ID: 906151511

View in Genome Browser
Species Human (GRCh38)
Location 1:43590546-43590568
Sequence ATGTGTAATAGGCAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906151511_906151520 0 Left 906151511 1:43590546-43590568 CCCTTCCCCTGCCTATTACACAT 0: 1
1: 0
2: 1
3: 15
4: 293
Right 906151520 1:43590569-43590591 ACTTTCCACCAGGTGGGCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 120
906151511_906151517 -10 Left 906151511 1:43590546-43590568 CCCTTCCCCTGCCTATTACACAT 0: 1
1: 0
2: 1
3: 15
4: 293
Right 906151517 1:43590559-43590581 TATTACACATACTTTCCACCAGG 0: 1
1: 0
2: 0
3: 8
4: 155
906151511_906151518 -7 Left 906151511 1:43590546-43590568 CCCTTCCCCTGCCTATTACACAT 0: 1
1: 0
2: 1
3: 15
4: 293
Right 906151518 1:43590562-43590584 TACACATACTTTCCACCAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 124
906151511_906151523 13 Left 906151511 1:43590546-43590568 CCCTTCCCCTGCCTATTACACAT 0: 1
1: 0
2: 1
3: 15
4: 293
Right 906151523 1:43590582-43590604 TGGGCTCAGGTGACCTGCAGAGG 0: 1
1: 0
2: 3
3: 28
4: 284
906151511_906151519 -6 Left 906151511 1:43590546-43590568 CCCTTCCCCTGCCTATTACACAT 0: 1
1: 0
2: 1
3: 15
4: 293
Right 906151519 1:43590563-43590585 ACACATACTTTCCACCAGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906151511 Original CRISPR ATGTGTAATAGGCAGGGGAA GGG (reversed) Intronic
900194938 1:1371331-1371353 ATGTCTCACAGGCAGGGGCAGGG + Intergenic
901610510 1:10494292-10494314 ATCTGTAATAGCCGGGAGAATGG + Intronic
902090458 1:13898826-13898848 TTGTTTAAAAGGCAGGGAAAGGG - Intergenic
905959966 1:42035548-42035570 TTGTGTAATCGGCCCGGGAAGGG + Intronic
906009904 1:42513190-42513212 AAGTTTAATAGGCAGAAGAAAGG + Intronic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
906922431 1:50078819-50078841 ACATGTGATAGGCACGGGAATGG - Intronic
907655578 1:56338943-56338965 ATGAGTAATAAGCACAGGAAAGG - Intergenic
908087629 1:60653305-60653327 ATGTGTGATAGGCTGAGTAATGG - Intergenic
908183706 1:61631334-61631356 ATATGGAATAGGCAAGGTAAAGG - Intergenic
908389587 1:63672576-63672598 AGGTTTAATAGGCAAGAGAAAGG + Intergenic
908617957 1:65944553-65944575 ATGTTTTATAGACAGGGAAATGG + Intronic
909494914 1:76267699-76267721 ATGTGTAATAGGCAAATGAAGGG + Intronic
909800481 1:79801493-79801515 CTGTGTAATAGGCAGGGTTTAGG + Intergenic
910008868 1:82435755-82435777 GTGTGTAATAGGGAGAGGCAGGG + Intergenic
910285102 1:85545073-85545095 ATGTCTGAGAGGCAGGGCAAGGG - Intronic
911104121 1:94116806-94116828 ATGTGTAAAGGGCAGGGTAGGGG - Intronic
911330264 1:96518694-96518716 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
911483952 1:98482358-98482380 ATGAGGAAGAGGGAGGGGAATGG - Intergenic
912628236 1:111223741-111223763 ATATGTAAGAGGCAGGATAAAGG - Intronic
913671512 1:121100800-121100822 ATGTGTGATAGGGAGATGAAGGG - Intergenic
914023283 1:143888236-143888258 ATGTGTGATAGGGAGATGAAGGG - Intergenic
