108 CTGGATCATGTGACCTGAGTAGG + Intergenic
910988388 1:93028618-93028640 CAGGCTCCTGTGTCCACTATGGG - Intergenic
913334252 1:117694143-117694165 CAAGCTCCTTTGTACAGAGTAGG + Intergenic
913533983 1:119753995-119754017 CAGGATCCTGAATCCTGAGGTGG - Intronic
915283928 1:154841040-154841062 CAGGCCCCAGGGTCCTGATTAGG - Intronic
915826653 1:159085263-159085285 CTGACTCCTGTCTTCTGAGTTGG + Intronic
916882347 1:169032173-169032195 CAGGCTACAGTGTGCTGAGATGG - Intergenic
918197523 1:182236066-182236088 CAGCCTCCTGCCTCCTGACTTGG - Intergenic
921268885 1:213449440-213449462 GAGGCTCCTGTGTCCTCATGCGG + Intergenic
923251854 1:232185307-232185329 CAAGCTTCTCTGTCCTGAGTGGG + Intergenic
923478346 1:234358561-234358583 CTGGTTCCTGTGTCCTCAGAAGG - Intergenic
923656401 1:235920858-235920880 CAGGCTCCTTTGGTCTGGGTAGG - Intergenic
1063959205 10:11292892-11292914 CAGGCTCCTGTTGCCTGGGAGGG - Intronic
1064242515 10:13643605-13643627 CAGGTGCTTGTGTCCTCAGTGGG - Intronic
1067059783 10:43072350-43072372 CACGCACCTGTGTGCTGTGTGGG - Intergenic
1067274410 10:44821411-44821433 CAGGCACGTGTGTGATGAGTAGG + Intergenic
1067407883 10:46039565-46039587 CAGGCTACTGTGTTCTTAGAAGG + Intronic
1067470994 10:46537634-46537656 CAGGCTCTTGGGTTCTGAGAGGG + Intergenic
1073758162 10:106603302-106603324 AAGGCTCTTGTGCCCTGAGCTGG - Intronic
1074276560 10:112007918-112007940 CTGGCCCCAATGTCCTGAGTTGG + Intergenic
1075962539 10:126581839-126581861 CAGGCGCCTGTGGACTGATTCGG + Intronic
1076527139 10:131118987-131119009 CAGGCTCATGTGGCCCAAGTGGG + Intronic
1076681993 10:132177566-132177588 CCTGCTCCTGTGCCCTGGGTAGG + Intronic
1076833518 10:133008594-133008616 CAGGCTGCTGTGTCCAGACCAGG - Intergenic
1076834868 10:133015981-133016003 CAGGCTCCTCTGTCCCAGGTGGG + Intergenic
1076839702 10:133039993-133040015 CCGGCTTCTGTGTCCTCAGCGGG + Intergenic
1076883127 10:133249228-133249250 GAGTCTCCTGTCCCCTGAGTGGG + Intergenic
1076990129 11:268361-268383 AGGCCTCCTGTGTCCTGAGTGGG + Intergenic
1077246121 11:1539605-1539627 CAGGACCCTGAGGCCTGAGTGGG + Intergenic
1077431900 11:2519989-2520011 CGGGCTCCCGCGTCCTGGGTGGG - Intronic
1078958079 11:16226473-16226495 CATGCTCCTCTGTGCTGTGTCGG - Intronic
1079699718 11:23529669-23529691 CTGCCTTCTGTGTCCTCAGTTGG + Intergenic
1081725220 11:45323111-45323133 GAGGCTCCTGGATCCTGTGTTGG - Intergenic
1082871554 11:57947374-57947396 CAGACTCCTGTCTCCTGCCTCGG + Intergenic
1083733904 11:64668835-64668857 CAGGCTCCTGCCTGCTGAGTTGG - Intronic
1083862515 11:65429960-65429982 CAGGCTGATGTTTCCTGAATGGG + Intergenic
1083935912 11:65870081-65870103 CAGGCTCCTGGGTCCTGGGCAGG - Intronic
1084345840 11:68548263-68548285 CAGGCTGCTGTGTGCTGGGAAGG + Intronic
1084673118 11:70619260-70619282 CAGCCTCCTGAGCCCTGGGTTGG - Intronic
