ID: 906147770

View in Genome Browser
Species Human (GRCh38)
Location 1:43570076-43570098
Sequence CAGGCTACAGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 1, 2: 9, 3: 83, 4: 814}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906147770_906147784 28 Left 906147770 1:43570076-43570098 CCCTCCTCCTTCCCTGTAGCCTG 0: 1
1: 1
2: 9
3: 83
4: 814
Right 906147784 1:43570127-43570149 TCTTTGCTTCCTCAGATGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 248
906147770_906147783 24 Left 906147770 1:43570076-43570098 CCCTCCTCCTTCCCTGTAGCCTG 0: 1
1: 1
2: 9
3: 83
4: 814
Right 906147783 1:43570123-43570145 CTTCTCTTTGCTTCCTCAGATGG 0: 1
1: 0
2: 3
3: 91
4: 900
906147770_906147779 -5 Left 906147770 1:43570076-43570098 CCCTCCTCCTTCCCTGTAGCCTG 0: 1
1: 1
2: 9
3: 83
4: 814
Right 906147779 1:43570094-43570116 GCCTGGCCTGAGACAGGGCCTGG 0: 1
1: 0
2: 3
3: 57
4: 621
906147770_906147785 29 Left 906147770 1:43570076-43570098 CCCTCCTCCTTCCCTGTAGCCTG 0: 1
1: 1
2: 9
3: 83
4: 814
Right 906147785 1:43570128-43570150 CTTTGCTTCCTCAGATGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 231
906147770_906147778 -10 Left 906147770 1:43570076-43570098 CCCTCCTCCTTCCCTGTAGCCTG 0: 1
1: 1
2: 9
3: 83
4: 814
Right 906147778 1:43570089-43570111 CTGTAGCCTGGCCTGAGACAGGG 0: 1
1: 1
2: 1
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906147770 Original CRISPR CAGGCTACAGGGAAGGAGGA GGG (reversed) Intronic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900628069 1:3618547-3618569 CAGGCTGCGGGGAAGTAGCAGGG - Intergenic
900746204 1:4362326-4362348 CAGCCAACAGGGAAGGAAGCTGG - Intergenic
900860196 1:5223398-5223420 CAGGACACAGGGAGGGAGGGAGG + Intergenic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
901064864 1:6489832-6489854 CCGGCTAAAGGGCAGGAGAATGG + Intronic
901245238 1:7725219-7725241 AAGGTTCCAGGGAATGAGGAAGG - Intronic
901741560 1:11345299-11345321 GAGGCCACGGGGAAGGAGGTGGG + Intergenic
902104002 1:14018359-14018381 CAGGGTACGGGGGAGAAGGAGGG + Intergenic
902388408 1:16088937-16088959 AAGCCAACAGGGCAGGAGGAGGG + Intergenic
902503025 1:16923028-16923050 CAGGCTACAGGCAAGCACGCAGG - Intronic
902520590 1:17013439-17013461 CAGCCTCCAGGGCAGCAGGAAGG + Intergenic
902654934 1:17860577-17860599 GAGGGTACAGGGAAGGGTGAAGG - Intergenic
902664847 1:17930363-17930385 CAGGAGACAGGGAGGAAGGAAGG - Intergenic
903270210 1:22183484-22183506 AAGGTTACATGGGAGGAGGATGG - Intergenic
903339021 1:22642778-22642800 CAGGATGCAGGCAAGGAGGGTGG + Intergenic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903481178 1:23654506-23654528 CAGGCCCTAGGGAAGGAGGGAGG + Intergenic
903590320 1:24450744-24450766 CAGGCCACGGGGAAGGAAGATGG - Intronic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
904623177 1:31787786-31787808 TGGGCTCCAGGGAGGGAGGAAGG + Intergenic
905014299 1:34766683-34766705 CACGTTACAGGGGAGGAGCAAGG - Intronic
905154521 1:35964267-35964289 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
905734153 1:40314796-40314818 CAGACTGCAGGGCAGGAGAACGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906607459 1:47181934-47181956 CAGGAGACAGGAAAGGAAGAGGG + Intergenic
907249585 1:53129386-53129408 AAGGCTACAGGGCAGGAACAGGG - Intronic
907360129 1:53907497-53907519 CAAGGTACAGGAAAGGATGAAGG - Intronic
907563902 1:55416736-55416758 CAGATTACAGGGAATGGGGATGG + Intergenic
907715631 1:56923484-56923506 TAGGCTACAGGGATGGAGCATGG - Intergenic
907765645 1:57408097-57408119 CAGGCTACAGGGACTGAGAGAGG + Intronic
907819835 1:57956315-57956337 CAGGCTAGAGGGTAAGAGGTAGG + Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907987329 1:59544951-59544973 CAGCCATCAGGGAAGGAAGATGG - Intronic
908195344 1:61742335-61742357 CGGGCTCCAAGGAGGGAGGACGG - Intergenic
908288798 1:62640597-62640619 CAAAATACAGGGAAGGAGCAAGG + Intronic
908439963 1:64143521-64143543 AAAGCTACAGGGTAGGAGGGTGG + Intronic
908619023 1:65955172-65955194 CAGGGTACAGGGAAGGATTTTGG - Intronic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
909542152 1:76803223-76803245 CAGCCTCCAGGGAGGGAAGAGGG - Intergenic
910270011 1:85384427-85384449 CAGGCCACAGAGGTGGAGGAGGG - Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911663865 1:100532831-100532853 CAGCCCACAGGAAAGGAGAAAGG - Intergenic
912569800 1:110613157-110613179 GAAGTGACAGGGAAGGAGGAAGG - Intronic
912601210 1:110934772-110934794 CAACCTAAAGGGAAGGAGGCGGG + Intergenic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
913531448 1:119737027-119737049 CAGGCAACAGGAAAGTTGGAGGG - Intronic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914919307 1:151837012-151837034 CCGGCTCCTGGGAAGGTGGAGGG + Intergenic
915129825 1:153688525-153688547 GAGCCTACAGGGCAGGAGGCGGG - Intronic
915515073 1:156407972-156407994 AAGGCTGCAGGGAGGGAGCAGGG + Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915763965 1:158344269-158344291 GAGGTTACAGGGTAGGAGGAGGG - Intergenic
916064505 1:161125043-161125065 CAGGCTACAGTGCAGGATTATGG - Intronic
916128128 1:161589337-161589359 AGGGCAACAGGGAAGAAGGAGGG - Intronic
916138045 1:161671167-161671189 AGGGCAACAGGGAAGAAGGAGGG - Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916192900 1:162196553-162196575 CAGGCTGCAGTGAAGTAGCAGGG + Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917514612 1:175697246-175697268 CAGGCTGCAGTGAAAGAGGCTGG + Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918149138 1:181783041-181783063 CAGGCTCTGGGGTAGGAGGATGG - Intronic
919151232 1:193701566-193701588 AATGCTACATGGAAAGAGGAAGG + Intergenic
919483020 1:198112445-198112467 CAGGCTATGGGGTAGGAGTAGGG - Intergenic
920100480 1:203514107-203514129 CAAGCTAGAGGGAAGGAGATGGG - Intergenic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920441656 1:205984904-205984926 CATGCTGCAGGGAAGGAGAGGGG - Intronic
920748590 1:208652451-208652473 CAGCCTACAGCGAAGAAGGCCGG - Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
922040182 1:221888802-221888824 TAGGATCCAGGTAAGGAGGATGG + Intergenic
922095614 1:222440604-222440626 CAGGCTACAGTGTAGGAGGATGG - Intergenic
922819279 1:228472837-228472859 GAGGCTGCAGAGGAGGAGGAAGG - Intergenic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924447051 1:244142856-244142878 CAGGAGATAGGGAAAGAGGAAGG - Intergenic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063113924 10:3060033-3060055 GAGGCAAGAGGAAAGGAGGATGG + Intergenic
1063187080 10:3661054-3661076 CAGCCTACAGGGAAGGGGGAAGG - Intergenic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1065207608 10:23372167-23372189 GGGGCTACAGGGAGGGAGCAAGG + Intergenic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1065527566 10:26638336-26638358 GATGCAACAGGGAAAGAGGAAGG - Intergenic
1065620676 10:27577839-27577861 TAGGATACAGGAAGGGAGGAAGG - Intergenic
1067051814 10:43025994-43026016 CAGCCTACCAGGAGGGAGGAAGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067704960 10:48599718-48599740 CAGGCTAGTGGGAAAGGGGAGGG - Intronic