914661767 1:149796178-149796200 ATGTGTGATAGGGAGATGAAGGG - Intronic
914867416 1:151443054-151443076 ATGTGTAATACCCAGGGCCAGGG + Intronic
916530643 1:165653260-165653282 ATGTGTGATAGGAATGGGGATGG - Intronic
916903904 1:169260667-169260689 ATGTTTAATCTGCAGAGGAAAGG + Intronic
917637842 1:176954407-176954429 ATCTGCAAAAGGCAAGGGAATGG + Intronic
918473040 1:184894638-184894660 AGGTGTAATGGATAGGGGAACGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921534585 1:216330416-216330438 ATGTGGCATTGACAGGGGAATGG + Intronic
921707902 1:218345461-218345483 AAGTGAAAGAGGCAGGGGAGGGG + Intergenic
922799492 1:228358611-228358633 ATGAGTAACAGGCAGGGAACTGG + Intronic
923237086 1:232044932-232044954 ATGTGAAACAGGCAGGGGCCAGG - Intergenic
1068601435 10:58961058-58961080 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
1069925502 10:71847617-71847639 AAGTTTAATAGGCAGAAGAAAGG - Intronic
1070252378 10:74784261-74784283 ATGTGAAGTAGGGAGGGGAGGGG + Intergenic
1071905790 10:90172193-90172215 AAATGTAAAAGGCAGGGCAAAGG - Intergenic
1072252155 10:93590187-93590209 ATGTTTAATAGGCAGAAGAAAGG + Intronic
1073093453 10:100965209-100965231 ATGTTTAAAAGCCAGGGGACTGG - Intergenic
1074844659 10:117386939-117386961 TTGGGAAATAGGCAGGGGGATGG - Intergenic
1076238624 10:128884789-128884811 AAGTGTAACATGCAGAGGAAGGG - Intergenic
1079954654 11:26847970-26847992 ATGTGTTATAGGTTGGGGAGAGG + Intergenic
1081298808 11:41425287-41425309 AGGTGTGAAGGGCAGGGGAAGGG + Intronic
1081505919 11:43716844-43716866 AGGTGAAGGAGGCAGGGGAAAGG + Intronic
1081690498 11:45074656-45074678 ATGTGTGAGAGGCAGGGCAGAGG + Intergenic
1081792593 11:45798954-45798976 ACGGGAAATAGGCAGGGGATTGG - Intergenic
1084099474 11:66936429-66936451 ATGGTTAATGGGCAGGGGAGAGG + Intronic
1085079700 11:73624148-73624170 CAGTGTGATAGGCAGGGGAGGGG + Intergenic
1085621707 11:78042721-78042743 AAGTTTAATAGGCAAGAGAAAGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085968044 11:81553006-81553028 AAGTGTAATAAGTAGAGGAAGGG - Intergenic
1087487166 11:98770773-98770795 ATGGGGAAGAGGGAGGGGAAGGG + Intergenic
1088833100 11:113554892-113554914 AAGTCTAATAGGCAGAAGAAAGG - Intergenic
1089628604 11:119769593-119769615 CTGTGCAAAATGCAGGGGAAGGG + Intergenic
1090912286 11:131131823-131131845 ATGGGTAGTTGGCTGGGGAAAGG - Intergenic
1091547341 12:1510230-1510252 ATGGGTTAGAGGCCGGGGAAGGG - Intergenic
1092064217 12:5576393-5576415 AAGTGTAATGGGCAAGGAAATGG + Intronic
1094249395 12:28341614-28341636 AAGTGTAATAGGCAGAATAATGG - Intronic
1094331964 12:29303559-29303581 AGGTGTGAGAGGCAGGGGAATGG + Intronic
1094424552 12:30304819-30304841 ATGTGAGTTAGGCAGGAGAAGGG + Intergenic
1094772192 12:33676012-33676034 AAGTGTGACAGGCAGAGGAAAGG - Intergenic
1096086123 12:48866081-48866103 ATTTGTATTAGGAAGTGGAAAGG + Intergenic
1096122490 12:49097329-49097351 ATGTGCAATAGGGTGGGGTAGGG - Exonic
