ID: 906151250

View in Genome Browser
Species Human (GRCh38)
Location 1:43588886-43588908
Sequence TCCAGGACGTTGCGGCCAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906151250_906151253 18 Left 906151250 1:43588886-43588908 CCAGTTGGCCGCAACGTCCTGGA 0: 1
1: 0
2: 0
3: 2
4: 58
Right 906151253 1:43588927-43588949 CTCTGCCAACTACACCTGTGTGG 0: 1
1: 0
2: 2
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906151250 Original CRISPR TCCAGGACGTTGCGGCCAAC TGG (reversed) Exonic
905866596 1:41380333-41380355 ACCAGGAAGTTGAGGCCACCAGG + Intronic
905913105 1:41667295-41667317 TCCATGAGCTTGAGGCCAACTGG - Intronic
906151250 1:43588886-43588908 TCCAGGACGTTGCGGCCAACTGG - Exonic
1063388985 10:5636247-5636269 ACCATGCCGTTGTGGCCAACAGG + Intergenic
1063706093 10:8432255-8432277 CCCAGGAGTTTGCGACCAACAGG + Intergenic
1067133317 10:43585854-43585876 TCCTGAACTTTGCGGCCAACAGG + Intergenic
1075951270 10:126479576-126479598 TCCAGGACGCAGCTGACAACAGG + Intronic
1076604246 10:131678813-131678835 TCCTGGACTCTGCAGCCAACAGG - Intergenic
1080600882 11:33819794-33819816 ACAAGGACGCTGCGGCCGACAGG - Intergenic
1096333898 12:50738431-50738453 GCCAGGAGTTTGAGGCCAACTGG + Intronic
1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG + Intergenic
1101245493 12:102880376-102880398 TCCAGGACATTGCCACCAAGGGG + Intronic
1103403414 12:120658701-120658723 TGCAGGCCGTTCCAGCCAACGGG - Intronic
1109790971 13:67247127-67247149 TCCAGGAGTTTGAGGCCAGCCGG + Intergenic
1116938890 14:50770723-50770745 TCCAGCAAGGTGTGGCCAACAGG + Intronic
1126459045 15:48895870-48895892 TCCAGGACTTCGAGACCAACTGG + Intronic
1129117765 15:73374814-73374836 TCCAGGACGTCTGGGCCACCTGG + Intergenic
1131068700 15:89450471-89450493 TCCAGGGCACTACGGCCAACTGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143026716 17:3945353-3945375 TCCAGGACATTGGGACAAACCGG - Intronic
1146781455 17:35677198-35677220 CCCAGGACATTGAGACCAACTGG - Intronic
1160744550 19:704479-704501 GCCAGGCCGTTCCGGCCACCTGG + Intergenic
1161611539 19:5245868-5245890 TCCAGCACGTTCCGACCCACGGG + Exonic
1161949285 19:7458846-7458868 TGTTGGACGTTGAGGCCAACGGG + Intronic
1162750334 19:12825736-12825758 TCCTGGACGCTGCGGGCAGCGGG - Exonic
1163198724 19:15746330-15746352 TCCAGGAGTTTGAGACCAACTGG - Intergenic
1167390172 19:49189726-49189748 TACAGGAAGTTGTGCCCAACAGG + Intronic
925024320 2:595700-595722 TCCAGGACGTGGGGGCCCTCCGG - Intergenic
925343030 2:3149760-3149782 TCCTGGACGTTCCTGCCAAGGGG + Intergenic
929124645 2:38512145-38512167 TCCAGGAGTTTGAGGCCACCTGG - Intergenic
934901617 2:98164177-98164199 TCCAGGACCTTGCGGCAGAAGGG + Intronic
936100532 2:109574226-109574248 TCCAGGAGTTTGAGACCAACTGG + Intronic
938261216 2:129896316-129896338 TCCTGGAGCTTGAGGCCAACGGG - Intergenic
1168863376 20:1062666-1062688 TCAAGGAGGGTGCTGCCAACTGG - Intergenic
1171266113 20:23773390-23773412 TCCAGGGCTTTGCAGCTAACAGG + Intergenic
1172279991 20:33701614-33701636 TCCCGGACGGGGCGGCCAGCCGG - Intergenic
1174878296 20:54250483-54250505 TCCCGGACGGGGCGGCCAGCCGG + Intergenic
1183211585 22:36454850-36454872 TCCAGGACGGCGCAGCCCACCGG - Intergenic
1184415589 22:44350184-44350206 TGCAGGACGTTCCGGGCAGCTGG - Intergenic
1185263731 22:49886316-49886338 TCCAGGACGTCCCGTCCAAGTGG + Exonic
954941191 3:54374768-54374790 TACAGGACTTGGAGGCCAACAGG - Intronic
961503480 3:127354765-127354787 TCCAGCACCTTGCTGCCCACAGG + Intergenic
969274351 4:6124910-6124932 TCCAGGACTATGAGGCCAGCTGG + Intronic
984804201 4:183736896-183736918 TCCCGGACGGGGCGGCCAGCCGG + Intergenic
986619822 5:9660530-9660552 TTAAGGACGTTGCGGCCATTGGG - Intronic
989379636 5:40800392-40800414 TCCCGGACGTGGCGGCCGGCCGG - Intergenic
999431093 5:151525934-151525956 TGCAGGACTTTGCTGCCAATGGG + Exonic
999993720 5:157071792-157071814 TCCAGGAGTTTGAGACCAACCGG + Intergenic
1003939692 6:11011892-11011914 TCCAGGAAGGTGGGGCCAGCGGG + Intronic
1005653838 6:27911872-27911894 TCCAGGATGCAGCTGCCAACTGG + Exonic
1013365275 6:109432988-109433010 TCCAGGAAGTATCGACCAACTGG - Intronic
1017955212 6:159171420-159171442 TCCATGACGTTGCTGTCAAAGGG - Intronic
1019233379 6:170587193-170587215 CCCAGGAGTTTGAGGCCAACCGG - Intergenic
1019337270 7:491369-491391 TCCAGGGCCTTGGGGCCACCAGG + Intergenic
1023515602 7:40998154-40998176 GCCAGGAGGTTGAGACCAACCGG + Intergenic
1029276653 7:99409058-99409080 TCCAGGACGGTGCAGACCACCGG - Intronic
1035379612 7:158429400-158429422 TCCAGGACCTTCCCGCCATCAGG + Intronic
1038595149 8:28881144-28881166 TCCCGGACGGGGCGGCCAGCCGG - Intronic
1042618677 8:70678700-70678722 TCAAGAATGTTGTGGCCAACAGG - Intronic
1048752589 8:137697060-137697082 TCCAGGATGTTGAGGCAGACTGG - Intergenic
1060308615 9:122438989-122439011 TCCAGGAGTTTGAGACCAACTGG - Intergenic