1067833528 10:49623868-49623890 AGGGCAGCAGGGAAGGAGGAGGG - Intronic
1067924531 10:50494626-50494648 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
1067927776 10:50527814-50527836 CATGCTGCAGGGAAAGAAGAGGG + Intronic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068956150 10:62819674-62819696 CTTTCTACAGGCAAGGAGGAAGG + Intronic
1069028347 10:63568718-63568740 CAGGCTACAGTGAACTATGATGG - Intronic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069913627 10:71774238-71774260 CAGGCACCAGGGAGGGAGGGCGG - Intronic
1070828226 10:79403558-79403580 CAGGATGCTGGGAGGGAGGAAGG + Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071418981 10:85470065-85470087 CAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1071502392 10:86213105-86213127 CAGGCTCCAAGGCAGGAGGTGGG - Intronic
1071715675 10:88093025-88093047 CAGGATTCAAGGTAGGAGGATGG + Intergenic
1072439017 10:95437846-95437868 TAGGCTACAGGGGAGCAGGGAGG - Intronic
1072903805 10:99432054-99432076 GAGGCTAGAGGGTGGGAGGAGGG - Intergenic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1073318546 10:102599903-102599925 CAGGCTCCAGGAAGGAAGGAAGG - Intronic
1074522750 10:114239889-114239911 CCGGGTACAGGGGTGGAGGAGGG + Intronic
1074689130 10:115988477-115988499 GAGGCTAGAGGGGAGTAGGATGG + Intergenic
1074724133 10:116289932-116289954 AAGGAGACAGGGAAGCAGGAAGG - Intergenic
1074815070 10:117136969-117136991 CAGGCTACAGGGGACCCGGAAGG - Intronic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1075273445 10:121073174-121073196 GAGGCAAAAGGAAAGGAGGAAGG + Intergenic
1075573160 10:123559568-123559590 CAGACTTCAGGCAAGGATGATGG + Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1075578120 10:123595754-123595776 CAGGCTACCAGGTAGGAGGCTGG + Intergenic
1075788756 10:125068522-125068544 CAGGTTTCAGGGCAGCAGGAAGG + Intronic
1075996504 10:126880740-126880762 CAGACCACAGGGAAGGGGAATGG + Intergenic
1076729040 10:132429283-132429305 CAGACATCAGGGAGGGAGGATGG - Intergenic
1076843143 10:133056399-133056421 CAGGACACAGGAAAAGAGGATGG + Intergenic
1077052403 11:573219-573241 GAGGCTCCTGGGAAGGAGGACGG - Intergenic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077572820 11:3354374-3354396 CAGGCTACAGGAGAAAAGGAAGG + Intronic
1079102037 11:17547796-17547818 AAGGCTGCAGGGAGGGAGAATGG + Intronic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1079973292 11:27062252-27062274 TAGGCAACAGAGAAGAAGGAAGG + Intronic
1080153555 11:29080112-29080134 AAGGATAGAGGGTAGGAGGAGGG + Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081931672 11:46875768-46875790 CAGGCTCCTGGGAAGCAGCAGGG + Intronic
1082264790 11:50107068-50107090 GAGGCTACAGGGAGGTAGGAGGG - Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082772863 11:57222052-57222074 AAGTCTTCAGTGAAGGAGGAAGG - Intergenic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083152696 11:60802823-60802845 CAGGCTACAGGAAAGAGGGAGGG - Intergenic
1083582327 11:63832845-63832867 CTGGCTCCAGGGAGGTAGGAAGG - Intergenic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1083724428 11:64620837-64620859 CAGGCTCCAGGAAAGGGGGTTGG - Intronic
1084012544 11:66360682-66360704 GGGTCTACTGGGAAGGAGGATGG + Intronic
1084667426 11:70583960-70583982 GAGGTTAGAGGGAAGCAGGAGGG - Intronic
1084952664 11:72675214-72675236 CAGACTACAGGCATGGGGGAAGG + Intergenic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085336752 11:75702388-75702410 CAGGAGCCAGGGAATGAGGAGGG + Intergenic
1085649979 11:78259015-78259037 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1086121957 11:83313685-83313707 GAGGCTAAAGGGAAGTAGTAAGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087701354 11:101440085-101440107 CAAGCTAGCAGGAAGGAGGAAGG + Intergenic
1087818335 11:102683488-102683510 GAGGCACCAGGTAAGGAGGAAGG - Exonic
1088235579 11:107719374-107719396 CAGGCTCTAGGGAAGTAGAATGG - Intronic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088842636 11:113639702-113639724 GAGACTTCAGGGAGGGAGGAGGG + Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1089743213 11:120599368-120599390 GAGGCTCCAGGGATGGAGGAGGG + Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090239970 11:125174982-125175004 CAGGCTTCAGGGAAGGCTGGAGG - Intronic
1090920756 11:131204093-131204115 CAAGCTCCAGAGAAAGAGGAGGG + Intergenic
1091329152 11:134717006-134717028 CAGGCTCCAGTGAAGGATCATGG + Intergenic
1091339829 11:134801673-134801695 AAGGAAACAGGGCAGGAGGAAGG + Intergenic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092280361 12:7093209-7093231 CAGGCCCCTGGGAGGGAGGAGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092620905 12:10267074-10267096 AAGGCTACTGGGAGGGGGGAGGG - Intergenic
1092955163 12:13542879-13542901 CAGGCCCCAGGGCATGAGGAAGG - Exonic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093705881 12:22274720-22274742 CAGGCAACAGCGATGGAAGAAGG - Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094727325 12:33133686-33133708 CAGGCAAGAAGGAAGGAAGAAGG + Intergenic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1095871554 12:47033889-47033911 CAGGCAACAGAGAAGGCAGATGG + Intergenic
1096085973 12:48865370-48865392 CAGACTCCAGGGACGCAGGAAGG + Intronic
1096418334 12:51433051-51433073 GAGGCTACAGGGAACAGGGAAGG - Intronic
1096665320 12:53160409-53160431 CTGGCTCCAGGGAAAGAAGAGGG - Intronic
1096675237 12:53222524-53222546 CAGGCCACAGGGAGGGGGGTTGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096795978 12:54077804-54077826 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1096929519 12:55191155-55191177 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1098073199 12:66698608-66698630 CAAGAAACAGGGAAGGAGGAAGG - Intronic
1098384328 12:69902744-69902766 GTGGCTACAGGGAAGCAGGAAGG + Intronic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1099827671 12:87799125-87799147 GAGGGTACAGGGTAAGAGGAGGG - Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101995897 12:109524638-109524660 CTGGCAAGAGGGGAGGAGGATGG - Intronic
1102316748 12:111894390-111894412 AAGGCTGCAGGGAAGGGGAAAGG - Intronic
1102884200 12:116509013-116509035 CAGGCTTCCTGGAAGGAGGGAGG - Intergenic
1102900220 12:116630859-116630881 CAGGGTCCAGGGAGGAAGGAGGG + Intergenic
1103081191 12:118025227-118025249 CAGCTTCCAGGGGAGGAGGATGG - Intronic
1103140099 12:118540911-118540933 CAGGCATCAGGGAAGCAAGAGGG + Intergenic
1103174984 12:118855248-118855270 CAGGGAACAGGGAAGCAGGTAGG - Intergenic
1103643450 12:122371675-122371697 CAGGACACAGGCGAGGAGGATGG + Intronic
1103851872 12:123938634-123938656 CAGGGGCCAGGCAAGGAGGATGG - Intronic
1104031666 12:125069306-125069328 CAGGCTTCAGGGAGGAAGGCAGG + Intronic
1104140662 12:125983657-125983679 CAGGCTTCTAGGGAGGAGGAGGG + Intergenic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104693670 12:130847161-130847183 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1104704385 12:130932489-130932511 CAGGGTACAGGGGACAAGGAGGG - Intergenic