1098562882 12:71896863-71896885 ATTTGGAATAGACTGGGGAATGG + Intronic
1098580849 12:72097215-72097237 GTGGGTAAGAGGCAGTGGAAAGG + Intronic
1098859036 12:75687012-75687034 AAGTGTGATAGGAAGGGTAACGG - Intergenic
1099432602 12:82605827-82605849 ATGTGTGAAAGACAGAGGAAAGG - Intergenic
1100189660 12:92177037-92177059 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
1100216056 12:92449920-92449942 ATGTGTAGTAGGCTGGTGAAGGG - Intergenic
1101444320 12:104726663-104726685 AGGTGTAATGGGCTGGGAAAGGG + Intronic
1101584439 12:106072685-106072707 ATGTGTATGGGGCAGGGGAGGGG - Intronic
1106150749 13:27099330-27099352 ATGTGTAACAGGCAGTGACAGGG - Intronic
1106896457 13:34308030-34308052 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
1106928083 13:34633847-34633869 TAGTTTCATAGGCAGGGGAATGG - Intergenic
1106949317 13:34865184-34865206 ATTTGTAATAGGCCAGGCAAGGG - Intergenic
1109620134 13:64893085-64893107 ATGTGTGTTAGGCAAGGGGATGG - Intergenic
1111151683 13:84261899-84261921 ATGGTTAAAAGGCAGGGGAGTGG + Intergenic
1111203822 13:84976728-84976750 GGGTGGATTAGGCAGGGGAATGG + Intergenic
1114412888 14:22517418-22517440 AAGTGTCAGAGGCAGGGGAGAGG + Intergenic
1114587019 14:23824784-23824806 ATGTTTAAGAGGCTGGGGCATGG + Intergenic
1115405148 14:33006484-33006506 GTGAGTAATTGGCAGGGGGAGGG + Intronic
1115763412 14:36598206-36598228 ATGTGTGATTGGCAGGAGACAGG - Intergenic
1115799050 14:36971658-36971680 AAGTTTAATAGGCAGAAGAAAGG - Intronic
1116498445 14:45591089-45591111 ATGAGTAATTGGGAGGTGAAGGG + Intergenic
1118625669 14:67656798-67656820 AAGTGTAAAAGGCAGTGGAGTGG - Intronic
1119409675 14:74422592-74422614 GTGTGTATCACGCAGGGGAAGGG + Intronic
1119459838 14:74791498-74791520 ATGTGTAAAAGCCAGAAGAAAGG - Intronic
1121288995 14:92759224-92759246 AGGTTTAATAGGCAAGAGAAAGG + Intergenic
1126268718 15:46787109-46787131 ATGTCTAATAGGTGGAGGAAAGG + Intergenic
1127354292 15:58183166-58183188 ATTTTTAAAAAGCAGGGGAATGG - Intronic
1128074961 15:64820168-64820190 ATGGGGAATAAGCAGGGGCAGGG + Intronic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1129235365 15:74220589-74220611 ATGTGTGCGAGGGAGGGGAAAGG + Intergenic
1130437851 15:83919858-83919880 AATTGTAATAAGCAGGGAAAAGG + Intronic
1130860840 15:87888129-87888151 ATGTGTGATAGGTCAGGGAAAGG - Intronic
1132082389 15:98878063-98878085 ATGTGTAATAGGCAGTGTATCGG + Intronic
1133598870 16:7319728-7319750 ATGTGAAGCAGGCAGAGGAAAGG + Intronic
1133728899 16:8561221-8561243 CTGTGCTATAGGCAAGGGAAGGG - Intergenic
1134103054 16:11466078-11466100 CTGTGTAATAGTCCGTGGAATGG - Intronic
1134186432 16:12088520-12088542 ATGTGAAAATGGCAGAGGAATGG + Intronic
1135472671 16:22745482-22745504 ATGAGTTATAGGCAGGGAAGAGG + Intergenic
1136358621 16:29763054-29763076 ATGGGTAATTGCCAGGGGCAGGG - Intergenic
1137673977 16:50294786-50294808 GGGTGTAATAGGCAGGGGAGGGG - Intronic
