ID: 906149857

View in Genome Browser
Species Human (GRCh38)
Location 1:43581400-43581422
Sequence CGTTTCTAAGCTCTGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906149852_906149857 2 Left 906149852 1:43581375-43581397 CCTCTAGGCCCTGATGTCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 166
Right 906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 132
906149855_906149857 -7 Left 906149855 1:43581384-43581406 CCTGATGTCTCAGGACCGTTTCT 0: 1
1: 0
2: 0
3: 14
4: 236
Right 906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 132
906149854_906149857 -6 Left 906149854 1:43581383-43581405 CCCTGATGTCTCAGGACCGTTTC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906149857 Original CRISPR CGTTTCTAAGCTCTGTCCCC AGG Intronic
900487954 1:2932422-2932444 GGTTTCTATCCTGTGTCCCCTGG - Intergenic
900487984 1:2932527-2932549 GGTGTCTATCCTCTGTCCCCTGG - Intergenic
901070086 1:6512637-6512659 CTGTTCTAAGCTCTGTCTCCAGG + Intronic
906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG + Intronic
906675279 1:47688766-47688788 CCTTTCCAGGTTCTGTCCCCAGG + Intergenic
910164213 1:84307058-84307080 GGTTTCTAAGATCTGTGCCTGGG + Intronic
911563805 1:99438771-99438793 TGTCTCTTAGCTCTGTCCTCCGG + Intergenic
918413908 1:184287876-184287898 CATTTCCAAGCTCTGTAGCCAGG - Intergenic
919768556 1:201142720-201142742 CCACTCTGAGCTCTGTCCCCAGG - Intronic
920647447 1:207813983-207814005 CATATCTTGGCTCTGTCCCCTGG - Intergenic
922041188 1:221900435-221900457 CTTTTCTAATCTCTGTCCTGTGG - Intergenic
1065478180 10:26163824-26163846 TTTTTCTAAGCTCTGTCCACAGG - Intronic
1067725545 10:48768076-48768098 CCATTCTAAGCTCTGGTCCCAGG - Intronic
1070593918 10:77819452-77819474 CATTTCTAGGCACTGTTCCCCGG - Exonic
1072688022 10:97550244-97550266 GGTTACCAAGTTCTGTCCCCAGG - Intronic
1077079652 11:719556-719578 ACTTGCTAAGCTGTGTCCCCAGG - Intronic
1080787562 11:35489573-35489595 CATGTCTAAGCTCTGAGCCCTGG + Intronic
1081462623 11:43286012-43286034 CGTTTCTTAGGCCTGGCCCCAGG - Intergenic
1083615502 11:64024053-64024075 CCTCTCCAAGCCCTGTCCCCAGG + Intronic
1085181572 11:74541157-74541179 CTTTTCCAAGCTCTGTGGCCAGG - Intronic
1085424537 11:76392141-76392163 TGTTCCTTAGCTCTGTCCTCTGG - Intronic
1085761167 11:79242939-79242961 CATTTTTAAACTCTGTACCCTGG + Intronic
1087178680 11:95120459-95120481 CGTTTCTAGGCCCTAGCCCCTGG - Intronic
1089252546 11:117175343-117175365 CCTTTCTGAGGTCTGTCCACTGG - Intronic
1093182428 12:15982076-15982098 CGTTTCTAAGCCCTGGCCTGAGG - Intronic
1099369551 12:81812429-81812451 CCTCTATAAGCTCTGTCCCAGGG - Intergenic
1104149022 12:126064185-126064207 TGTTTCTATGCTGTGTCTCCGGG - Intergenic
1107394206 13:39998470-39998492 AGATTATAAGCTCTGTTCCCTGG - Intergenic