1104993500 12:132640208-132640230 CAGGACCCAGGGATGGAGGATGG + Intronic
1106021950 13:25924107-25924129 CAGACAACGTGGAAGGAGGAGGG - Intronic
1106248895 13:27969228-27969250 CAGCCTAGTGGGAAGGAGGTGGG - Exonic
1106986414 13:35357440-35357462 CAGGGTGGAGGGTAGGAGGAGGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107182309 13:37475013-37475035 GAGGCTAGAGGGTGGGAGGAGGG + Intergenic
1107236590 13:38177766-38177788 GAGGGTTCAGGGTAGGAGGAGGG + Intergenic
1107977659 13:45705409-45705431 AAGGCAACTGGGAAGGATGAAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110001287 13:70204830-70204852 GGGACTACAGGGAAGAAGGATGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111821998 13:93226807-93226829 GAGGCAAGAGGGAAGGAGAAAGG - Intergenic
1112342864 13:98566722-98566744 CAAGCAACAGGGAAGCAGGTGGG + Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112634960 13:101206202-101206224 AAAGATACAGGGAGGGAGGAAGG - Intronic
1113135782 13:107087280-107087302 AAGTCAACAGGGAAGGAGAACGG - Intergenic
1113162234 13:107394852-107394874 CAAGGAACAGGGAAGGAGGAAGG + Intronic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114524385 14:23359186-23359208 CAGGCTGCAGGGTAGAGGGAAGG + Intronic
1114654965 14:24310545-24310567 CAGGCTGCAGGGAAGTAAGGAGG + Exonic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1115030163 14:28785272-28785294 CAGGCTTCGGGGAAGGAGGGAGG + Intronic
1115486770 14:33917856-33917878 AAAGCTACAGGGATGGAGCATGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1117911725 14:60643217-60643239 CGAGCTACAGGGACGGAGAAGGG - Intergenic
1118903241 14:70003775-70003797 AAAGCTTCAGGGATGGAGGATGG + Intronic
1119418923 14:74494381-74494403 CCGACGACAGGCAAGGAGGAAGG + Exonic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1120030877 14:79639358-79639380 GAGGGTAGAGGGTAGGAGGAAGG - Intronic
1121020990 14:90580027-90580049 CAGGCCCCAGGGAAGAAGGAGGG - Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121257644 14:92542919-92542941 CGGGCTAGAGGGAAGGGGGCAGG + Intronic
1121275303 14:92663434-92663456 CAGGCAAGAGGGAGGGAGGCCGG + Intronic
1121921573 14:97887021-97887043 CATGCAACAGGGAAAGAGGCAGG + Intergenic
1122038763 14:98967104-98967126 CAGGCTCCAGGGAATGGGGTAGG + Intergenic
1122153675 14:99737973-99737995 CAGGCGTCGGGCAAGGAGGAAGG - Intronic
1122363221 14:101179739-101179761 AAGGCGGCGGGGAAGGAGGAGGG - Intergenic
1122398643 14:101453364-101453386 CAAGCTACATTGAAGAAGGACGG + Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123457491 15:20439229-20439251 CAGGACACAGGGAAGGGAGATGG + Intergenic
1123457504 15:20439291-20439313 CAGGACACAGGGAAGGGAGACGG + Intergenic
1123457518 15:20439353-20439375 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123457531 15:20439415-20439437 CAGGACACAGGGAAGGGAGACGG + Intergenic
1123457545 15:20439477-20439499 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123660526 15:22560944-22560966 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660540 15:22561006-22561028 CAGGACACAGGGAAGGGAGACGG - Intergenic
1123660553 15:22561068-22561090 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660567 15:22561130-22561152 CAGGACACAGGGAAGGGAGACGG - Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124244563 15:28058257-28058279 CTGCCCACAGGGAAGGACGAAGG + Intronic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263689 15:28214624-28214646 CAGGGCACAGGGAAGGTAGACGG + Intronic
1124376799 15:29133660-29133682 CAGGCTACAGGGCACTAGGCAGG - Intronic
1124650309 15:31469263-31469285 GAGCCTGCAGGGATGGAGGATGG + Intergenic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1126317534 15:47386496-47386518 CTGGCTTCAGGGAAGGAGAGGGG + Intronic
1126380184 15:48038571-48038593 CAGGCTGAAGGAAAGGAGTAAGG + Intergenic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127657429 15:61069486-61069508 CAGCGTCCAGGGAAAGAGGAAGG + Intronic
1127959829 15:63882521-63882543 CAGGCCTGAGGGAGGGAGGAAGG - Intergenic
1128116999 15:65114414-65114436 CAGAATACAGGCAATGAGGAAGG - Intronic
1128497068 15:68204770-68204792 CTGGCAGCAGGGAAAGAGGAGGG - Intronic
1128702236 15:69813096-69813118 CGGGCTGCAGGGAAAGAGGCGGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1129579606 15:76793444-76793466 CAGCCTTCAGGGAGGGAGAAAGG + Intronic
1129919968 15:79311515-79311537 CAGGCTACAGGGAGGCTGCATGG + Intronic
1130214789 15:81958050-81958072 GAGATTACAGGGAATGAGGAAGG - Intergenic
1130959452 15:88650060-88650082 CAGGCTACGGGGAAGGTGTTAGG + Intronic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131098199 15:89669304-89669326 CAGACCACAGGGAAAGAGAAGGG - Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131949779 15:97669448-97669470 CAGGCTACTGGGGAGTCGGAAGG - Intergenic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133545805 16:6805388-6805410 GAGGATAGAGGGTAGGAGGAGGG + Intronic
1133710597 16:8397608-8397630 TAGGCTCCAGGAAAGGAAGAGGG - Intergenic
1134215136 16:12311435-12311457 CAGGAGCCAGGAAAGGAGGACGG - Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134743459 16:16569263-16569285 CATGCTAAAGGGGAGAAGGAAGG - Intergenic
1134924096 16:18143198-18143220 CATGCTAAAGGGGAGAAGGAAGG + Intergenic
1136021909 16:27445862-27445884 CAAGCCCCAGGGAAGGAGGGAGG + Intronic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136081319 16:27854251-27854273 AAGGCAAAAGGGGAGGAGGAGGG + Intronic
1136701979 16:32152689-32152711 CAGGACACAGGGAAGGGAGATGG + Intergenic
1136765686 16:32774771-32774793 CAGGACACAGGGAAGGGAGACGG - Intergenic
1136802412 16:33095607-33095629 CAGGACACAGGGAAGGGAGACGG + Intergenic
1136870041 16:33798560-33798582 AAGTCTACAGGGAAGGAAAATGG - Intergenic
1137554378 16:49461440-49461462 CAGGGTGCAGGGTAGGAGAAGGG + Intergenic
1137586796 16:49668609-49668631 CAAGATACAGGGAAGGTGGCAGG + Intronic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1138873940 16:60926762-60926784 CAGTCTGCAGGGTAGAAGGAAGG + Intergenic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140210174 16:72963267-72963289 CGGGCTGCAGGAAGGGAGGAGGG - Intronic
1140723285 16:77789549-77789571 CAGGCTACGGGGAAGGAAGTGGG - Intronic
1140741866 16:77948590-77948612 CGGGTAACAGGGAAGGAGTATGG - Intronic
1140809037 16:78559274-78559296 CTGGCTTCAGGGAAGAACGATGG + Intronic
1141036590 16:80631410-80631432 CAGGGTACATGGCAGGAGAAGGG - Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1142050483 16:87954891-87954913 AAGGCCACAAGGAAGCAGGAAGG - Intronic
1142247557 16:88976883-88976905 CAGCCTTGAGGGAAAGAGGAGGG + Exonic
1142311870 16:89318865-89318887 CAGGCATCAGGGATGGTGGATGG - Intronic
1203068075 16_KI270728v1_random:1037019-1037041 CAGGACACAGGGAAGGGAGACGG - Intergenic
1203102129 16_KI270728v1_random:1317494-1317516 AAGTCTACAGGGAAGGAAAATGG + Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142696877 17:1638750-1638772 CAGGCCACAGGGTGGGAGCAGGG - Intronic