1138110329 16:54318723-54318745 AAGTGTTCCAGGCAGGGGAATGG + Intergenic
1139277879 16:65744607-65744629 ATGGGGAATAGGAAGAGGAAAGG + Intergenic
1139279950 16:65761998-65762020 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
1139972305 16:70783724-70783746 TTGTTTAATGTGCAGGGGAATGG + Intronic
1140902467 16:79382026-79382048 AAGTGGAAGAGACAGGGGAAAGG - Intergenic
1142756530 17:2019568-2019590 AGGAGGAAAAGGCAGGGGAAGGG - Intronic
1142989782 17:3722805-3722827 ATTTTTAATAAGCAGGGGAATGG + Intronic
1143843091 17:9750322-9750344 ATATGTACTGGGCAGTGGAATGG + Intergenic
1143871306 17:9959006-9959028 ATGTGAAATTGACAGGAGAAGGG + Intronic
1146266353 17:31455565-31455587 ATGTGTACAAGGCAGAGGACTGG - Intronic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1147314608 17:39613671-39613693 TTGTGCAAAAGGCAAGGGAAGGG - Intergenic
1148016510 17:44525291-44525313 TTGTGGAATAGAAAGGGGAAAGG + Intergenic
1148809934 17:50283901-50283923 CTGAGAGATAGGCAGGGGAAGGG - Intergenic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149060924 17:52420792-52420814 ATTAGGAATAGGCAGGGGTAGGG + Intergenic
1149514991 17:57274194-57274216 ATGTGTAAAATGCAGGGTGATGG - Intronic
1150478619 17:65492386-65492408 ATGTGTGATGGGGAAGGGAATGG - Intergenic
1150550104 17:66202359-66202381 TTGTAGAATAGGCTGGGGAAGGG + Intergenic
1151236846 17:72726746-72726768 ATATGTATAAGCCAGGGGAAAGG + Intronic
1151381602 17:73729654-73729676 ATGGGTGATAGGAAGGGGACGGG - Intergenic
1153552850 18:6280565-6280587 ATGTGTGATAGGTAGGATAACGG + Intronic
1156764098 18:40630456-40630478 ATGTGTGATAGGCAGAATAATGG - Intergenic
1156784118 18:40889738-40889760 ATGTGGAATATGCAGAGGAATGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161826917 19:6573888-6573910 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
1163013390 19:14439447-14439469 ATATGTGGTAGGCATGGGAATGG + Intronic
1166210794 19:41305545-41305567 ATGTCCACTAGGCAAGGGAAGGG + Intronic
1167551984 19:50167682-50167704 ATGTGTACTAGGGAGGGGGCTGG - Intergenic
925041964 2:739513-739535 CTGTGCAGGAGGCAGGGGAATGG + Intergenic
925250591 2:2433825-2433847 ATGTGATAGAGGAAGGGGAAGGG + Intergenic
927959625 2:27233021-27233043 ATCTGCAAGAGGGAGGGGAAGGG - Exonic
928835916 2:35544827-35544849 ATATGTAAAATGTAGGGGAATGG - Intergenic
929356003 2:41025392-41025414 ATGTGCAAGAGGGAGAGGAAGGG + Intergenic
929885991 2:45879110-45879132 ATGTGTAGGATGCAGGGGCAGGG - Intronic
934044487 2:88161181-88161203 ATTTGTCAAAGGAAGGGGAAAGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
938981205 2:136528956-136528978 TTGAGAAATAGGCAGGGGCAGGG - Intergenic
939006610 2:136795547-136795569 TAGTGTAATAGGCAGGATAACGG - Intronic
939510398 2:143097635-143097657 AAGTGTAACAAGTAGGGGAAGGG + Intronic
939718703 2:145619090-145619112 ATATGTTAATGGCAGGGGAATGG + Intergenic
