ID: 906151052

View in Genome Browser
Species Human (GRCh38)
Location 1:43588048-43588070
Sequence CTGCCCGCAGACCATGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906151047_906151052 10 Left 906151047 1:43588015-43588037 CCTCATCATGTTACTGCCATCGT 0: 1
1: 0
2: 0
3: 2
4: 112
Right 906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 161
906151045_906151052 25 Left 906151045 1:43588000-43588022 CCGTCTGTTCGGCGCCCTCATCA 0: 1
1: 0
2: 0
3: 34
4: 1149
Right 906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 161
906151046_906151052 11 Left 906151046 1:43588014-43588036 CCCTCATCATGTTACTGCCATCG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 161
906151048_906151052 -6 Left 906151048 1:43588031-43588053 CCATCGTCATGCCCATCCTGCCC 0: 1
1: 0
2: 1
3: 12
4: 197
Right 906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906151052 Original CRISPR CTGCCCGCAGACCATGTCCC TGG Intronic
900132404 1:1092629-1092651 CTGCTCACAGCCCTTGTCCCAGG - Intronic
900195745 1:1374747-1374769 CCGCCCACAGACCATGCTCCTGG - Exonic
900345435 1:2208229-2208251 CTGCACACAGACCATGGCCCTGG + Intronic
901451728 1:9340091-9340113 CGGCCCACAGACCATCACCCAGG - Intronic
905653394 1:39671421-39671443 CTGCCCCCAGCCCAGGGCCCAGG + Intronic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
914004911 1:143724026-143724048 CTGCCCCTACACCTTGTCCCTGG - Intergenic
915083049 1:153365167-153365189 CTCCCCACAGGCCATGTGCCTGG - Intergenic
915173514 1:153995604-153995626 GTGCCTGCAGACAACGTCCCTGG - Intronic
915613606 1:157016169-157016191 TTGCTCGCTGACCATGTGCCAGG - Intronic
919016713 1:192047669-192047691 CTGCTCCCACACCCTGTCCCTGG - Intergenic
920305206 1:205014228-205014250 CTCCCCGCAGACACTGACCCTGG + Intronic
1063002785 10:1940190-1940212 CTCCCCAGAGCCCATGTCCCGGG - Intergenic
1066509799 10:36083467-36083489 CTCCCCGCAGGCACTGTCCCAGG + Intergenic
1066745637 10:38602872-38602894 CAGCCCTCACATCATGTCCCAGG + Intergenic
1067045550 10:42983286-42983308 CTCCATGCAGACCTTGTCCCTGG + Intergenic
1067077558 10:43196875-43196897 CAGCCAGCAGGCCATCTCCCAGG + Intronic
1067811406 10:49429782-49429804 CTGACGGCAGACCATGGCACTGG + Intergenic
1073866190 10:107806903-107806925 TTGCCTGAAGACCATCTCCCTGG - Intergenic
1075592560 10:123703212-123703234 CTCCCCTCAGACCAGCTCCCAGG + Intergenic
1075653366 10:124144925-124144947 CTGCCCTCACTCCATGTGCCGGG - Intergenic
1076648890 10:131973583-131973605 CTCCCCACAGACTAAGTCCCAGG + Intronic
1076724441 10:132406928-132406950 AGGCCCCCACACCATGTCCCAGG - Intronic
1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG + Intergenic
1077506499 11:2932099-2932121 CTGCCCACAGTCCCTGCCCCAGG + Intergenic
1078152755 11:8773265-8773287 CTGCCTGCAGACCACGGCCAGGG + Intronic
1081283872 11:41245288-41245310 CTGCACGCAGTTCATGTCACTGG + Intronic
1081763986 11:45596665-45596687 CTGGCTGCTGACCATGTCCATGG + Intergenic
1084208392 11:67609309-67609331 CTGCCCTCCCAACATGTCCCAGG - Intronic
1084313850 11:68332383-68332405 CTGCCTGCAGAGCAAGGCCCGGG - Intronic
1084883475 11:72188677-72188699 CTGCAAGCAGACCAATTCCCAGG - Intergenic
1084956849 11:72696148-72696170 CTGCCCCCCGACCCTGTCCTTGG - Intronic
1087015783 11:93553291-93553313 CTGCCTGTAGACCATCTCACTGG - Intergenic
1088917960 11:114241352-114241374 CTCCTCACAGACCATGGCCCGGG - Intronic
