ID: 906153047

View in Genome Browser
Species Human (GRCh38)
Location 1:43598909-43598931
Sequence CACCACCCAATGCTGCACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906153047_906153058 27 Left 906153047 1:43598909-43598931 CCCAGGTGCAGCATTGGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 906153058 1:43598959-43598981 GCATGCACAAGCTCCCTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 104
906153047_906153057 26 Left 906153047 1:43598909-43598931 CCCAGGTGCAGCATTGGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 906153057 1:43598958-43598980 AGCATGCACAAGCTCCCTTTTGG 0: 1
1: 0
2: 0
3: 9
4: 97
906153047_906153055 -9 Left 906153047 1:43598909-43598931 CCCAGGTGCAGCATTGGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 906153055 1:43598923-43598945 TGGGTGGTGGTGGGGTGGCAGGG 0: 1
1: 1
2: 10
3: 198
4: 1338
906153047_906153059 28 Left 906153047 1:43598909-43598931 CCCAGGTGCAGCATTGGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 906153059 1:43598960-43598982 CATGCACAAGCTCCCTTTTGGGG 0: 1
1: 0
2: 2
3: 28
4: 158
906153047_906153054 -10 Left 906153047 1:43598909-43598931 CCCAGGTGCAGCATTGGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 906153054 1:43598922-43598944 TTGGGTGGTGGTGGGGTGGCAGG 0: 1
1: 0
2: 16
3: 200
4: 1347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906153047 Original CRISPR CACCACCCAATGCTGCACCT GGG (reversed) Exonic
900625696 1:3607621-3607643 AACCTCCCACTGCTGCACATGGG + Intronic
901369554 1:8785014-8785036 CATGATCCAATGCTCCACCTAGG + Intronic
901497135 1:9628776-9628798 CACCACCCACTCCTCCACCCTGG - Intergenic
903741460 1:25560857-25560879 CTCCACCTAATGCTGGTCCTCGG + Intronic
903742973 1:25568987-25569009 CCCCACTCAGTGCTGCCCCTGGG - Intergenic
904279022 1:29405406-29405428 CAGCAACCCAAGCTGCACCTGGG - Intergenic
905304453 1:37007860-37007882 CACCTCCCACTGCTGCTGCTCGG - Intronic
906153047 1:43598909-43598931 CACCACCCAATGCTGCACCTGGG - Exonic
910667783 1:89742894-89742916 CACCTCCTAATACTCCACCTTGG + Intronic
910884297 1:91949560-91949582 TCCCACCCAAGGCCGCACCTCGG - Exonic
912595884 1:110875329-110875351 CCCCACCCAGAGCTGGACCTAGG - Intronic
918317276 1:183332604-183332626 CACCAGCCAACCCTGCACATGGG + Intronic
920348042 1:205319204-205319226 GACCACCCAGTTCTGCAGCTGGG - Intronic
921368848 1:214401422-214401444 CATCAGCCAATCCGGCACCTTGG - Intronic
922370428 1:224905054-224905076 CATCACACACTGCAGCACCTGGG - Intronic
1066695876 10:38077112-38077134 CAGCAGCCCAAGCTGCACCTGGG + Intergenic
1067773451 10:49144270-49144292 CTCCACCCAAGCCTGCCCCTAGG - Intergenic
1068123684 10:52811830-52811852 CTCCACTCAATCCTGCACTTTGG + Intergenic
1069047813 10:63761656-63761678 CACCACCCATCTCTGCGCCTCGG + Intergenic
1069930607 10:71878995-71879017 CACCGCACATGGCTGCACCTGGG + Intergenic
1070139957 10:73731805-73731827 CACCACCCATTGCCCCACCATGG + Intergenic
1070810509 10:79295372-79295394 GACCACCCAGTGCTGTAGCTGGG - Intronic
1070935702 10:80293113-80293135 CACCCCCCACCTCTGCACCTAGG - Intergenic
1072469312 10:95697471-95697493 CACCTCTCAATACTGCACATTGG - Intergenic
1073210660 10:101799312-101799334 CACCACTCAAGGCTGCTCCCTGG + Exonic
1073974791 10:109087752-109087774 CCCCACCCCACACTGCACCTTGG + Intergenic