941483317 2:166045716-166045738 ATGAGTTTAAGGCAGGGGAATGG + Intronic
942065219 2:172264536-172264558 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
943544464 2:189257624-189257646 ATGTGTGATATGCAGGGAAATGG + Intergenic
944055409 2:195517407-195517429 ATGTGTAATAGGCAGGAAAATGG - Intergenic
944590630 2:201214169-201214191 AAGTGTAATAAGTAGGGGGAGGG + Intronic
946980434 2:225208078-225208100 ATGTGTAATATGAATGGAAAAGG + Intergenic
948157525 2:235795439-235795461 ATGAGGAATAGGAAGGGGAAAGG - Intronic
1168854463 20:998945-998967 ATGTGTAATATGTTTGGGAAAGG + Intronic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1172038675 20:32028698-32028720 CTGTGCAAAAGGGAGGGGAAAGG + Intronic
1172169040 20:32917822-32917844 ATGTGTAGTAGCAATGGGAAAGG - Intronic
1173215947 20:41083689-41083711 ATGTTGAATAGGCAGGACAAAGG + Intronic
1173582771 20:44159316-44159338 AAGTGGAATGGGTAGGGGAATGG + Intronic
1173901499 20:46593017-46593039 ATATGTAATAAGGAGGGCAAAGG - Intronic
1174599894 20:51715824-51715846 AGCTTTAATGGGCAGGGGAAGGG + Intronic
1174947560 20:55005029-55005051 AAGTGAAATGGGGAGGGGAAAGG + Intergenic
1175924114 20:62463466-62463488 ATGGGTGATGGGCGGGGGAAGGG + Intergenic
1176668821 21:9712795-9712817 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
1177062151 21:16389220-16389242 AGGTGGAAAAGGCAGAGGAAAGG - Intergenic
1179106860 21:38408806-38408828 ATGTGTAGGAGGAAGGGGAGGGG + Intronic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1180607290 22:17068341-17068363 ATGTGTGGGAGGCAGAGGAAAGG + Intergenic
1181468236 22:23122242-23122264 ATGTGTTATAGCCAGGGGTCTGG - Intronic
1183838738 22:40479479-40479501 AGGTTTAATAGGCAGAAGAAAGG - Intronic
1184109569 22:42387144-42387166 GTGTGTAACAGGCAGGGGGCTGG - Intronic
1184631517 22:45784385-45784407 ATGGGAAATAGGCGAGGGAAAGG - Intronic
951671439 3:25187534-25187556 ATGTGTTAGAGACAGGAGAAAGG + Intronic
951823059 3:26835570-26835592 TTGTGAATTTGGCAGGGGAAGGG + Intergenic
952029861 3:29128759-29128781 ATGTGCAAAAGGCAGGGGGTAGG - Intergenic
952546508 3:34425764-34425786 ATGTGTAGTAGGCAGAATAATGG + Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
953215654 3:40915283-40915305 ATATGAAATATGAAGGGGAAGGG - Intergenic
954514364 3:51159133-51159155 GTATGTTATAGGCAGGGGAAGGG - Intronic
955306790 3:57840898-57840920 GTGTGTAATAGGTTGGGGAAGGG + Intronic
955411436 3:58658003-58658025 ATGTGCAAGTGGCAGTGGAAAGG + Intronic
957453323 3:80408506-80408528 CTGTGTAAGTGACAGGGGAAAGG - Intergenic
957941193 3:87006403-87006425 GTGTGTAATTGGCTGGGTAAAGG + Intergenic
958604728 3:96342442-96342464 ATGTGTAATAGGCTTGTGAGAGG - Intergenic
962862811 3:139420096-139420118 AGGTGTAATGGGCAGGGAACTGG + Intergenic
963071268 3:141307426-141307448 ATGTGTGATAGGGATGGAAAAGG - Intergenic
963173929 3:142279427-142279449 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