1090080674 11:123610186-123610208 CTGCCCGCAGACCATGTACAAGG + Exonic
1091744527 12:2982617-2982639 CTGCCCGCGGCCCACATCCCGGG - Intronic
1092222429 12:6724157-6724179 CGGCCCGCAGAGCCTGACCCAGG + Exonic
1094112678 12:26878335-26878357 CCACCCACAGACTATGTCCCAGG + Intergenic
1094711975 12:32973532-32973554 CTTCCCCCAGACAATGTCCCAGG - Intergenic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1097172393 12:57124342-57124364 TTGAGCGCATACCATGTCCCAGG - Intronic
1106353627 13:28958004-28958026 GTGCTCGGAGACCATGCCCCAGG - Intronic
1106892496 13:34261148-34261170 CTGCCAACTGACCATGTCCAAGG - Intergenic
1108431900 13:50361769-50361791 GTGCCTGCAGACAATGTCCCCGG + Intronic
1113037980 13:106071980-106072002 CTGCCAGCAAACATTGTCCCAGG + Intergenic
1113483851 13:110640662-110640684 CTGCTCGCAGACCCTGGGCCAGG - Intergenic
1114736611 14:25049607-25049629 CTGCCCGCACAACGGGTCCCAGG + Intronic
1117169320 14:53075967-53075989 CTGCCCGCTGACAATGTACCTGG + Intronic
1119472823 14:74909998-74910020 CTTCCCTCAGGCCATGCCCCTGG - Exonic
1120788045 14:88554813-88554835 CGGCTCGCAGACCATTCCCCTGG + Intergenic
1124695596 15:31861961-31861983 CTGCTCCCAGAGCATGTCCTTGG - Intronic
1125201328 15:37102499-37102521 CGGCCCGCAGCCCCTCTCCCTGG - Intergenic
1128968645 15:72086649-72086671 CTGCCCACAGACCACTGCCCCGG - Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131173152 15:90192370-90192392 CTGCATGCAGGCCATGTCCTTGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132249912 15:100328049-100328071 CTACTCTCAGACCATGTCCAAGG + Intronic
1132373520 15:101313544-101313566 CTGGCAGAAGACCATGCCCCAGG + Intronic
1132401218 15:101506617-101506639 CAGACCACAGGCCATGTCCCAGG - Intronic
1132809458 16:1790588-1790610 CTCCCTGCTGACCAGGTCCCCGG - Exonic
1136573658 16:31110830-31110852 CTCCCCGCAGATCATGCCCCGGG - Intronic
1136737428 16:32476777-32476799 CAGCCCTCACATCATGTCCCAGG - Intergenic
1137520924 16:49194982-49195004 GTGCCTGCAAACCATTTCCCAGG - Intergenic
1138423231 16:56913315-56913337 CTGGCTGGAGACCCTGTCCCAGG + Exonic
1142411445 16:89919087-89919109 CTGCCCTCACACCCTCTCCCTGG - Exonic
1203015643 16_KI270728v1_random:352800-352822 CAGCCCTCACATCATGTCCCAGG + Intergenic
1203033978 16_KI270728v1_random:625958-625980 CAGCCCTCACATCATGTCCCAGG + Intergenic
1146185153 17:30719850-30719872 CTGCCCAAGGACCATGTACCTGG + Intergenic
1146287036 17:31581131-31581153 CTGCCCGCAGGCCAGGCCTCTGG - Intergenic
1148858482 17:50591927-50591949 CTGCCCGCAGATCCTGACCCAGG + Exonic
1150138421 17:62708771-62708793 CTGACTGCTGACCATGTCCCTGG - Intronic
1151903548 17:77033528-77033550 GTGCACGCAGACCCTCTCCCTGG - Intergenic
1151944445 17:77311850-77311872 CTGCCCGAGGACCTTGCCCCTGG + Intronic
1152230815 17:79113151-79113173 GTGTCCCCAGACCCTGTCCCTGG - Intronic
1152289038 17:79428407-79428429 CTGCCCTGATACCGTGTCCCTGG - Intronic
1152357084 17:79812696-79812718 CTGCCCTGAGCCCATGCCCCAGG + Intergenic
1152409962 17:80118219-80118241 CCGCCAGCAGCCCATGGCCCTGG + Intergenic
1155306693 18:24485384-24485406 CTGCCAGGTGAACATGTCCCAGG + Intergenic
1160738973 19:677260-677282 CTCCCCGAAGGCCACGTCCCTGG + Intronic
1161312000 19:3600041-3600063 CAGCCCGAAGGCCACGTCCCCGG + Exonic
1162830682 19:13282401-13282423 CTGCCCGCAGCCCATGACTGAGG + Intronic
1162968316 19:14166101-14166123 CCGCCCGCCGCCCATCTCCCTGG + Intronic
1162973626 19:14195839-14195861 CTGCCCGAGGATCATGTACCTGG - Intronic