1087439172 11:98161246-98161268 CAGGCTCCTCTGGCCAGAGTTGG + Intergenic
1087445303 11:98243617-98243639 CATTCTCCTGTGTCCGGAATTGG + Intergenic
1088262902 11:107961056-107961078 CAGTCTCCTGTTTCTTGAATAGG + Intronic
1089192212 11:116661238-116661260 CTGGCTGCTGTGTGCAGAGTGGG - Intergenic
1089365151 11:117917040-117917062 CCGGCTACTGTGTCCAGAGAGGG - Intronic
1090096787 11:123750168-123750190 CAGCCTCCAGTGTCCAGAGAAGG - Intergenic
1090164927 11:124536610-124536632 CATGCTCCTGTTTTCTGGGTTGG - Intergenic
1095197118 12:39333001-39333023 CTGGAACCTGTGTCCTGAGCAGG + Exonic
1095803796 12:46296454-46296476 CAGGATACTCTGTCCAGAGTTGG - Intergenic
1096586930 12:52628952-52628974 CAGGTTTCTGTGCCCTGAGTTGG + Intergenic
1098359736 12:69642690-69642712 GAGGCTCGAGTTTCCTGAGTGGG + Intergenic
1099450407 12:82801149-82801171 GAAGCTTCTGTGTCCTGAATTGG + Intronic
1101435096 12:104657797-104657819 CAGGCTCCAGTGTGGTGTGTCGG + Intronic
1102219267 12:111183367-111183389 CAGGCTCCAGTCCCCTCAGTTGG + Intronic
1102492860 12:113299346-113299368 CAGCCACTTGTGTCCTGAGAAGG + Exonic
1102621252 12:114196609-114196631 CTGGCTCCTGTGGGCTGTGTGGG - Intergenic
1104635911 12:130437737-130437759 CAGACTCCTGTGCTCTGAGGCGG - Intronic
1105357905 13:19676615-19676637 CAGGACTCTGTGTCCTGTGTGGG + Intronic
1105847708 13:24307941-24307963 CAGGATCCTGATTCCTGAGCCGG + Intronic
1108559262 13:51627115-51627137 CAGGCACCTGTGTCCAGATGAGG + Intronic
1115501673 14:34055235-34055257 CAGGCTCTTTTCTCTTGAGTAGG - Intronic
1117886196 14:60365623-60365645 CAGCCGCCTGTGAGCTGAGTTGG + Intergenic
1117921270 14:60727260-60727282 CAGACTCCTGTGACCTGGTTTGG - Intergenic
1118011154 14:61611863-61611885 AATGGTCCTGGGTCCTGAGTAGG - Intronic
1119423556 14:74522224-74522246 CAGGCTTCTGGTGCCTGAGTGGG - Intronic
1119919632 14:78434469-78434491 CAGGATGCTGTGTCCTTACTTGG - Intronic
1122113037 14:99514889-99514911 CAGGCTCCTCTGTCCTGCCTGGG - Exonic
1122280301 14:100618295-100618317 CAGGCTCCAGGGCCCTGAGTGGG + Intergenic
1123685845 15:22796713-22796735 CAGGCTCCTGGCTGCAGAGTAGG - Intronic
1124142536 15:27089368-27089390 CAGGCTGCAGTGTCCTCTGTGGG + Intronic
1126183481 15:45808836-45808858 GAGGATCAAGTGTCCTGAGTTGG + Intergenic
1126326499 15:47483515-47483537 AAGACTCTGGTGTCCTGAGTAGG - Intronic
1127765888 15:62185761-62185783 CAGACTACTGTGTCCCGAATTGG + Intergenic
1129423947 15:75451564-75451586 CAGGCTCCGGTGCCCAGACTGGG + Exonic
1130890352 15:88128233-88128255 TAGGCTCATGTGTCCTCAGAAGG - Intronic
1131249861 15:90823180-90823202 CAGGATCCAGTGGCCTGAGCGGG + Intergenic
1132333364 15:101027544-101027566 CCGGCCCCTGTGGCCTGAGGGGG - Intronic
1132534742 16:472522-472544 GTGGCTCCTGTGCCCTGAGAAGG + Intronic
1132997102 16:2829108-2829130 CTGGCTCCAGGGTCCTGTGTTGG + Intergenic