963175009 3:142289108-142289130 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
964479530 3:157127896-157127918 TTCTGTAATAGGCAGAGGACTGG - Intergenic
964776034 3:160278545-160278567 AAGCGTAATAGGCAGAAGAAAGG - Intronic
966429690 3:179818591-179818613 AAGGGTAATGGGCAGGGGAGGGG - Intronic
966521783 3:180881505-180881527 AAGTTTAATAGACAGGAGAAAGG - Intronic
966899809 3:184473007-184473029 ATTGGTAAGGGGCAGGGGAAGGG - Intronic
966979483 3:185117960-185117982 ATGTGTAATAGAGTGGGGATTGG - Intronic
967207607 3:187138399-187138421 ATGTGTAAAAGGCAAGGAAGTGG + Intronic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
968801616 4:2746795-2746817 GTGTGTGGCAGGCAGGGGAATGG - Intronic
970012015 4:11469664-11469686 ATGTTTGGTTGGCAGGGGAAAGG + Intergenic
972807859 4:42548694-42548716 ATGTGTGAGTGGGAGGGGAAGGG - Intronic
976259629 4:83133713-83133735 AAGTTTAATAGGCAGAAGAAAGG + Intronic
977355381 4:95939848-95939870 AAGTGGTATAGGCAGGTGAAGGG - Intergenic
977494502 4:97758220-97758242 ATGTGTAAAAGAAAAGGGAAAGG + Intronic
978789888 4:112651128-112651150 ATGGGTGACAGGCAGGGTAAGGG - Intronic
979312330 4:119217813-119217835 ATGTATTCCAGGCAGGGGAATGG + Intronic
979992285 4:127389436-127389458 ATGAGTAAAAGGAAGGGGTAGGG + Intergenic
982335318 4:154230374-154230396 GTGAGTAATAGAGAGGGGAAAGG - Intergenic
983813950 4:172099245-172099267 AAATGTAATGGTCAGGGGAATGG + Intronic
985405962 4:189638730-189638752 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
985759895 5:1743106-1743128 CTGTGCTTTAGGCAGGGGAAAGG - Intergenic
986758190 5:10857005-10857027 CTGTGTCATCGGCAGGGCAAAGG - Intergenic
986969580 5:13316247-13316269 ATGTGAAAAAGGCATGAGAAGGG + Intergenic
987004904 5:13700329-13700351 ATAATTAATAGGCATGGGAAAGG - Intronic
988618977 5:32803105-32803127 AAGTTTAATAGACAGGAGAAAGG - Intergenic
989522667 5:42420232-42420254 ATGTATAAAAGACTGGGGAAGGG + Intergenic
990285344 5:54296171-54296193 ATGCGTATTAGGCAGAGGCAGGG + Intronic
991215912 5:64157297-64157319 TTTTGTACTAGGCAGGGGTAAGG - Intergenic
991306491 5:65181873-65181895 ATGTGAAGGAGGCAGGGGAGTGG - Intronic
991476792 5:67029786-67029808 ATGTGAAAAAGGTAGGAGAAAGG + Intronic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
993349823 5:86835911-86835933 AGGAGTATTGGGCAGGGGAATGG + Intergenic
994385933 5:99131728-99131750 AAGTAAAATAGGCATGGGAATGG - Intergenic
995507989 5:112880350-112880372 GTGTGTAAGATGGAGGGGAAAGG + Intronic
995853891 5:116573762-116573784 GTGTGTCGAAGGCAGGGGAAGGG - Intronic
997183879 5:131861491-131861513 ATGTTTAATGGGCATGGGGAAGG + Intronic
997520428 5:134520275-134520297 CTGTGTACTAGGCATGGTAATGG - Intergenic
998648961 5:144095824-144095846 ATGTAAAAAAGACAGGGGAATGG - Intergenic
1003612931 6:7629794-7629816 ATGTGTGATGGGCAGAGGAGGGG - Intergenic
1006890519 6:37423715-37423737 AAGTTTAATAGGCAGGAGAAAGG + Intergenic