1163502548 19:17685707-17685729 CTCTACGCAGACCATGTGCCTGG - Intronic
927705736 2:25295287-25295309 CAGCCCGCAGGCCCTGGCCCAGG + Intronic
929775535 2:44928951-44928973 CCGCCCGGAGACCGCGTCCCGGG - Intergenic
931852717 2:66269048-66269070 CTGCCCTAAGACCATCTTCCAGG + Intergenic
933151579 2:78921777-78921799 CTGCACACAGACCGTGGCCCTGG - Intergenic
933678186 2:85076533-85076555 CTGCCCGCAGTCCCCCTCCCTGG + Intergenic
933721094 2:85398259-85398281 CTGCCCACTGCCCAGGTCCCAGG + Intronic
936038018 2:109128420-109128442 CTGCCCGCCGACCAGCACCCTGG - Intergenic
936383315 2:112006739-112006761 CTGCCTGCAGACTATTCCCCAGG - Intronic
942654017 2:178195396-178195418 CTGCCCGCAGATCGTGTCGCCGG + Intronic
947353389 2:229269863-229269885 CTCCCCGCAAATCATGGCCCAGG + Intronic
948657511 2:239485824-239485846 CTGCCAGGATCCCATGTCCCTGG - Intergenic
948785488 2:240350235-240350257 CTGCACGCAGGCACTGTCCCAGG - Intergenic
948858635 2:240742384-240742406 CTCTCCCCCGACCATGTCCCTGG + Intronic
948884537 2:240876158-240876180 CTGCCCGCAGCCAGTGTACCCGG - Intronic
948927456 2:241108480-241108502 CAGCCAGCAGGCCATGTGCCAGG + Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1173916568 20:46712424-46712446 CTGCCCCCTGACCCTGTCCCGGG + Intronic
1175229353 20:57463909-57463931 CTTCCTGCAGGCCCTGTCCCTGG + Intergenic
1175939784 20:62532683-62532705 CAGCCCTCAGCCCATCTCCCCGG - Intergenic
1176220576 20:63967626-63967648 CTGGCCGCAGCCCCTGCCCCCGG - Intronic
1176869555 21:14074295-14074317 CTGCCAGCAGACCCTGGGCCGGG - Intergenic
1179271701 21:39856465-39856487 CTGACCACATACCATGTACCTGG + Intergenic
1179888249 21:44323691-44323713 CCGCCGGCAGAGCCTGTCCCCGG + Intronic
1181319735 22:21995132-21995154 CTGCCCACAGGGCTTGTCCCAGG - Intergenic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181600627 22:23949815-23949837 CTGCCCGCAGTTCCTGTTCCCGG + Intergenic
1181607884 22:23991507-23991529 CTGCCCGCAGTTCCTGTTCCCGG - Intergenic
1181779757 22:25184163-25184185 CTGCCCGCAGCCCAACTCCAGGG - Intronic
1183584226 22:38742832-38742854 CTGCACTCAGACCTTCTCCCCGG - Intronic
1184552375 22:45211155-45211177 CTGCCAGCAAACCATGGCCCCGG + Intronic
1184593147 22:45499241-45499263 CTGGCCTCAGACCCTGTCCCAGG + Intergenic
1184747376 22:46464241-46464263 CCGCCTGGAGAACATGTCCCAGG - Exonic
1184941073 22:47765654-47765676 CTGCCCGCACTCCATCCCCCTGG - Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
1185320755 22:50199341-50199363 CTGGCCACAGCCCATGTCCTTGG - Exonic
1185373761 22:50472770-50472792 CTGCCCTCAGCCCATGACCAGGG + Intronic
949942424 3:9165108-9165130 CTGCCAGCAGACCCAGGCCCTGG - Intronic
953923805 3:46970194-46970216 CAACCCGCAGACCAAGGCCCAGG + Intronic
961511613 3:127407126-127407148 CTCCCCGGAGACCACCTCCCTGG + Intergenic
963040291 3:141065289-141065311 CTGCCTGATGTCCATGTCCCTGG + Intronic
963969253 3:151411268-151411290 CTACCTGCAGACCATGCCACAGG + Exonic
965732246 3:171784539-171784561 CTGCACACATGCCATGTCCCAGG + Intronic
968483148 4:845688-845710 CTGCCCTCAGGCCACCTCCCTGG - Intergenic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
985173503 4:187176793-187176815 CTGCTCTCTGACCATGTCCTCGG + Intergenic
987304198 5:16622478-16622500 CTGCAGTCAGACCATGTCACGGG + Intergenic
989430834 5:41353479-41353501 CTGACCTCAGACCATATCCCAGG - Intronic