1110790723 13:79583921-79583943 TGGTTCTCAGCTCTGTCCCCTGG + Intergenic
1114890308 14:26913031-26913053 CTTTTTTAATTTCTGTCCCCTGG - Intergenic
1115299026 14:31863690-31863712 TGTTTCTGAACTCTGTCCCATGG - Intergenic
1120246760 14:82015637-82015659 TGGTTCTAAGCTCTGCCCTCTGG + Intergenic
1122148088 14:99706087-99706109 TCTTTCTAAGCTCTGTGCCTGGG + Intronic
1123061174 14:105595196-105595218 AGTCACTGAGCTCTGTCCCCCGG + Intergenic
1123085629 14:105716107-105716129 AGTCACTGAGCTCTGTCCCCCGG + Intergenic
1202850579 14_GL000225v1_random:15341-15363 CTTGTCTAAGCTCTGTCTACAGG - Intergenic
1202850651 14_GL000225v1_random:16093-16115 CTTTTCTAGGCTCTGTCTACAGG - Intergenic
1202854119 14_GL000225v1_random:39423-39445 CTTTTCTAGGCTCTGTCTACAGG - Intergenic
1202856641 14_GL000225v1_random:55546-55568 CTTTTCTACGCTCTGTCTACAGG - Intergenic
1202859047 14_GL000225v1_random:70144-70166 CTTTTCTAAGCTCTGTCTACCGG + Intergenic
1202864844 14_GL000225v1_random:109582-109604 CTTTTCTAGGCTCTGTCTACAGG - Intergenic
1202866486 14_GL000225v1_random:122382-122404 CTTTTCTAGGCTCTGTCTACAGG + Intergenic
1202868712 14_GL000225v1_random:139586-139608 CTTTTATAAGCTCTGTCTACAGG + Intergenic
1202869080 14_GL000225v1_random:142945-142967 CTTTTCTAAGCTCTGCCTACAGG + Intergenic
1202922392 14_KI270723v1_random:37186-37208 CTTTTCTAAGCTCTGCCTACAGG - Intergenic
1202922549 14_KI270724v1_random:428-450 CTTTTCTAAGCTCTGCCTACAGG + Intergenic
1123756162 15:23399185-23399207 CATTCCTCAGCTCTGGCCCCTGG - Intergenic
1127416371 15:58761350-58761372 GGTTTCTGGGCTCTATCCCCAGG - Intergenic
1129936198 15:79451933-79451955 TGTCTCTTAGCTCTGTCCTCAGG - Intronic
1131131620 15:89904070-89904092 TGTTTCCAAGCTCAGTCACCCGG + Intronic
1133344461 16:5060550-5060572 GGGCTCTAAGCCCTGTCCCCTGG + Intronic
1135169893 16:20174655-20174677 CTCTTCTAAGCTCTGTCCAGTGG + Intergenic
1143103560 17:4517096-4517118 TGATTCCAAGCTGTGTCCCCAGG + Intronic
1143883674 17:10050424-10050446 GGTGTCCAAGCTCTGTCTCCAGG - Intronic
1146401370 17:32502691-32502713 CCTTTCTCTGCTCTGTCTCCAGG - Intronic
1146523303 17:33543790-33543812 CGTTTACTAGCTCTGTGCCCTGG - Intronic
1146564918 17:33904452-33904474 GGTATCTGAGATCTGTCCCCAGG + Intronic
1152359015 17:79821691-79821713 CATTTCCTAGCTCTGTGCCCTGG - Intergenic
1156688877 18:39682476-39682498 TGTTTCTAATCTCAATCCCCAGG - Intergenic
1157230844 18:45914656-45914678 CGTTTGTTAGCTCTGTGCCTTGG - Intronic
1161799235 19:6406514-6406536 TGTTTCTTAGCTCTGTTCACTGG - Intergenic
1163353508 19:16794641-16794663 CGTTGCTAACCTCTGGCCCTAGG - Intronic
925272342 2:2620817-2620839 GGTTCCAAATCTCTGTCCCCAGG + Intergenic
925829417 2:7879426-7879448 CATTTCAAAGATCTGTGCCCTGG + Intergenic
927790033 2:26002623-26002645 CGTTTCTAAGGTGTGTCAGCAGG + Intergenic