1142808882 17:2386097-2386119 CAGGCTGCAGGGGACGGGGAAGG + Exonic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143317354 17:6042506-6042528 CCGCCTACAGGGAAGGGTGAAGG - Intronic
1143742005 17:8961239-8961261 CAGGCTACAGGAGAGGAAGAAGG + Intronic
1144026788 17:11284432-11284454 CAGGCAACAGGAATGGAGAAGGG + Intronic
1144079829 17:11753956-11753978 GAGGGTACAAGGTAGGAGGAGGG - Intronic
1144239649 17:13297769-13297791 CATGCACCATGGAAGGAGGAAGG - Intergenic
1144459730 17:15448716-15448738 CAAGCTTCAGAGGAGGAGGAAGG - Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146176075 17:30667450-30667472 CAGGCAGCAGGGAAGGGGAAAGG + Intergenic
1146349533 17:32083560-32083582 CAGGCAGCAGGGAAGGGGAAAGG + Intergenic
1146399631 17:32492963-32492985 AAGGCTGGAGGGCAGGAGGAGGG - Exonic
1146647216 17:34583307-34583329 CAGGACTCAGGGAAGGAGGTTGG - Intronic
1147131797 17:38414071-38414093 CAGGCTACAGTGAATGGTGATGG + Intergenic
1147544863 17:41393525-41393547 CAGGCCAGTGGGAAGGAGGGTGG - Intronic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1147791827 17:43018520-43018542 CAGGCTGCAGGGAAGGGGCCTGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148243092 17:46012785-46012807 CAGGCCAGAGGGAAGAGGGAAGG + Intronic
1149382200 17:56105528-56105550 CAGGAGGCAGGGAAGGAGGGAGG - Intergenic
1149448094 17:56729398-56729420 GAGCCTGCAGGGAAGGTGGAGGG - Intergenic
1149646062 17:58242495-58242517 CATCCTGCAGGGAAGGAGGGAGG + Intronic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150549051 17:66192153-66192175 CAGGCTAGAGGGGTGGAGTAGGG - Intergenic
1150584522 17:66505321-66505343 CTGGCCACAGGGAAGAGGGAGGG + Intronic
1150819948 17:68426993-68427015 CAGGTAACAGTGAAGGGGGAAGG + Intronic
1150819965 17:68427037-68427059 CAGGTAACAGTGAAGGGGGAAGG + Intronic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151796268 17:76347969-76347991 CAGCCTACAGGGTAGGAGTAAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1153343710 18:4003863-4003885 CAGGCTCTAAGGAAGGAAGATGG + Intronic
1153714954 18:7838733-7838755 CACCCTGCAGGGAAGGAGGCAGG - Intronic
1153855022 18:9136987-9137009 GTGGCGACAGGAAAGGAGGAAGG + Intronic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1154170823 18:12048700-12048722 CTGGCTACAGGAAGGGAAGAAGG - Intergenic
1156106515 18:33669280-33669302 CAGGCTAAAGGTGAGAAGGATGG + Intronic
1156209899 18:34928359-34928381 CAGGCTTCAAGGATGGGGGAGGG + Intergenic
1156352366 18:36312043-36312065 GAGGGTACAGGGCAGGGGGAAGG - Intronic
1156596569 18:38554495-38554517 CCTGCTTCAGGGAAGAAGGATGG - Intergenic
1156857826 18:41803026-41803048 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1157496836 18:48162215-48162237 AAGGCTGCAGGGAAGGAGGCTGG - Intronic
1157563363 18:48663836-48663858 CACACCACAGGGAAGGAGGGAGG - Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157712062 18:49857028-49857050 CAGGTGACAGGAGAGGAGGAAGG - Intronic
1157799893 18:50610511-50610533 GAGGCTGCAAGGCAGGAGGAGGG - Intronic
1158420560 18:57289243-57289265 CAGGCTTGAGGGTAGGAAGAAGG + Intergenic
1158563724 18:58536635-58536657 CAAGCTCTAGGGAAGGAGCAGGG - Exonic
1158746392 18:60204553-60204575 TTGGCAAGAGGGAAGGAGGAGGG - Intergenic
1160967304 19:1752402-1752424 GAGGCAACGGGGAAGCAGGAAGG + Exonic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161534953 19:4813261-4813283 CAGGCCACATGGAAGCAGGCTGG - Intergenic
1161664718 19:5568234-5568256 GAGGCTCCAGGGAGGGAGGCTGG + Intergenic
1161734395 19:5982085-5982107 CAGGCTGCAGTGAGGTAGGATGG + Intergenic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162836727 19:13324224-13324246 GAGGCTGCAGGGGAGGAGGAGGG + Intronic
1162881455 19:13662735-13662757 CCAGCCACACGGAAGGAGGAAGG - Intergenic
1162886331 19:13700191-13700213 TAGGATACAGGAAAGGATGAGGG - Intergenic
1162982748 19:14249452-14249474 CAGGCAGCAGGGAAGGGGAAGGG - Intergenic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163761160 19:19137572-19137594 CAGGCTCCCGGGAATGAGGAGGG - Intronic
1163830880 19:19546670-19546692 CAGGCTCTAGGGAGGAAGGATGG + Intergenic
1163966709 19:20753018-20753040 GAGGCTCCAGACAAGGAGGAAGG - Intronic
1164794393 19:31014557-31014579 GAGGTGAGAGGGAAGGAGGAAGG + Intergenic
1164850455 19:31478831-31478853 CAGGGTCCAGGGAAGGATCAGGG + Intergenic
1164931204 19:32177589-32177611 CAGGCAGGAGGGAGGGAGGAAGG + Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1164975640 19:32570989-32571011 GAGGAAACAAGGAAGGAGGAAGG - Intergenic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166109869 19:40615129-40615151 CAGGCTCCAGCGAGGCAGGAGGG + Intronic
1166862710 19:45819162-45819184 AAGCCGACAGGGAAGGAAGAGGG - Intronic
1167264324 19:48476011-48476033 CAGGCTTCTTGGAAGGAGGTTGG + Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1167600267 19:50450947-50450969 CAGCCCCCAGGGAAGGAGGAAGG - Intronic
1167674869 19:50877792-50877814 CAGACTGCAGGGAGGGAGGGCGG + Intronic
1168103326 19:54152631-54152653 GGGGCCACAGGGAAGGGGGATGG + Intronic
1168288109 19:55344452-55344474 AAGGCTACCAGAAAGGAGGAAGG + Intronic
1168707216 19:58477028-58477050 AAAGCTTCATGGAAGGAGGAGGG - Intronic
925004851 2:434173-434195 AAGGATGCAGCGAAGGAGGAAGG - Intergenic
925017586 2:543642-543664 CAGGCTGGAGGGTAGGAGGCAGG + Intergenic
925018580 2:551291-551313 GAGGCTGCAGTGAAGGAGGTGGG + Intergenic
925060541 2:886682-886704 CAGGCATCAGGGAAAGGGGAAGG - Intergenic
925283179 2:2699085-2699107 CAGGCTTCAGGACAGGAGCACGG + Intergenic
925451463 2:3973096-3973118 CAGACTCCTGGGAAGGAGCAAGG + Intergenic
926037302 2:9645787-9645809 CATGATGCAGGGAGGGAGGAGGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926836851 2:17032509-17032531 CAGGCACCAGGGCAGGAGGATGG + Intergenic
927061843 2:19430417-19430439 CAGTATACAGGGAAGGAAGTTGG + Intergenic
927133101 2:20077089-20077111 CAGGCTGCAGGGAAGAAGTCAGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
927783029 2:25954576-25954598 CAGGCCTCAGTGAAGGAGGGCGG - Intronic
927856153 2:26529128-26529150 CAAGCATGAGGGAAGGAGGATGG + Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930926538 2:56824665-56824687 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
930965359 2:57317253-57317275 CTGGCTTCAGGGAATGAGGAAGG - Intergenic
931394063 2:61870403-61870425 CGGGATAAAGGGAAGTAGGATGG - Intronic
931701200 2:64910439-64910461 GAGGCTGCTGGGAAGAAGGAAGG + Intergenic
932063972 2:68533693-68533715 CATGGTACAGGGAGGGAGGTGGG - Intronic
932574296 2:72954397-72954419 GAGGCTTCAGGGAAGGCAGACGG + Intronic
932768016 2:74483303-74483325 CAGTCTACAGGAAAGGAAGGCGG - Exonic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933804193 2:85986483-85986505 CAGGCCACAGGAATGGAGAACGG - Intergenic
934089543 2:88539206-88539228 CAGGCTCCAGGCAGGGAGCAAGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
934757343 2:96833226-96833248 CAGCCTCCAGGGAGGGAGCAGGG - Exonic