1010493504 6:76503387-76503409 ATGGGGGATAGGCAGGGGGAGGG - Intergenic
1010656641 6:78519037-78519059 AGATGTAAAAGGCAGGTGAATGG - Intergenic
1011050979 6:83149441-83149463 TTGTGAAACAGGAAGGGGAAGGG + Intronic
1013458921 6:110357603-110357625 TTGCGTGATAGGCAGGGAAAGGG - Intronic
1013475832 6:110506470-110506492 ATGTGTATGAGACAGTGGAAAGG + Intergenic
1015018159 6:128439195-128439217 ATGTGAAGCAGGAAGGGGAAGGG - Intronic
1015083900 6:129264107-129264129 ATGAATAATAGGAAGGAGAAGGG + Intronic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1018823716 6:167393666-167393688 ATGTGTGATAGGCAGAATAATGG + Intergenic
1019555054 7:1625141-1625163 ATGTGTAGAAGGCAGGGCAGTGG - Intergenic
1021367079 7:19792980-19793002 AAGTTTAATAGGCAAGAGAAAGG + Intergenic
1023709902 7:42980854-42980876 ATGAGCACTAGGCTGGGGAAAGG - Intergenic
1023781435 7:43659749-43659771 ATGTAAAACAGGCAGGGGAGTGG - Intronic
1025717285 7:63972122-63972144 GTTTGTAAAAGGCAGGGCAATGG + Intergenic
1027591076 7:80119932-80119954 ATTTTTAACAGGAAGGGGAATGG - Intergenic
1028108134 7:86904716-86904738 AAGTGAAATGGGCAGGAGAAAGG - Intronic
1028743113 7:94298696-94298718 ATGGGCTATGGGCAGGGGAAGGG - Intergenic
1028842190 7:95440733-95440755 ATGTGTACAAGGCAGAGGTATGG + Intergenic
1029046158 7:97631212-97631234 ATGAGTAATATGCAGGGTAAAGG + Intergenic
1029358790 7:100072963-100072985 ATGTGTGTTAGGGACGGGAACGG + Intronic
1030273784 7:107697851-107697873 GTGTGGAATCGGCAGGGGAGGGG - Intronic
1030278205 7:107742983-107743005 AAGTGTAAAAGGCTGGAGAAAGG + Intergenic
1030642998 7:112026829-112026851 GAGAGTAATAGGCAAGGGAATGG - Intronic
1031381886 7:121096540-121096562 ATGTGTAATTGCCAGGTCAATGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032025533 7:128439001-128439023 TTGTAAAATAGGGAGGGGAAAGG - Intergenic
1032347059 7:131126148-131126170 ATGTACAAAAGGCAGGAGAAGGG + Intronic
1032381514 7:131488151-131488173 AAGTGAAATAGGAAGGGAAAAGG - Exonic
1032414517 7:131725999-131726021 ATGTGTGTGAGGCATGGGAAGGG + Intergenic
1032928338 7:136636172-136636194 ATGTTTAAAAGGCAAGAGAATGG - Intergenic
1035658934 8:1332574-1332596 ATGTGTGACAGCCAGGGGCAGGG - Intergenic
1037097282 8:15000865-15000887 AAGTTTAATAGGCAGAAGAAAGG - Intronic
1037162077 8:15785647-15785669 GTGTGTAGGAGGCAGGGGCATGG - Intergenic
1037168231 8:15857294-15857316 ACGTGGAATACGCAGGGTAAAGG - Intergenic
1037400666 8:18492371-18492393 GTGGGTAAAAGGGAGGGGAAGGG + Intergenic
1037452765 8:19033601-19033623 ATGAGTACTAGGGAGGTGAAAGG - Intronic
1037500661 8:19482652-19482674 TTATGTTATAGGCAGAGGAAGGG - Intronic
1037886384 8:22598527-22598549 ATGAGAAAGAGGCAGGGGACCGG + Intronic
1037895667 8:22652515-22652537 ATGTGTGGTGGGGAGGGGAAGGG + Intronic
1039006173 8:33039427-33039449 AGGTTTAATAGGCAAGAGAAAGG - Intergenic
1039012007 8:33104154-33104176 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