927962834 2:27251167-27251189 CGGTTCTGAGTTCTGGCCCCTGG - Intergenic
933090607 2:78111573-78111595 CTTTTCCAAGCTCTGTAGCCAGG + Intergenic
934048395 2:88190457-88190479 GTTTTCTCAGCTGTGTCCCCAGG + Intergenic
936291918 2:111232598-111232620 GGCTTCTATGCTCTGTCGCCCGG + Intergenic
943319670 2:186432136-186432158 CTTTTCCAAGCTCTGTAGCCAGG - Intergenic
1172020749 20:31912206-31912228 CGTCTCTTTGCTCTGTCCCTGGG + Intronic
1172355481 20:34276885-34276907 GGTTTCCTAGCTCGGTCCCCTGG + Intergenic
1173335835 20:42111907-42111929 CCATGCTAAGCCCTGTCCCCAGG - Intronic
1173499319 20:43540704-43540726 CATGCCTAAGCTCTGTCCCCTGG + Intronic
1175457313 20:59125154-59125176 AGTGTGCAAGCTCTGTCCCCAGG - Intergenic
1176225209 20:63994065-63994087 ATTTTCTAAACTGTGTCCCCTGG + Intronic
1177868404 21:26540419-26540441 TAGTTCTAAACTCTGTCCCCTGG - Intronic
1181629633 22:24143814-24143836 CTTTTCTACCCTCTGCCCCCTGG + Intronic
1181917306 22:26291648-26291670 CTTTTCTAAGCTGTGTGCTCTGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
1185366927 22:50441073-50441095 GGCTTCCAGGCTCTGTCCCCAGG + Intronic
949573315 3:5313983-5314005 CGGCTCTAGGCTCTGTCCCCTGG + Intergenic
951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG + Intronic
951878837 3:27460394-27460416 GCCTTCTAAGCTCTGTCCTCTGG + Intronic
952083847 3:29794259-29794281 TGTTCCTTAGCTCTCTCCCCAGG + Intronic
953053010 3:39362621-39362643 CCTCTGGAAGCTCTGTCCCCGGG - Intergenic
953201412 3:40781351-40781373 CCTTTCTAAGTTCTGCCCCGAGG + Intergenic
954906154 3:54064754-54064776 CGTTGCTCAGCTCTGGCCCTTGG + Intergenic
956440387 3:69274976-69274998 CCTTCCTATGCTCTTTCCCCAGG + Intronic
959148853 3:102583897-102583919 CCTTTCTAAGCTCTGATTCCCGG - Intergenic
961066603 3:123882062-123882084 GTTTTCTAAGATCTGGCCCCTGG + Intronic
963323534 3:143835897-143835919 CTTCTCTGAGATCTGTCCCCTGG + Intronic
969837720 4:9857182-9857204 AGGTTCTGAGCTATGTCCCCTGG - Intronic
970296252 4:14633937-14633959 TGTGTCTAAGCTCTGTCTCTTGG + Intergenic
976342890 4:83964635-83964657 CATTTCTAAGCTCTGTAGCCAGG + Intergenic
977227684 4:94412779-94412801 CATTTCTTGGCTCTGTTCCCAGG - Intergenic
987507516 5:18792961-18792983 CTTTTCCAAGCTCTGTAGCCAGG - Intergenic
988555567 5:32233008-32233030 CATTTCCTAGCTCTGTCTCCAGG - Intronic
991659115 5:68932468-68932490 CTTTTCCAAGCTCTGTAGCCAGG + Intergenic
993971182 5:94421873-94421895 TGTTTCTAAGGTCTGTGCCCTGG + Intronic
994787811 5:104186863-104186885 CGATTCCAAGCTCTGTAGCCAGG - Intergenic
995005996 5:107196068-107196090 CATTTCTACGCTCAGGCCCCAGG + Intergenic
996532467 5:124541006-124541028 CTTTTCTAAGTCCTGTGCCCAGG + Intergenic
998701387 5:144704059-144704081 TGTTTCTAGCCTCAGTCCCCAGG + Intergenic
999623153 5:153492067-153492089 GGTTTCTAGTCTCTCTCCCCTGG + Intronic