934763023 2:96866641-96866663 CAGGCTGCTGGGAGGAAGGAAGG + Intronic
934803476 2:97192978-97193000 CAGGCTACAAGTGACGAGGAAGG + Exonic
934991543 2:98925114-98925136 GAGGCAAGAGGGAAGGAGGAGGG + Intronic
936286434 2:111184812-111184834 CAGGCATCAGGGCAGGAAGAAGG + Intergenic
937243593 2:120478003-120478025 CAGGCCACAGGGGATGAGGCAGG - Intergenic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938394370 2:130931487-130931509 CATACTACAGAGAAGGAAGAGGG - Intronic
938959031 2:136324148-136324170 CAGGCAACAAGGAAGGAAAACGG + Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
940317749 2:152342659-152342681 CAGGTTTCTGGAAAGGAGGAAGG - Intronic
940539107 2:154988074-154988096 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941251173 2:163165059-163165081 CAAGCTACAGGGAAAGACAATGG - Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942138062 2:172948802-172948824 TAGGGTAGAGGGTAGGAGGAGGG + Intronic
942415210 2:175751654-175751676 CAGGCTTGAGGGAAGGAGACAGG - Intergenic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
943398743 2:187376745-187376767 GTGGCTACAGGGAAGGACAATGG - Intronic
944410681 2:199439383-199439405 CAGGCTCCAGGGAAGGGAGTGGG - Intronic
944447378 2:199805196-199805218 GAGGCTGCAGGGGTGGAGGATGG - Intronic
944601976 2:201312683-201312705 AAGGCTACAGAGATGGTGGACGG + Intronic
945396450 2:209324610-209324632 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
946115548 2:217458820-217458842 CAGGCCACATGTAAGGAAGAGGG + Intronic
946598881 2:221337475-221337497 CAGGCTACAGTGCAGCAGCATGG - Intergenic
947386213 2:229593257-229593279 TAGGCTACAAGGGAGGAGGAAGG - Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947459462 2:230290671-230290693 TTGGCTTGAGGGAAGGAGGAAGG + Intronic
947650375 2:231781283-231781305 GAGGCTAGGGGGAAGGAGAAGGG - Exonic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948421026 2:237859901-237859923 CAGGGCACAGGGGAGGCGGAGGG + Intronic
949020948 2:241741112-241741134 CAGGCAACAGGGAAGGCTGGGGG - Intronic
1169344532 20:4820066-4820088 GAGGCACCAGGGAAGGAGGGTGG - Intronic
1169439108 20:5619392-5619414 AAGGCCACAGGTTAGGAGGATGG - Intergenic
1169529743 20:6472169-6472191 TAAGCTAGAGGGAAGGAGGGAGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170809295 20:19661189-19661211 CAGGCTACAGGAAAGAAAAAAGG - Intronic
1170891073 20:20375903-20375925 CAAACCACAGGGAAGGAGCAGGG - Intergenic
1170982014 20:21222943-21222965 CCAACTACAGGGAATGAGGAAGG + Intronic
1171248487 20:23632095-23632117 CAGCCCACAGGGAAGCAGGTTGG - Intronic
1171296187 20:24019115-24019137 CAGCCTTCAGCCAAGGAGGATGG + Intergenic
1171408189 20:24928065-24928087 CAGGCCCCAGACAAGGAGGATGG + Intergenic
1172035515 20:32008031-32008053 CAGGATGCAGGGGAGCAGGAGGG + Intergenic
1172187073 20:33037543-33037565 CAGGCTATGGGGCAGCAGGAGGG - Exonic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172810503 20:37644264-37644286 CAGACTGCAGGGCAGGAGGGAGG - Intergenic
1172814084 20:37672556-37672578 GGGGCTACAGGGCAGAAGGAAGG + Intergenic
1172876890 20:38169866-38169888 CCGGCTGCAGGGACGGTGGAAGG - Intergenic
1173062859 20:39679003-39679025 CAGGGTACAGGGATGGAGTCTGG - Intergenic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173927237 20:46789858-46789880 CACACTCCAGGGAAGGAGGATGG - Intergenic
1174079492 20:47960874-47960896 CAGGTTGCAGGGATGCAGGAAGG - Intergenic
1174130478 20:48340561-48340583 CAGGCTACAGAGCAGCAGGGAGG + Intergenic
1174198496 20:48790421-48790443 CAGGCTCCAAGGAAAAAGGAGGG + Intronic
1174366804 20:50061446-50061468 CAGGCCACAGGGAAGGTGTCAGG - Intergenic
1174841492 20:53905401-53905423 CTGCCTACAGGGAATGAGGTAGG + Intergenic
1175599423 20:60260676-60260698 CAGGCTCCTGGGATGGAGTAAGG + Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1175807481 20:61837910-61837932 GAGGCCACAGGGAAGGGAGATGG - Intronic
1176308323 21:5135967-5135989 CAGGATGCTGGGCAGGAGGATGG - Exonic
1176957623 21:15124324-15124346 CAGGAGACAGGGAAGAAGGAGGG + Intergenic
1177741528 21:25159782-25159804 AAGGCTACAGGGAAGTTTGAGGG - Intergenic
1178131656 21:29580202-29580224 CAAGCTATAGGGAAGGAGCAGGG + Intronic
1178770954 21:35503640-35503662 AAGGCTTCAGGGTAGAAGGAAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179176716 21:39013299-39013321 CAGGCCACAGGGAATGGGTATGG - Intergenic
1179603849 21:42499391-42499413 CACGCCCCAGGAAAGGAGGAAGG - Intronic
1179848737 21:44126065-44126087 CAGGATGCTGGGCAGGAGGATGG + Exonic
1180059101 21:45375533-45375555 CAGGCTGGGGGGATGGAGGAGGG + Intergenic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1180946394 22:19696109-19696131 CAGGATACAGGGCAGCAGGGCGG + Intergenic
1181082248 22:20423434-20423456 CTGGCTCCAGGGAAGCAGTATGG + Intergenic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181766576 22:25096482-25096504 CGGGCAACAGGGAGGGAAGATGG - Intronic
1182009603 22:26989549-26989571 CAGGCTTCAGGGAAGGAGCCAGG - Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182082010 22:27536266-27536288 GAGCCTACTGGGAAGGAAGACGG + Intergenic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182904398 22:33922388-33922410 GAGGCTGGAGGGAAGGGGGATGG - Intronic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1184135215 22:42544753-42544775 AAGGCCATAGGGAAGGAGGCAGG + Intergenic
1184225846 22:43128477-43128499 CAGGCTATAGACAAAGAGGATGG - Exonic
1184612450 22:45613404-45613426 TAGGCTGAAGGGGAGGAGGATGG - Intergenic
1184676355 22:46045335-46045357 TTGGCTGGAGGGAAGGAGGAGGG + Intergenic
1184734292 22:46388966-46388988 CAGGCTGCATGGAAGGGAGAGGG + Intronic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1185376469 22:50484741-50484763 CTGACTACAGGGCATGAGGAGGG - Exonic
949120532 3:378703-378725 CAGTCCACAGGGATGGAGTAGGG - Intronic
949454555 3:4224918-4224940 CAGGCAACTGGGAAGGATGGTGG - Intronic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950111461 3:10421354-10421376 CAGCTTTCAGGGAAGGAGAAGGG - Intronic
950182247 3:10922789-10922811 CATGCTAAAGGGAATGGGGAAGG + Intronic
950903846 3:16520058-16520080 CAGACTGCAGGGAGGGAGAAAGG + Intergenic
951234311 3:20216829-20216851 GAGAGTACAGGGAAGGAGAATGG + Intergenic
951571669 3:24070488-24070510 AAGGGTAGAGGGTAGGAGGAGGG - Intergenic
952279298 3:31907936-31907958 CAGGCTACAGTGTTGGAGGCTGG + Intronic
953382855 3:42487110-42487132 CAGGCTGCAGGAAGGGAGCAGGG - Intergenic
954138192 3:48591944-48591966 CAAGTTCCAGGAAAGGAGGATGG + Exonic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954522196 3:51238600-51238622 GAGGGTAGAGGGTAGGAGGACGG - Intronic
954594298 3:51812263-51812285 AAGGGTAGAGGAAAGGAGGACGG - Intergenic
954808356 3:53233021-53233043 CAGGCTCCAGGGAAGGGGAGCGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955395884 3:58556902-58556924 CTGCCGGCAGGGAAGGAGGAAGG + Intergenic
955407311 3:58633585-58633607 CAGGCTTCAGGGAAGGCAGCCGG - Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956308669 3:67854705-67854727 CTGCCTACAGGGATGAAGGAAGG - Intergenic