1133695354 16:8257827-8257849 CAGGTTCCTGGGCTCTGAGTTGG - Intergenic
1133708003 16:8373852-8373874 CAGGCTCCTGAGTCCTTTGCTGG + Intergenic
1134611975 16:15616299-15616321 CAGGCCACTGAGTCCTGTGTTGG + Intronic
1135304462 16:21356298-21356320 CAGCCTCCTGTGACCAGTGTTGG + Intergenic
1135613652 16:23890517-23890539 CAGGCTCCTAAGTCTTCAGTGGG - Intronic
1136139531 16:28279737-28279759 CAGGATCCTGAGTCCAGGGTCGG + Intergenic
1136301203 16:29335428-29335450 CAGCCTCCTGTGACCAGTGTTGG + Intergenic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1140269890 16:73456127-73456149 AAGGCTCCTGACTCCTGAGGAGG - Intergenic
1140484391 16:75282329-75282351 CAGGGTCCTGAGTCATGAGAAGG - Intergenic
1142062902 16:88042164-88042186 CAGCCTCCTGTGACCAGTGTTGG + Intronic
1145805081 17:27720946-27720968 GATACTCCTGTGTCCGGAGTTGG - Intergenic
1145905101 17:28511967-28511989 CAGCCTCCTGTGGGCTGTGTAGG - Intronic
1147310518 17:39593413-39593435 CAGACTCCTGTGTCCAGGGAAGG + Intergenic
1149349161 17:55769949-55769971 CAGCCTCCTGTGACCTTAATGGG + Intronic
1149557743 17:57586221-57586243 CAGACTCCTGTTAACTGAGTGGG - Intronic
1150389886 17:64784110-64784132 CAGTCTCCAGTGTCCTGGCTGGG + Intergenic
1150634558 17:66903903-66903925 GGGGCTTCTGTGTTCTGAGTGGG - Intergenic
1152091211 17:78248859-78248881 AAGGGCCCTGTGTCCTGACTTGG + Intergenic
1152242899 17:79169478-79169500 CTGGGTCCTGGGTCCTGGGTGGG - Intronic
1152281865 17:79389614-79389636 CATGCTCATGTGTCATGTGTCGG - Intronic
1152368431 17:79870562-79870584 CAGTCTCCTGTGTCCCAGGTTGG - Intergenic
1152825916 17:82464670-82464692 CAGGCTCCTGTGGCTTAAGCGGG + Intronic
1153613190 18:6908688-6908710 CAGGCAGCTGTGGCCTGAATGGG + Intronic
1157314163 18:46574545-46574567 AAGTCCCCTGGGTCCTGAGTTGG + Intronic
1160830799 19:1104216-1104238 CAGGCTCCAGTGACCTTGGTGGG + Intronic
1160997144 19:1888049-1888071 CAGGCAGCTGAGTCCTGAGCAGG - Intergenic
1161134822 19:2613555-2613577 CAGCCTCCTGGGACCTCAGTAGG + Intronic
1161520476 19:4720964-4720986 CAGCCTCCTGGGACCTTAGTAGG + Intronic
1161553554 19:4928002-4928024 CAGCCTCCTGGGACCTCAGTAGG + Intronic
1161732566 19:5970379-5970401 CAGGCTCCTACGACCTCAGTAGG + Intronic
1162000234 19:7740025-7740047 CAGACTCCTGTGTCCTTGCTTGG - Exonic
1162100142 19:8334346-8334368 CAGGCTCTTGGGTCCGGAGCTGG + Exonic
1162146312 19:8614113-8614135 CTGACTTCTGTGTCTTGAGTGGG + Intergenic
1163023826 19:14497816-14497838 CTGGCTCCTGTTTCCTGATGAGG + Intergenic
1163510827 19:17734038-17734060 CCGTCTCCTGTGTGCTGAGAAGG + Intronic
1166276281 19:41756519-41756541 CAGGGCCCTGGGTCCTGAGCAGG - Intronic
1167211330 19:48135902-48135924 CAGGCTCCTCTCTCCTGGGTGGG - Intronic
1167238741 19:48330689-48330711 CCGGCTCCTGTGTCCTCGGGAGG - Intergenic
1167250673 19:48396959-48396981 CAGGCTCCTGGGTCCTGCCTGGG - Intronic