1076747157 10:132520172-132520194 CACCCCCCACTGCAGCCCCTGGG + Intergenic
1077995033 11:7445680-7445702 CACCACACAAAGCAGCATCTGGG + Intronic
1077998520 11:7474577-7474599 CACCACACTATGATGCATCTTGG - Intergenic
1084326371 11:68402706-68402728 CTCCGCCCATTGCTGCACCTGGG + Intronic
1084460925 11:69296179-69296201 CACCCCTCACTGCTCCACCTGGG + Exonic
1087097013 11:94328813-94328835 GAACAGCCACTGCTGCACCTGGG + Intergenic
1090351391 11:126110706-126110728 CACCATCCAAGGCTGCACACTGG + Intergenic
1091080065 11:132658216-132658238 CATCACTCCATGCTGCACATAGG + Intronic
1091319569 11:134640097-134640119 CGCCACCCAATGCTCTCCCTAGG - Intergenic
1095981003 12:47974824-47974846 CCCCAACCAAGGCTGCACCTTGG - Exonic
1096028503 12:48389357-48389379 CACCACCCAATGCTTCAGGTAGG - Intergenic
1096389089 12:51215587-51215609 CAGAACCCAATACTACACCTTGG - Intronic
1097060923 12:56283162-56283184 CCTCACGCAATGCTCCACCTTGG + Intronic
1098180342 12:67840371-67840393 GACCCCCCAATGCTGCATGTGGG + Intergenic
1102448370 12:113021570-113021592 CACCACCCATTCCTGTACCAGGG + Intergenic
1104815495 12:131643184-131643206 CACCACCCAATGCTTTAACGTGG + Intergenic
1104824716 12:131701018-131701040 CACCACCCCATGCCCCAACTGGG + Intergenic
1105702104 13:22941545-22941567 AACCACCCAAAGTTGCATCTGGG - Intergenic
1105854729 13:24363330-24363352 AACCACCCAAAGTTGCATCTGGG - Intergenic
1107294417 13:38894556-38894578 CACCCCCAAATGCTGCCCTTGGG + Intergenic
1108273820 13:48788354-48788376 AACTACCCAATGCTGCTCTTTGG + Intergenic
1112571854 13:100600640-100600662 GACCACTGAATGCTGCAACTGGG + Intergenic
1113636527 13:111922795-111922817 CTCCCCACAATGATGCACCTTGG + Intergenic
1115868832 14:37778047-37778069 CACCACCCAATGAAGCACATTGG - Intronic
1116782495 14:49251347-49251369 CACCACACAGTGAAGCACCTTGG + Intergenic
1118317148 14:64732318-64732340 CACCCCACAGTGCTGCACCAAGG - Intronic
1119261417 14:73240142-73240164 GACCACCCAGCCCTGCACCTTGG - Intronic
1119872245 14:78027782-78027804 CACCACCCCATGCTGTTTCTTGG - Intergenic
1121856382 14:97273918-97273940 CACCACTCAGTGATGCACTTTGG + Intergenic
1122867112 14:104611428-104611450 CCCTACCCAATACAGCACCTGGG + Intergenic
1125589394 15:40844830-40844852 CACCACCCAGAACTGCAACTTGG + Exonic
1128448553 15:67786548-67786570 CACCACCCAAGCCAGCAGCTTGG - Intronic
1130629361 15:85550483-85550505 CACCACCTAACCCTACACCTAGG - Intronic
1131629510 15:94161489-94161511 CACCTCCCACTGAGGCACCTGGG + Intergenic
1132610367 16:813155-813177 CCCCACCCACGGCTGCACCAAGG - Intronic
1132975985 16:2711476-2711498 GACCACCCAGTGCTGCTCCCTGG + Intergenic
1136573965 16:31112350-31112372 CTCCACACACTGCTGCATCTTGG + Exonic
1137699289 16:50484817-50484839 CACCATCCCATGGTGCCCCTTGG + Intergenic
1139359497 16:66388695-66388717 CACCATCCTCTGCTGCCCCTTGG - Intronic
1140478420 16:75250356-75250378 CACCACCCAACTCTCCACCGAGG + Intronic
1141978063 16:87531417-87531439 CACCATCCAATGCTGGCCTTGGG - Intergenic
1142005295 16:87686921-87686943 CACCTCCTGCTGCTGCACCTTGG + Intronic
1143501854 17:7343856-7343878 CTCCACCAAACGCAGCACCTGGG - Exonic
1144788588 17:17845287-17845309 CACCACTCCCTGCTGCCCCTGGG + Intronic
1144859280 17:18290109-18290131 CCTCACCCAATGCTCCACATGGG + Intronic
1146171832 17:30640446-30640468 CACATCACACTGCTGCACCTGGG - Intergenic