956447366 3:69338682-69338704 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958055492 3:88405436-88405458 GATCCTACAGGGAAGGAGGCAGG - Intergenic
958458309 3:94361175-94361197 CAGCCTACATAGCAGGAGGAAGG + Intergenic
958849940 3:99312468-99312490 GAGGATATAGGGAGGGAGGAGGG + Intergenic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959847107 3:111046133-111046155 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
959847133 3:111046309-111046331 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
959901299 3:111664508-111664530 GAGCATAAAGGGAAGGAGGAAGG + Intronic
960040845 3:113148561-113148583 CATGCTCCCAGGAAGGAGGAAGG + Intergenic
960315622 3:116172914-116172936 ATGGCTACTGGGAAAGAGGATGG + Intronic
960968879 3:123125009-123125031 GAGGCTCCAGGTAAGGAGGCAGG - Intronic
961516658 3:127442165-127442187 CAGGAGACAGGGAGGGATGAGGG + Intergenic
961628941 3:128282279-128282301 CCGGCAGCAGGGAAGGAGGCTGG - Intronic
961643819 3:128381816-128381838 GAGTCTACAGGGTAGCAGGAAGG + Intronic
962090889 3:132243003-132243025 CAGGATACGGGGTAGGAGGAGGG - Intronic
962169672 3:133087748-133087770 CAGGTTCCAGGGAAGAAAGATGG - Intronic
962712564 3:138100163-138100185 CAGCCTCCAGGGAGGGAAGAGGG + Intronic
963127978 3:141832985-141833007 CAGCTTACAGGGCAGGAGGGAGG - Intergenic
963228705 3:142888752-142888774 GAGGCTGCAGGGGTGGAGGAAGG + Intronic
963967694 3:151391436-151391458 GAGGGTACAGGGAAGGGGTATGG - Intronic
964458667 3:156897047-156897069 GAGGATAGAGGGTAGGAGGAAGG + Intronic
964718356 3:159746695-159746717 CAGGATATAGGGAAAGAGGCTGG - Intronic
965419240 3:168436622-168436644 CAGCCATCAGGGAAAGAGGAAGG - Intergenic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
965878024 3:173352059-173352081 AAGGCCACAGGAAAGCAGGAGGG + Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966715027 3:183006134-183006156 CAGGCTACTTGGAAGGCTGAGGG + Intergenic
966937397 3:184719974-184719996 GAGACTCAAGGGAAGGAGGAAGG + Intergenic
967268634 3:187714521-187714543 CTGGCTCCAGGGAAGCAGGAAGG - Intronic
968115000 3:196082349-196082371 CAGGCTACCAGGGTGGAGGAAGG - Intergenic
968195109 3:196700027-196700049 CAGGCATCAGGGACTGAGGAAGG - Intronic
968263045 3:197340347-197340369 GAAGCTCCAGGGAAGGAGGAGGG - Intergenic
968282445 3:197487273-197487295 GAGGGTACAGGGAAGCAGGAGGG + Intergenic
968662952 4:1806347-1806369 CAGGCTTCAGGGGTGGAGGCGGG + Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969350108 4:6593476-6593498 GGGTCTGCAGGGAAGGAGGATGG - Intronic
969376399 4:6766308-6766330 CAGGCTGCTGGGAACGAGGGTGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969637670 4:8378625-8378647 CAGGCTAGAGGTAGGGAGGAGGG + Intronic
969749576 4:9100009-9100031 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
972015578 4:34240311-34240333 CATGCTTCATGAAAGGAGGAAGG + Intergenic
973563781 4:52163126-52163148 GTGGGTACAGGGTAGGAGGAAGG + Intergenic
973567602 4:52204003-52204025 GAGGATAAAGGGAAGAAGGAAGG - Intergenic
974339372 4:60594510-60594532 CAGGAAACAAGGAAGGAGAAGGG - Intergenic
975217346 4:71770651-71770673 CAGCCTAGAGCGTAGGAGGAAGG + Intronic
975359516 4:73451558-73451580 GAGGCTGCAGGGATGCAGGATGG + Intronic
975468620 4:74737700-74737722 CAGGAAACAGGGAAGGGAGAGGG + Intergenic
975642934 4:76518460-76518482 CAGGCAAAAAGGAAGGAGGGGGG - Intronic
976173332 4:82326888-82326910 CAGTATCCATGGAAGGAGGAGGG - Intergenic
976679153 4:87735548-87735570 CAAGCTACATGGAGGGAAGAGGG - Intergenic
976753373 4:88473308-88473330 GAGGCTAGAGGGAGGAAGGAGGG - Intronic
976947945 4:90793325-90793347 GAGGCTGCAGGGTGGGAGGAGGG - Intronic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
978320636 4:107490808-107490830 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
978430956 4:108633055-108633077 CAGGGTAGAGGGTGGGAGGAGGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978624979 4:110675033-110675055 CATGCTGCAGGTCAGGAGGAAGG + Intergenic
978689445 4:111488796-111488818 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
978770380 4:112450273-112450295 CATGCCACAGGGATGGAGGGAGG - Intergenic
979492279 4:121341910-121341932 CAGACTTCAGGGAAGGATGTGGG - Intronic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
982087286 4:151848585-151848607 CAGGCTACAGAGAAGGGGATTGG + Intergenic
982362013 4:154529030-154529052 GTAGCTACAGGGAAGTAGGATGG - Intergenic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983257024 4:165411371-165411393 AAGGGATCAGGGAAGGAGGAAGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984676658 4:182556647-182556669 CTGGCTACAGGGGAGTGGGAAGG - Intronic
985273412 4:188216198-188216220 AAGGAGACAGGGAAGGAGGGAGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985474462 5:71612-71634 CAGGACACAGGGCAGGAGAAGGG - Intergenic
986168330 5:5294814-5294836 CAGGTGACAGGAAAGGAAGAGGG + Intronic
986314658 5:6578586-6578608 CAGGCAACAAGGACGGATGAGGG - Intergenic
987593591 5:19965705-19965727 CAGGTTACATTTAAGGAGGAAGG + Intronic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
988158777 5:27492179-27492201 AAGGCTACAGGGAAAGATGCTGG - Intergenic
988412597 5:30906469-30906491 CAGGCTACAGGGAAAAAATAGGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988829934 5:34977520-34977542 CATCCTCCAGGGAGGGAGGAGGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990926167 5:61026236-61026258 CAGCCTGCAGGGGAGGAGGGGGG + Intronic
991080447 5:62593204-62593226 CAGTCTTCAGGGAAGGATAAGGG + Intronic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
992638492 5:78748230-78748252 CAGCTAACAGGAAAGGAGGAAGG - Intronic
993026861 5:82656982-82657004 AAGACTACAGGGAAGGTGAAGGG - Intergenic
993697088 5:91074318-91074340 GAGGGTAGAGGGAAAGAGGAGGG - Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994135129 5:96277946-96277968 CAGCCTTCAGAGAAGGGGGATGG - Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
996012217 5:118493614-118493636 GAGGATACAGGGTAGAAGGAGGG - Intergenic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
996868511 5:128158343-128158365 GAGGCTACTGGGTGGGAGGAGGG - Intronic
997302959 5:132819807-132819829 CAGGCAGCCAGGAAGGAGGATGG + Intergenic
997756274 5:136402485-136402507 GAGGTTACAGGGGATGAGGAGGG + Intergenic
997805121 5:136909911-136909933 CAGGCAACAGGGAAGGGGCAGGG + Intergenic
997805952 5:136918028-136918050 CATGGTCTAGGGAAGGAGGAAGG - Intergenic
999434579 5:151553287-151553309 AAGGCCAGAGGGATGGAGGACGG + Exonic
999444006 5:151624316-151624338 ACAGCTACAGGGAAGGATGAGGG + Intergenic
999759857 5:154691654-154691676 CAGGGAACAGGGACGGAGGGAGG - Intergenic
1000120768 5:158195689-158195711 TAGGATACAGGGAAGGGGGTTGG + Intergenic
1001037774 5:168310025-168310047 AAGGGGACAGGGAAGGGGGAGGG - Intronic
1001547866 5:172581631-172581653 GAGGCTGGAGGGAAGGAGGGAGG - Intergenic