1167270468 19:48502990-48503012 CAGGCTCCTGTGGAGTGAGGAGG + Exonic
925064145 2:916069-916091 CGGGATCCTGTGTCCTGTGCTGG - Intergenic
925098796 2:1228732-1228754 CAGGCTACTGTGTCCAGAATTGG + Intronic
925285974 2:2715880-2715902 CACTCCCCTGTGGCCTGAGTGGG - Intergenic
925533115 2:4885193-4885215 CATGCTTCTGTGTCCAGAATTGG - Intergenic
926029189 2:9570706-9570728 CAGGATTCTGAGTCCTGGGTGGG + Intergenic
926205968 2:10834572-10834594 GAGGCTCCTGTGGCCTGGGAGGG + Intronic
926979043 2:18547323-18547345 CAGGCTGGTTTGTCCTAAGTTGG - Intergenic
930265652 2:49195973-49195995 CAGGAGCATGTCTCCTGAGTTGG - Intergenic
931014276 2:57958037-57958059 GATCCTCCTGTGTCCTGAGAAGG - Intronic
931778738 2:65562140-65562162 CAGGCTCCTGCTCCCTGAGAAGG - Intergenic
932892215 2:75607071-75607093 CAGGCTCCTGTTTGCAGAGCTGG - Intergenic
933586996 2:84189806-84189828 CAGGCTCCTGTGGCTTCAGAAGG - Intergenic
933684335 2:85131704-85131726 AAGGGTCCTGTGTCCTGAGGGGG + Intergenic
934149954 2:89136593-89136615 CAGGCTATTGTGTCCGGAGTTGG - Intergenic
934217341 2:90045438-90045460 CAGGCTATTGTGTCCGGAGTTGG + Intergenic
934603328 2:95675598-95675620 CAGGCTCATATGTCCTGCATTGG + Intergenic
937059663 2:118971656-118971678 CAGCCTCCTTTGTCTTCAGTTGG + Intronic
937508224 2:122561273-122561295 CAGGATGCTGTGGACTGAGTTGG + Intergenic
940973846 2:159922023-159922045 AAAGCTCCTGTGGCCGGAGTGGG + Intergenic
941196609 2:162460153-162460175 CAGGCTCCTTTGGCCTAGGTGGG + Intronic
945262776 2:207860118-207860140 CAGCCTCCAGTTTCCTGAGCAGG - Intronic
945744026 2:213698705-213698727 CATGCTAAGGTGTCCTGAGTTGG + Intronic
946432566 2:219633424-219633446 CAGGGTCATGTGGCCAGAGTGGG - Exonic
947623633 2:231605827-231605849 CAGGCTCCTGGGTAGTCAGTTGG - Intergenic
1169183620 20:3593025-3593047 AAAGCACCTGTGTCTTGAGTGGG - Intronic
1172023607 20:31933347-31933369 CAGCCTACTGTGTCCTGAGATGG + Intronic
1172520667 20:35563475-35563497 CAGGCTCCAGTGAGCTGAGATGG + Intergenic
1173714130 20:45187571-45187593 CAGGATACCCTGTCCTGAGTAGG + Intergenic
1174157791 20:48528050-48528072 CAGGCTCCTGCAGCCTGAGGAGG - Intergenic
1175593544 20:60212834-60212856 CAGGCTCCTGTGTCCAGCCCAGG - Intergenic
1175954105 20:62599515-62599537 CAGGCTCCTCTGTCATGGGAGGG + Intergenic
1176108018 20:63398718-63398740 CTGGCTCCTGGCTCCTGGGTGGG - Intergenic
1179489318 21:41729948-41729970 CTGCCTCCTGTGACCTTAGTGGG - Intergenic
1180229250 21:46416655-46416677 CAGGCTCAGGGCTCCTGAGTGGG - Exonic
1181038918 22:20182836-20182858 GAGGCTCCTCTGCTCTGAGTGGG + Intergenic
1181887045 22:26029784-26029806 CAAGCCCCTGTGTCCTCAGTTGG + Intronic
1183467949 22:37989498-37989520 CAAGCTCCTCTGTCATGGGTGGG + Intronic
1184680520 22:46070460-46070482 GAAGCTCCTGTGCCCTGAGTCGG + Intronic