995052731 5:107724760-107724782 CTGCCCGCAGCCCCGGCCCCCGG + Intergenic
995181182 5:109231613-109231635 CTGCCAGCAGTCCATTTACCTGG - Intergenic
997436957 5:133882493-133882515 CTGCCCGCAGAGCGGCTCCCAGG - Intergenic
999236808 5:150103470-150103492 GTGCTTGGAGACCATGTCCCAGG - Intronic
1001073544 5:168607019-168607041 CCACCAGCTGACCATGTCCCTGG - Intergenic
1004922610 6:20390697-20390719 CAACCCGCAGCCCATGGCCCAGG - Intergenic
1006917441 6:37603522-37603544 CAGACCAAAGACCATGTCCCAGG + Intergenic
1006927198 6:37663639-37663661 CTGTGGGCAGACCATGTGCCAGG - Intronic
1011730402 6:90256881-90256903 CTGCCCACAACCCATATCCCTGG + Intronic
1012853093 6:104470233-104470255 CTGCACACAGACCATGTTCCTGG + Intergenic
1015148908 6:130018404-130018426 CTGCCCGCAGATCCTGTTTCAGG - Exonic
1017805914 6:157945528-157945550 GTGCCCACAGACCATCTCCCTGG - Intergenic
1019274162 7:167133-167155 CTTCCCGCAGACCAGCTCCTGGG - Intergenic
1019790839 7:3012848-3012870 CTGGCCGCCGATCCTGTCCCAGG - Intronic
1020652640 7:10894007-10894029 CTGCTTCCAGAACATGTCCCCGG + Intergenic
1021622679 7:22563847-22563869 CTCCCCACAGTCCACGTCCCGGG - Intronic
1022329298 7:29362393-29362415 CTGGGCACAGACCATGTGCCAGG - Intronic
1023350337 7:39314127-39314149 CTGCCTGCAGGTCAGGTCCCTGG + Intronic
1024291321 7:47806691-47806713 GTGCCTGCAGAACAGGTCCCTGG + Intronic
1024604931 7:51015163-51015185 CTACCCGCATCCCACGTCCCCGG - Intergenic
1025004269 7:55342865-55342887 CTGCCCTCAGCCCTTGTCCTTGG - Intergenic
1029707032 7:102281675-102281697 ATTCCAGCAGCCCATGTCCCTGG + Intronic
1030015786 7:105219320-105219342 CTGCTCCCAGAACATATCCCCGG + Intronic
1032617589 7:133491648-133491670 CTGCACGCAGAAAATGTTCCAGG - Intronic
1035136502 7:156708807-156708829 CCTGCCGCAGACCTTGTCCCAGG - Intronic
1037893342 8:22635854-22635876 CTTGCTGCAGGCCATGTCCCAGG - Intronic
1038038109 8:23703208-23703230 CTGCCCCCGAACCCTGTCCCAGG + Intronic
1038372316 8:27006564-27006586 CTGCCTGCAGGACAGGTCCCTGG - Intergenic
1038798191 8:30727692-30727714 CTGCCTGCAGGCCATGGCACGGG + Exonic
1040280625 8:46040109-46040131 CTGGCAGCAGCCCATTTCCCAGG + Intergenic
1042126976 8:65548083-65548105 CTGCCCACAGATAATATCCCAGG - Intergenic
1047715741 8:127593597-127593619 CTGCATGCTCACCATGTCCCAGG - Intergenic
1049226077 8:141451128-141451150 CTGCATGCAGACAGTGTCCCGGG + Intergenic
1051233377 9:14975331-14975353 CTGCCCAGAGACCAAGTCACTGG + Intergenic
1053053704 9:34981184-34981206 CTGCCCTCAGCCCAAGTACCTGG + Exonic
1061149214 9:128819343-128819365 CGGCCTGCAGACCCTGTGCCTGG - Intronic
1061328518 9:129878484-129878506 CTGCCAGCATCCCATCTCCCAGG - Intronic
1061824165 9:133247470-133247492 CTGCTGGCAGAGCTTGTCCCTGG - Intergenic
1062125334 9:134857516-134857538 CTGTCCTCAAACCCTGTCCCTGG - Intergenic
1062258460 9:135643573-135643595 GTGGTCGCAGAGCATGTCCCAGG - Intergenic
1062592074 9:137278682-137278704 CTGGCCGCGGTCCATGTCGCAGG - Exonic
1186997846 X:15142695-15142717 CTGACCACAAACCATGTCACAGG + Intergenic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1192341543 X:70267610-70267632 CTGCCAGAAGAACCTGTCCCTGG + Intergenic
1198298240 X:135307999-135308021 CTGGCCTCAGAGCTTGTCCCTGG - Intronic
1199402686 X:147417630-147417652 CTTCCCCCAGAGAATGTCCCTGG - Intergenic
1200111245 X:153741997-153742019 CAGCCCTCACATCATGTCCCAGG + Intronic
1201038748 Y:9808448-9808470 CTGCTCCCACTCCATGTCCCAGG - Intergenic