1146345287 17:32056471-32056493 CACATCACACTGCTGCACCTGGG - Intergenic
1147573618 17:41586540-41586562 CACCACCCAAGCCAGCACCAAGG + Exonic
1152566055 17:81100914-81100936 CACCACCCAAGGCCCCACCTGGG - Intronic
1155527928 18:26736084-26736106 CACCAAGCCTTGCTGCACCTAGG - Intergenic
1157328846 18:46688757-46688779 CCCCGCCCAAAGCAGCACCTTGG + Exonic
1157618910 18:49004019-49004041 GACCACCCATACCTGCACCTGGG + Intergenic
1158534507 18:58295760-58295782 AACCACCCACAGCTGCACTTTGG + Intronic
1162794358 19:13078857-13078879 GCCCACCCGCTGCTGCACCTTGG - Intronic
1163193273 19:15696011-15696033 CATCTCCCGATGCTGCACCCAGG + Exonic
1163228574 19:15981370-15981392 CATCTCCCGATGCTGCACCCAGG - Intergenic
1163274179 19:16272687-16272709 CAACACCCAATTCTGCCTCTAGG + Intergenic
925075841 2:1014930-1014952 CACCCCTCAAGGCTGCCCCTCGG - Intronic
927175663 2:20405236-20405258 CATCACCAAATCCTGCACCAAGG - Intergenic
927276096 2:21263667-21263689 CCCCTGCCAATGCTGCTCCTTGG + Intergenic
930047288 2:47183896-47183918 CATCAGCCATTGCTGAACCTAGG - Intergenic
933970329 2:87464775-87464797 CTACACCTAATGCTGCCCCTGGG - Intergenic
935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG + Intergenic
936078334 2:109415856-109415878 CACCTCTCAGTGCTGCGCCTGGG - Intronic
936323454 2:111485721-111485743 CTACACCTAATGCTGCCCCTGGG + Intergenic
937879178 2:126852222-126852244 CATCACCCAGACCTGCACCTTGG + Intergenic
938170302 2:129069913-129069935 CACCTCCCATTCCTGCACCCGGG - Intergenic
938676637 2:133642282-133642304 CACCTCCCAATACTGCACACTGG + Intergenic
944773122 2:202933567-202933589 CACCACCCAATCCCCCAACTGGG - Intronic
947433733 2:230054068-230054090 CCCCACCTCAGGCTGCACCTGGG - Intronic
1169340499 20:4792819-4792841 CCCCACCCACTGCTTGACCTGGG - Intronic
1169425231 20:5491643-5491665 TAACACCTCATGCTGCACCTGGG - Intergenic
1174601590 20:51729358-51729380 CACTACCCAGTGCTGAACCCAGG + Intronic
1175452014 20:59077500-59077522 CACCTGCCATTGCTGCCCCTGGG + Intergenic
1180074226 21:45454683-45454705 CAGCACCCACTGCTGTGCCTGGG + Intronic
1180917124 22:19497083-19497105 CCCCAGCCAGTGCTGCACCCGGG + Intronic
1182085210 22:27556585-27556607 CACCACCCCGTGCTCGACCTCGG - Intergenic
1184430844 22:44440905-44440927 GACCACCCAGGGCTGCACTTGGG - Intergenic
1184688096 22:46105423-46105445 CACCACCCCATGCTGCCCAGAGG - Exonic
1185279556 22:49964269-49964291 CACTACCCCGTGCTGCACCCAGG + Intergenic
1185386318 22:50532635-50532657 CACCACCCAGTGCCGCCGCTGGG + Intergenic
953789454 3:45936397-45936419 CTCCTCCCAATGCCACACCTGGG + Intronic
954292413 3:49656563-49656585 CACCAGCAGATGCTGCTCCTGGG + Exonic
955933456 3:64080149-64080171 CATCACCCACTTCTACACCTGGG - Intergenic
958042588 3:88244657-88244679 CAACAGCCCAAGCTGCACCTTGG - Intergenic
965762907 3:172098958-172098980 CAGCACACAATGCTGCCTCTCGG + Intronic
978206290 4:106084057-106084079 CTCCATCCAGTTCTGCACCTTGG - Intronic
981831908 4:149011426-149011448 CAGCAGCCATTGCTGCTCCTTGG - Intergenic
995866516 5:116697576-116697598 CAGCACACAATGCAGTACCTGGG + Intergenic
998372382 5:141670337-141670359 TATCACCCAATGCTGCCACTTGG + Intronic
1002493433 5:179596088-179596110 CATCACCCAATGCAGAACATTGG - Intronic
1003213525 6:4088936-4088958 CTCCACCCAATGCTGCAAATCGG - Intronic
1004332310 6:14733034-14733056 CCCAACCCACTGCTGCACGTTGG + Intergenic