950574356 3:13822876-13822898 ATGGCTCCTGTGTCCTGGATGGG + Intronic
951046446 3:18044422-18044444 CAGGCTCCAGTCTCCAGGGTAGG - Intronic
952232653 3:31447967-31447989 CAGGCTGCTGCTTCCAGAGTGGG + Intergenic
953093320 3:39750772-39750794 CAGTCTTCTGTGTCCTGAAGTGG + Intergenic
953451401 3:43009484-43009506 CTGGCTCCTGTGTGCTGGGAAGG + Intronic
955669048 3:61383115-61383137 CAGGCTCCTCTGCCCTGCGATGG - Intergenic
956641664 3:71421618-71421640 CAGGTGTCTCTGTCCTGAGTCGG - Intronic
957236720 3:77602498-77602520 CAGGTTCTTGTGTCCTGAGGAGG + Intronic
961185133 3:124908165-124908187 CATGCTGCTGTGTCTTGAATAGG + Exonic
961870224 3:129982110-129982132 CTGGCTCCTGTGTGGAGAGTAGG - Intergenic
965398174 3:168186060-168186082 CAGGATTCTGTGTCCTCATTTGG + Intergenic
967187734 3:186959908-186959930 GAGGCTCCTGGGTGCTGAGTGGG + Intronic
968212663 3:196861888-196861910 CAAGGTACTGTGTCCAGAGTTGG + Intergenic
968565168 4:1308455-1308477 AAGGCTCCTGAGTCCCCAGTAGG - Intronic
968897915 4:3415578-3415600 CTGGCTGCTGTTTCCTCAGTTGG + Intronic
969175912 4:5399009-5399031 CTGGATCCTGTGTCCTGTGTTGG + Intronic
975837752 4:78442286-78442308 CAGACTCATGTGCCTTGAGTGGG + Intronic
984228598 4:177065970-177065992 TATGCTACTGTGTCCTGAGTTGG + Intergenic
984589449 4:181600944-181600966 CACGCTTCTGTGACCTGAGTGGG - Intergenic
995025119 5:107411454-107411476 CAGGAACTTGCGTCCTGAGTAGG + Intronic
995751581 5:115458081-115458103 CAGTCTCCTTTGTTCTGAGTTGG + Intergenic
997341732 5:133150426-133150448 CAGGCTCCCATGTCCTGAGCAGG - Intergenic
998037876 5:138932188-138932210 CAGGCTCCTGCTTGCTGAGCCGG + Intronic
998864037 5:146476865-146476887 CAGCCTCCTGCCTCCTGGGTAGG + Intronic
1002778969 6:352150-352172 CTGGCTGCTGCCTCCTGAGTGGG - Intergenic
1003249629 6:4414642-4414664 CATGGTACTGTGTCCAGAGTTGG - Intergenic
1003452431 6:6247783-6247805 CAGGATCCTGTGTGGTAAGTAGG - Intronic
1003980197 6:11382067-11382089 CAGGCTCCTACTTCCTGAGTTGG - Intronic
1004251446 6:14026287-14026309 AAGGCTCCTTTGACCTGAGCAGG + Intergenic
1005600132 6:27418227-27418249 CATGCCCCTGTGGCCTGAATAGG - Intergenic
1005705201 6:28444410-28444432 CAGTCTACTGTGTCCAGAATTGG + Intergenic
1006352831 6:33533717-33533739 CATGCCACTGTGTCCGGAGTTGG - Intergenic
1006886131 6:37383717-37383739 TAGGATGCTGGGTCCTGAGTTGG + Intronic
1007026879 6:38585124-38585146 CATGCTCTTGTCTCCTGAGATGG - Intronic
1007030862 6:38624472-38624494 AATCCTCCTGTGTCCAGAGTTGG - Intronic
1007772157 6:44200837-44200859 CAGGGTCCTGTCAGCTGAGTGGG + Intergenic
1008151039 6:47951315-47951337 GTGGCTCCTGTATCCTCAGTGGG + Intronic
1010045663 6:71440455-71440477 CATACTGCTGTGTCCGGAGTTGG + Intergenic
1015956676 6:138606178-138606200 CAGGCTCCTCTGGCCTGAAGAGG + Intronic
1019477642 7:1251709-1251731 CAGGCTCTGGTGTCCTCACTGGG + Intergenic