1001702987 5:173720988-173721010 CAGGCAGCAGGGAAGCTGGAAGG + Intergenic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002939970 6:1707533-1707555 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002939990 6:1707595-1707617 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002940010 6:1707657-1707679 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1003031508 6:2605254-2605276 TAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1003987480 6:11451727-11451749 GAAGCTAAAGGGAAGGAGAAGGG + Intergenic
1004019154 6:11760813-11760835 TAAGCCACAGGGAAGGAGTATGG - Intronic
1005010358 6:21330041-21330063 AAGACTACAGGGAAGTTGGAGGG + Intergenic
1005083581 6:21981300-21981322 CAGGTTCCAGGGCAGGAAGAAGG - Intergenic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005311621 6:24564458-24564480 GAGGCTGCAGGGAATGAGGCTGG + Intronic
1005578531 6:27212036-27212058 AAGGCTACAAGGAAGGAGTCGGG + Intergenic
1005949025 6:30617444-30617466 CACGCGACAGGGAGGCAGGAAGG - Intronic
1006028593 6:31162823-31162845 ATGACTACAGGGAAGAAGGATGG + Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006369288 6:33634100-33634122 CTGGCGACAGGGGAGCAGGAGGG - Intronic
1006422095 6:33941359-33941381 CATTCTCAAGGGAAGGAGGAAGG - Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006639980 6:35484862-35484884 GGGGCTGCAGGGTAGGAGGAAGG + Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007419135 6:41708795-41708817 CACCCTACAGGGAAGGAGAGAGG + Intronic
1007626751 6:43251039-43251061 AAGGAGACAGGGAAAGAGGAAGG - Intronic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1007816167 6:44527119-44527141 CTGGCTACAGGGGAAGAGCACGG + Intergenic
1008111251 6:47497368-47497390 AAGGCGACAGGGAAGGAGAAGGG - Intronic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1008417647 6:51261571-51261593 CAGGCTTCAGGGCAAGAGAAAGG + Intergenic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1008899454 6:56594984-56595006 CAGTCTTCAGGGAAGCAGGGAGG + Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010435610 6:75826601-75826623 CAGGCTCCAGGGGACAAGGATGG + Intronic
1010489678 6:76460749-76460771 CAGGATTCAGGGAAAGAGGTGGG - Intergenic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1010814883 6:80346469-80346491 CAGGCAAGAGGGAAGAATGAGGG - Intergenic
1010815031 6:80348151-80348173 CAGGCAAGAGGGAAGAATGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012657794 6:101847681-101847703 CAGGCTCCATGCAAGCAGGAAGG - Intronic
1012744633 6:103069966-103069988 GAGGCAAGAGGGCAGGAGGAGGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014265068 6:119268320-119268342 CAAAATACAGGGAAGGAGCAAGG + Intronic
1014815473 6:125931243-125931265 GTGGCTACAGGGAATGAAGAGGG - Exonic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016392126 6:143585160-143585182 CAGGCTACAGGGACAGAGAGTGG + Intronic
1017467806 6:154710966-154710988 GCAGGTACAGGGAAGGAGGATGG - Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1018346324 6:162903253-162903275 GAAGCTTCAGGAAAGGAGGATGG + Intronic
1018718544 6:166554647-166554669 CAGGCTGCAGTGGAGGAGGATGG - Intronic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1018747960 6:166777071-166777093 GGAGATACAGGGAAGGAGGATGG + Intronic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1018826578 6:167412290-167412312 CCTGCTTCAGGGAAGAAGGATGG - Intergenic
1018862268 6:167719845-167719867 CAGGCGACAGGCAGGAAGGACGG - Intergenic
1019129059 6:169860211-169860233 CAGCCGACAGGGAAGGCGGATGG - Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019549226 7:1593948-1593970 CAGGAAGCAGGGAAGGAGGGAGG - Intergenic
1019767620 7:2863317-2863339 CGTGTTCCAGGGAAGGAGGAGGG + Intergenic
1020120907 7:5502714-5502736 CAAGCTACTGGGGAGGAGGCAGG + Intronic
1020323410 7:6956632-6956654 GAGGCTCCAGACAAGGAGGAAGG - Intergenic
1020731336 7:11884721-11884743 TAGGGTACAGGGTGGGAGGAGGG + Intergenic
1020942043 7:14552524-14552546 CATGAGACAGGGAGGGAGGAGGG - Intronic
1021164923 7:17325793-17325815 GAGGCTGCAGGGTGGGAGGAGGG + Intronic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021798383 7:24280460-24280482 CAGGCTACAGTGCAGAAGGAAGG + Intergenic
1021801805 7:24314830-24314852 CAGGCTACAGTGAACTATGATGG + Intergenic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1023243780 7:38178560-38178582 GAGCCTCCAGGGGAGGAGGAGGG + Intronic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1023759512 7:43450865-43450887 CAGGCCTCAGGGAAGGAAGCTGG - Exonic
1024013173 7:45287956-45287978 CTGGCCTCTGGGAAGGAGGAGGG - Intergenic
1024076868 7:45825520-45825542 CAGGTGACAGGGAAGGAGGCCGG - Intergenic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1025127551 7:56355903-56355925 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025143393 7:56484053-56484075 CAGGCGACATGCGAGGAGGAGGG + Intergenic
1025602782 7:63015461-63015483 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026462438 7:70626656-70626678 GAGGCGAGAGGGAAGGATGAGGG - Intronic
1027453511 7:78359399-78359421 CAAAATACAGGGAAGGAGCAAGG - Intronic
1027688137 7:81303934-81303956 CAGCCTGCATGGAAGGAGGTTGG - Intergenic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028190844 7:87849873-87849895 CAACTTACAGGGTAGGAGGAAGG + Exonic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028985714 7:97006731-97006753 CAGCCTGGAGGGAAGGAGCAAGG - Intronic
1029066113 7:97850302-97850324 TGGGCTACAGGGAGGGGGGAGGG - Intergenic
1029557858 7:101282797-101282819 CAGGCGGCAGGGAAGGAGGCTGG + Intergenic
1029578452 7:101419609-101419631 CAAGCTACAGGAACGGAGCAGGG - Intronic
1030173440 7:106627632-106627654 CTGGCACCAGGGAAGAAGGAGGG + Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031658931 7:124396486-124396508 CAGGATACAGGAAATGGGGAGGG + Intergenic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1033076326 7:138253548-138253570 CACACTGCATGGAAGGAGGATGG + Intergenic
1033643724 7:143285662-143285684 GAGACTACAGGGAAGGAGAAAGG + Intronic
1033666943 7:143450175-143450197 TAGGCAACAGGGAAAGACGAAGG - Intergenic
1033885597 7:145941159-145941181 CAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1034283109 7:149867030-149867052 AAGACTACAGGCAAGGAGGAGGG - Exonic
1034490134 7:151388726-151388748 CAGGCTTCAGGGAAGCAGGGAGG + Intronic
1035389728 7:158496701-158496723 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035389770 7:158496796-158496818 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035389924 7:158497167-158497189 AGGGGTACAGGGAAGGGGGAGGG - Intronic
1035428220 7:158796730-158796752 CGGGCGAGAGGGAAGCAGGACGG + Intronic
1035699400 8:1626721-1626743 CTGGCTACAGGAAAGAAGAAAGG - Exonic
1037326095 8:17692670-17692692 GAGGGTGCAGGGTAGGAGGAGGG + Intronic
1037554660 8:20010505-20010527 GAGGCTGAAGGGTAGGAGGAGGG - Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037622389 8:20576226-20576248 GAGGCTACAGGGAAAGGGAATGG - Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037753242 8:21696107-21696129 GAGGGGACAGGAAAGGAGGAGGG - Intronic