1007349173 6:41256122-41256144 CACAACCCAATCCACCACCTGGG + Intergenic
1007473677 6:42105908-42105930 CACCACCCAAGGCCACACTTGGG - Exonic
1007473685 6:42105938-42105960 TACCACCCAAGGCTACACTTTGG - Exonic
1007492027 6:42230656-42230678 CACCACACACTGGTGCACCATGG - Intronic
1008816956 6:55579496-55579518 GAGCACCCAAGGCTGCAGCTGGG - Intergenic
1009348457 6:62646210-62646232 CAACAACCCAAGCTGCACCTTGG - Intergenic
1017155948 6:151322737-151322759 CACCACCCACTCCTGCCACTGGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019619786 7:1986301-1986323 CACCAACCTCTGCTGCAGCTTGG + Intronic
1019709413 7:2511458-2511480 CAGCCCCCCAGGCTGCACCTCGG - Intergenic
1023165303 7:37337545-37337567 CAACCCCCAATGCTCCACATAGG - Intronic
1023868018 7:44248055-44248077 CACCAGCCAATGTGGCAGCTTGG - Intronic
1024292187 7:47812688-47812710 CACGACCCCATGTTGCAGCTAGG - Intronic
1024430543 7:49283201-49283223 CACCACTCAATTCTTTACCTTGG - Intergenic
1026740116 7:72973953-72973975 CAGCACCCAATTCTGCACACTGG + Intergenic
1026797426 7:73375465-73375487 CAGCACCCAATTCTGCACACTGG + Intergenic
1027103617 7:75391117-75391139 CAGCACCCAATTCTGCACACTGG - Intergenic
1027615198 7:80414514-80414536 CAGCGCCCAGTGCTGCACCTTGG + Intronic
1028660792 7:93271321-93271343 CAAAACACAATGTTGCACCTAGG - Intronic
1030598791 7:111570126-111570148 CTCCACACCATGCTGCTCCTGGG - Intergenic
1031298850 7:120039297-120039319 CAACAGCCCATGCTGTACCTTGG + Intergenic
1032613734 7:133443638-133443660 CACCACCCACTGATGCCCCCAGG - Intronic
1035253237 7:157610935-157610957 CAGCATACAATGCTGCATCTGGG + Intronic
1035265265 7:157686557-157686579 GACCCCCCAAGGCTGCACCACGG + Intronic
1036390347 8:8319108-8319130 CACCACGCAGTCCTGCTCCTGGG + Exonic
1036559431 8:9889012-9889034 CACCACCCAATGCAGGACTTAGG + Intergenic
1040386640 8:46918846-46918868 CTCCAGCCACTGCTGCACCAGGG + Intergenic
1045810422 8:106214847-106214869 CACAACACAATGCTTTACCTTGG - Intergenic
1048136745 8:131753468-131753490 CACCTCCCACTGCTCCACTTGGG + Intergenic
1049201182 8:141341416-141341438 CACCACCCGATGCAGGCCCTGGG + Intergenic
1049560972 8:143310065-143310087 CACCAGGCAATGCTGATCCTGGG + Exonic
1049645729 8:143734855-143734877 CACCACCCCGAGCTGCCCCTGGG + Intergenic
1049841180 8:144773453-144773475 CACCACCAGAGGCTGCACCACGG - Exonic
1051739868 9:20240844-20240866 CACCAGCCCCTTCTGCACCTGGG + Intergenic
1051933904 9:22421236-22421258 CAACAACAAAAGCTGCACCTAGG - Intergenic
1051974105 9:22928177-22928199 CACCAGCCATTGCTGCACTGAGG - Intergenic
1053285944 9:36849689-36849711 CACCACACCATCCTGCCCCTTGG + Intronic
1053412205 9:37923073-37923095 CACCTCCCCTTTCTGCACCTCGG - Intronic
1057486251 9:95486800-95486822 AAGCTCCGAATGCTGCACCTGGG + Intronic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1061258825 9:129467924-129467946 CCCCACCCAAGGCTCCACCGAGG + Intergenic
1061878725 9:133557751-133557773 CACCCCCCACTGCTGCCACTTGG - Intronic
1061950425 9:133932929-133932951 CCCCTCCCAATGCTCCTCCTGGG + Intronic
1062317844 9:135977270-135977292 CACCACCCCACCCTGCACCAGGG - Intergenic
1197902901 X:131392842-131392864 CACCACCCAGAGCAGCACCAGGG + Intronic
1200039204 X:153353626-153353648 ACCCACCCAGAGCTGCACCTGGG - Intronic
1201468122 Y:14307381-14307403 CACCATCAGATGCTTCACCTTGG + Intergenic