1019803464 7:3105342-3105364 GAGGCTCCGGTGGCCAGAGTGGG - Intergenic
1019875981 7:3811285-3811307 CAGGCAACTGTGACCTGGGTGGG - Intronic
1020643971 7:10791116-10791138 CATCCTGCTGTGTCCTGACTGGG - Intergenic
1021816253 7:24450120-24450142 CAGCCTGCTGAGACCTGAGTGGG + Intergenic
1022282008 7:28920417-28920439 CAGGCTCCTTACTCCTGGGTTGG - Intergenic
1024929912 7:54658945-54658967 AAGGATCCTGTGGCCTGATTTGG + Intergenic
1026541582 7:71284238-71284260 CATGCCACTGTGTCCAGAGTTGG - Intronic
1027896036 7:84046342-84046364 CATGCTGCTCTGTCCTGATTGGG + Exonic
1028133125 7:87200316-87200338 CAGGCTCCTGTGTGCTGTGTAGG - Intronic
1029619433 7:101680627-101680649 GGGGCTCCTGGGGCCTGAGTGGG - Intergenic
1031845925 7:126806032-126806054 CAGCCTACTGTGTCCAGAATTGG + Intronic
1032154899 7:129459641-129459663 CAGGCTCCTGGATACTGGGTGGG + Intronic
1034681907 7:152935184-152935206 CGGGTTGCTGTGTCCTGAGTTGG + Intergenic
1034865269 7:154636350-154636372 CTGGCTCCTGTGTCCTGAGCAGG - Intronic
1036209350 8:6829625-6829647 CATGCTTCAGTCTCCTGAGTAGG + Intronic
1037303390 8:17478138-17478160 AATGCCCCTGTGTCCGGAGTTGG - Intergenic
1037828603 8:22175093-22175115 AAGGCTCATGTGACCTTAGTGGG + Intronic
1040667232 8:49649604-49649626 CATGCTTCTGTGTCCGGAATTGG + Intergenic
1041068372 8:54103252-54103274 CATGCTTATGTGTCCAGAGTTGG - Intergenic
1042118609 8:65459701-65459723 GGGGCTCCTGTGGCCTGAATGGG + Intergenic
1042896767 8:73679296-73679318 CATGCTGTTTTGTCCTGAGTGGG - Intronic
1048304775 8:133276257-133276279 CAGTTGCCTGTGTCCTGAGATGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049599266 8:143499426-143499448 CTTGCCCCTCTGTCCTGAGTGGG + Intronic
1053448541 9:38172704-38172726 CAGGCTCTCGTGCCCTGAGGGGG - Intergenic
1054160935 9:61671754-61671776 CTGGATCCTGGGTCCTGTGTGGG + Intergenic
1056257945 9:84819488-84819510 CAGGCTCCTGGGTCTTGGGGAGG + Intronic
1058152803 9:101480666-101480688 CCAGCTCCTGTGTCCTAGGTGGG - Intronic
1061078757 9:128357498-128357520 CTGGCTGCTGTGTACGGAGTGGG + Intronic
1061674675 9:132209014-132209036 CGGGCTCCTCACTCCTGAGTAGG + Intronic
1061810255 9:133158231-133158253 CAGACTACTGTGTCATCAGTGGG - Intronic
1062622113 9:137427839-137427861 CATGCACATGTGTGCTGAGTGGG - Intronic
1062717231 9:138017325-138017347 CGGGCTTCTGTGGCCTGAGCGGG + Intronic
1187261860 X:17692326-17692348 CCGGCTCCGGTGTTCTGAGAAGG - Exonic
1195720404 X:107861860-107861882 AAGGCTACAGTGTCCTGGGTTGG - Intronic
1196657147 X:118230121-118230143 CAGGCTTCTGTGTCTAGAATGGG - Intergenic
1199985255 X:152945582-152945604 CAGGCTCCTGTTCTGTGAGTGGG + Intronic
1201534108 Y:15026616-15026638 CAGGTGCCTGTGTTCTGTGTGGG + Intergenic
1202350425 Y:23984251-23984273 CATGCTTCTGTGTCCTAATTTGG + Intergenic
1202520354 Y:25685870-25685892 CATGCTTCTGTGTCCTAATTTGG - Intergenic