1038462745 8:27730387-27730409 TCAGCTACAGGGAAGGGGGAGGG - Intergenic
1038500218 8:28037538-28037560 GAGGCAACAGTGAAGCAGGAGGG - Intronic
1038514808 8:28178358-28178380 TAGGATACTGGGAAGGAAGAGGG - Intronic
1038646929 8:29369745-29369767 CAGGCTACAGTGAACTATGATGG + Intergenic
1038660564 8:29493141-29493163 CAGGCCAGTGGGAAGGAGGTGGG - Intergenic
1038798763 8:30731156-30731178 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039725726 8:40214321-40214343 CAGGCTACAAGGAAGAAGATAGG - Intergenic
1040655960 8:49508035-49508057 GGGGCTACAGAGAGGGAGGAAGG - Intergenic
1042236445 8:66617567-66617589 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1043586449 8:81775487-81775509 AAGGATAGAGGGGAGGAGGAGGG - Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044297545 8:90546157-90546179 CAGGCTGCAGGGAAGAATGAAGG + Intergenic
1045167853 8:99627101-99627123 CAGGCTAGAGGGTAGGGGAAAGG + Intronic
1045573880 8:103397695-103397717 CTGGCTACAGGGAGAAAGGATGG - Intergenic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1045618201 8:103942135-103942157 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1046002182 8:108434304-108434326 AAGGGTACAGGGAGGGAGGGAGG + Intronic
1046036511 8:108848433-108848455 AAAGGAACAGGGAAGGAGGAAGG + Intergenic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046547799 8:115673557-115673579 CAGACAACATGGAAGGAGGAAGG + Intronic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1047158885 8:122353756-122353778 GAGGCTTCAGGGAGAGAGGAGGG + Intergenic
1047674960 8:127191260-127191282 CAGGCTCCAGGCAGGCAGGAAGG + Intergenic
1047801161 8:128311817-128311839 AAGGCTACAGTGAAGGAAGCAGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1048844452 8:138593901-138593923 CAAGCTACAGGGAATGAGAGTGG + Intronic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1049271081 8:141696643-141696665 CAGGCTGGAAGGAAGGTGGAGGG - Intergenic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049516997 8:143065205-143065227 CAGAGTACAGGGAAGCAGCAGGG - Intergenic
1049526544 8:143129745-143129767 CAGGCTTCAGGGCTGGGGGAAGG + Intergenic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1049545654 8:143229399-143229421 CTGGCTCCAGGGATAGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050242318 9:3649907-3649929 CAGAGTACAGGAAAGGAAGATGG + Intergenic
1051164610 9:14248333-14248355 AAGGCTACAGGAAGGAAGGAAGG - Intronic
1052334615 9:27306859-27306881 TAGTCTTCAGGGAAGGGGGAAGG + Intergenic
1052687075 9:31770472-31770494 CAGGCTACTGGATAGGAGGGAGG + Intergenic
1052839235 9:33277376-33277398 CAGACTATAGGGAAGAAGTATGG + Intronic
1052998406 9:34564135-34564157 GAGGCCCCAGGGAAGGAGGAAGG - Intronic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053407552 9:37890579-37890601 CCAGCTACTGGGAAGGTGGAGGG + Intronic
1053785591 9:41650480-41650502 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054174310 9:61864446-61864468 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054449168 9:65393491-65393513 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054452571 9:65411106-65411128 GAGGCCACAGGCAAGGAGGCTGG + Intergenic
1054663228 9:67716345-67716367 CAGGCCTCAGAGAAGGAGGGCGG - Intergenic
1054732719 9:68717082-68717104 AAGGGGACAGGGAAGGAGGGAGG + Intronic
1054824377 9:69557504-69557526 CAGGCAACAGGGCAGCAGGAGGG - Intronic
1056127391 9:83549088-83549110 CAGGTTACAAGGAGGGAGAAGGG - Intergenic
1056344337 9:85675544-85675566 GAGGCTAGAAGGAAGGAGTATGG - Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056737093 9:89219326-89219348 AAGGCAGCAGGGAAGGAGGTGGG - Intergenic
1056921870 9:90797973-90797995 TAGGCCAAAGGGAAGTAGGATGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1058606725 9:106731024-106731046 CAGGGTATTGGGAAGGAGCAGGG - Intergenic
1059747527 9:117217478-117217500 AAGGATACAAGGAAGGAAGAAGG - Intronic
1060260917 9:122072823-122072845 GATGTTACAGGGAAGGAGGAGGG - Intronic
1060292355 9:122315581-122315603 GCTGATACAGGGAAGGAGGAGGG - Intronic
1060754839 9:126205409-126205431 CCGGCTGGAGGGAATGAGGACGG - Intergenic
1060813888 9:126624879-126624901 CAGGCTCCGGGGAGGGAGGTGGG + Intronic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061601136 9:131670975-131670997 CAAGATCCAGGGAAGGGGGATGG - Intronic
1061649858 9:132038794-132038816 CAGGAGACAGGGAAGAAGGAAGG + Intronic
1062339413 9:136087379-136087401 CAGGTGACAGGCCAGGAGGAGGG - Intronic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1062469075 9:136694429-136694451 CAGGCCACAGGGCAGAGGGACGG + Intergenic
1062599392 9:137313139-137313161 GAGGCTTGAGGGAAAGAGGAGGG + Intronic
1062613056 9:137383563-137383585 CGGGCCACAGGGAAGGAACAGGG - Intronic
1185499479 X:585722-585744 CCGGAGACAGGGATGGAGGAGGG - Intergenic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1185994905 X:4935858-4935880 AAGGTTACAGGAAATGAGGAGGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1186476990 X:9865393-9865415 CAGGCTCCCAGGAAGCAGGAGGG - Intronic
1188268924 X:28114398-28114420 GAGGAGACAGGGAAGCAGGAAGG + Intergenic
1189273121 X:39765646-39765668 CACGTGACTGGGAAGGAGGAAGG + Intergenic
1189302198 X:39960167-39960189 CAGGCAGCAGGGATGGAGGGCGG - Intergenic
1189756642 X:44278628-44278650 GAGTCTATAGGGAAGGAGGAAGG - Intronic
1190361917 X:49657660-49657682 GAGGCTACAGGGAAGTAGGAGGG - Intergenic
1190432186 X:50388677-50388699 GAGGCTGCAGGGGATGAGGATGG - Intronic
1190780728 X:53592444-53592466 GAGGATACAGGGCAAGAGGAAGG - Exonic
1192157951 X:68760532-68760554 AAGGCTACAGGGAACTATGATGG - Intergenic
1192223868 X:69215435-69215457 CAGTCTCCAGGGATGGAGGTGGG - Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1193959773 X:87910933-87910955 AAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1195219230 X:102730632-102730654 CAGGCTAGAGGGGAAGAGGGAGG + Intronic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1195563652 X:106315931-106315953 GAGGTTGGAGGGAAGGAGGAAGG + Intergenic
1195687701 X:107601265-107601287 CAAGCTACAGGGGAGGTGGCAGG + Exonic
1196180470 X:112684405-112684427 TGGGCTACGGGGAGGGAGGAGGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1197838273 X:130718323-130718345 CAGGCTACAGAGCAGGGTGACGG + Intronic
1198391505 X:136179780-136179802 CATGCTACAGTGAAGGAAAAGGG - Intronic
1199197985 X:145054665-145054687 GAGGGTTCAGGGTAGGAGGACGG + Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199433786 X:147789745-147789767 AAGGCCATAGGGAGGGAGGAAGG + Intergenic
1200022802 X:153226096-153226118 CAGGCTGGAGGGAGGGTGGAAGG + Intergenic
1200053587 X:153447045-153447067 CAGGCGACTGGGATGGAGGGGGG + Intronic
1200176585 X:154121435-154121457 CAGGCTTCAGAGGAAGAGGAGGG - Intergenic
1201893375 Y:18967555-18967577 AAGCCAACAGGGAAGGAAGATGG + Intergenic
1202300723 Y:23410963-23410985 CAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1202570088 Y:26259635-26259657 CAGGGTGGAGGGTAGGAGGAGGG - Intergenic