1001329286 5:170751125-170751147 CGTTTCTCTGATGTGTCCCCTGG - Intergenic
1011621886 6:89250872-89250894 GGTTTCTAAACTGTGTTCCCTGG - Intergenic
1012612602 6:101234106-101234128 AGTTTCTAATCTGTGTTCCCTGG - Intergenic
1015596871 6:134874621-134874643 CTTTTCCAAGCTCTGTAGCCAGG + Intergenic
1021101083 7:16586501-16586523 CTTTCCTGTGCTCTGTCCCCTGG + Intergenic
1021949407 7:25760257-25760279 CCTCTCTCAGCTCTGTCCCCAGG - Intergenic
1022744596 7:33157747-33157769 CCTTTCTAAGGTCAGTCTCCTGG + Intronic
1023865908 7:44238369-44238391 TGTCTCTCAGCACTGTCCCCTGG + Intronic
1024889483 7:54184125-54184147 CTCTTCTCAGCTCTGCCCCCAGG - Intergenic
1029127404 7:98304094-98304116 CCTTGCTCTGCTCTGTCCCCAGG - Intronic
1029183979 7:98725465-98725487 CTTCTCTCTGCTCTGTCCCCAGG + Intergenic
1032984707 7:137325195-137325217 CTTGTCTGATCTCTGTCCCCAGG + Intronic
1038264562 8:26028309-26028331 TATTTCTGAGCTCTGTTCCCAGG - Intronic
1039129116 8:34241621-34241643 CATTTCTAAGCTCACTCACCTGG + Intergenic
1040417392 8:47207419-47207441 CCTTCCTAAGCTCTCTCCCAGGG + Intergenic
1045455281 8:102372039-102372061 AGTTGCTAAGCTCTGTGTCCAGG - Intronic
1047294604 8:123559826-123559848 CTTTTGTAAGCTATGTCACCTGG + Intergenic
1050996558 9:12227093-12227115 CCTATCTATGCTCTTTCCCCAGG + Intergenic
1051175087 9:14352608-14352630 TGTTTCCATGCTCTGTCACCCGG + Intronic
1052786446 9:32832449-32832471 AGTTTCTAAGCTCTGTGGACAGG - Intergenic
1055348981 9:75365613-75365635 AGTTCCTGAGCTCTGTCCCAGGG + Intergenic
1057929203 9:99179079-99179101 CGGGTCTAAGCTCTGCCCCTGGG + Intergenic
1059269713 9:113064233-113064255 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059270847 9:113069681-113069703 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059273115 9:113080569-113080591 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059274251 9:113086015-113086037 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059995175 9:119902179-119902201 CGTTTCAAAGATCAGACCCCTGG + Intergenic
1203735797 Un_GL000216v2:138197-138219 CTTTTCTAAGCTCTGCCTACAGG - Intergenic
1203736064 Un_GL000216v2:140667-140689 CTTTTATAAGCTCTGTCTACAGG - Intergenic
1203739504 Un_GL000216v2:166640-166662 CTTTTCTAGGCTCTGTCTACAGG + Intergenic
1186605079 X:11080948-11080970 GTTTTCTAAACTCTGGCCCCAGG - Intergenic
1187549179 X:20284111-20284133 CCTTTCCAAACTCTGTCCTCTGG + Intergenic
1188461075 X:30427997-30428019 CTTTTCTATTCTGTGTCCCCAGG - Intergenic
1189255794 X:39638018-39638040 CACTTCTATGCTCTGGCCCCTGG - Intergenic
1189526487 X:41827702-41827724 CTTTTCTAAACTCTGTCAGCAGG - Intronic
1201125302 Y:10907740-10907762 CTTTTCTAGGCTCTGTCTACAGG + Intergenic
1201178848 Y:11327143-11327165 CTTTTCTAGGCTCTGTCCACAGG - Intergenic
1202625209 Y:56850183-56850205 CTTGTCTAGGCTCTGTCCACAGG + Intergenic