1039396523 8:37230114-37230136 ATAAGAAATAGGGAGGGGAAAGG + Intergenic
1039980668 8:42407327-42407349 AGGTTTAATAGGCAAGAGAAAGG + Intergenic
1040852403 8:51914583-51914605 AAGTGGAACAGGAAGGGGAAGGG - Intergenic
1042071829 8:64943298-64943320 AAGTGTAATAGGCATTTGAAAGG - Intergenic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042710901 8:71716184-71716206 AAGTGTAATAGGCAAAAGAAAGG + Intergenic
1043026227 8:75072604-75072626 ATGTGTAATGTGGAGGGGAGGGG + Intergenic
1043149171 8:76691962-76691984 ATGTCTAAGAGGTGGGGGAAAGG + Intronic
1044745579 8:95367473-95367495 ATGTGTGATAGGTCAGGGAAAGG + Intergenic
1046072386 8:109272964-109272986 ATGAATAATTGGAAGGGGAAGGG - Intronic
1047159822 8:122365520-122365542 ATGAGTAACAGTCATGGGAAAGG + Intergenic
1047294439 8:123558828-123558850 CAGTGGAATAGGCAGGGCAAGGG + Intergenic
1047765983 8:127990284-127990306 AGGGGGAATGGGCAGGGGAAGGG - Intergenic
1048543421 8:135363871-135363893 AGCTGGAATAGGCAGGGAAAAGG - Intergenic
1050209365 9:3235934-3235956 ATGTGTGATAAGCAGTAGAATGG - Intronic
1050485692 9:6132378-6132400 TTGTGTAAAAGAAAGGGGAATGG + Intergenic
1051076126 9:13238518-13238540 AAGTTTAATAGGCAGAAGAAAGG - Intronic
1051483584 9:17585065-17585087 AGGTTTAATATTCAGGGGAAGGG + Intronic
1053303838 9:36970191-36970213 ATGTGTAATGGAGAGGGGAGTGG + Intronic
1054155519 9:61637220-61637242 ATGTATGATATGAAGGGGAAAGG + Intergenic
1055026410 9:71726993-71727015 CTTTGTAAAAGGCAGTGGAAAGG + Intronic
1055762922 9:79628739-79628761 TTGTGTGATGGGCAGGGGAAGGG + Intronic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058509946 9:105706638-105706660 ATGCTTAAGAGGCAAGGGAAAGG + Intronic
1059692853 9:116702447-116702469 ATGTGAAATAGACAGTAGAAAGG - Intronic
1061022523 9:128025514-128025536 ATGTGCATTTGGCAGAGGAAGGG + Intergenic
1061748091 9:132754680-132754702 ATGTGTGATAGGCATGGCTAGGG - Intronic
1203657045 Un_KI270753v1:8146-8168 AAGTTTAATAGGCAGAAGAAAGG + Intergenic
1187056742 X:15747876-15747898 AAGTTTAATAGGCAGAAGAAAGG + Intronic
1188083414 X:25874182-25874204 ATGTGAAAGAGGTATGGGAAAGG + Intergenic
1188491280 X:30741047-30741069 AAGTCTAATAGGCAGAAGAAAGG - Intergenic
1188976522 X:36682556-36682578 ATGGGAACTAGGCAGGGAAAAGG - Intergenic
1190050024 X:47142565-47142587 ATGGGTAAGAGGCAGAGGCAGGG - Exonic
1190287633 X:48971562-48971584 AGGTGGCATAGGCAGGGGGAGGG + Exonic
1190947981 X:55114461-55114483 ATATGTAATGGCAAGGGGAAGGG + Intronic
1193772396 X:85603607-85603629 AAGTTTAATAGGCAGAAGAAAGG - Intergenic
1197714070 X:129693654-129693676 ATGTGTGGTAGGCAGGATAATGG + Intergenic
1197796761 X:130306177-130306199 GTTTGTCAAAGGCAGGGGAAGGG + Intergenic
1199778545 X:151037281-151037303 GTGTATTTTAGGCAGGGGAATGG + Intergenic
1200358596 X:155578283-155578305 AGCTGTGATAGGCAGGGGCAGGG - Intronic
1201344809 Y:12971271-12971293 ATGTGTTATCAGCAGGTGAATGG - Intergenic