ID: 906153565

View in Genome Browser
Species Human (GRCh38)
Location 1:43601417-43601439
Sequence TGAGTGCCAAGCTCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 549}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906153565_906153566 2 Left 906153565 1:43601417-43601439 CCAGGCTCTGAGCTTGGCACTCA 0: 1
1: 0
2: 6
3: 67
4: 549
Right 906153566 1:43601442-43601464 GCCTTCATAGTCTTGCTGACTGG 0: 1
1: 0
2: 1
3: 10
4: 77
906153565_906153569 14 Left 906153565 1:43601417-43601439 CCAGGCTCTGAGCTTGGCACTCA 0: 1
1: 0
2: 6
3: 67
4: 549
Right 906153569 1:43601454-43601476 TTGCTGACTGGCTTGCCCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 150
906153565_906153570 24 Left 906153565 1:43601417-43601439 CCAGGCTCTGAGCTTGGCACTCA 0: 1
1: 0
2: 6
3: 67
4: 549
Right 906153570 1:43601464-43601486 GCTTGCCCTTGGGCCCACCCTGG 0: 1
1: 0
2: 2
3: 15
4: 207
906153565_906153568 13 Left 906153565 1:43601417-43601439 CCAGGCTCTGAGCTTGGCACTCA 0: 1
1: 0
2: 6
3: 67
4: 549
Right 906153568 1:43601453-43601475 CTTGCTGACTGGCTTGCCCTTGG 0: 1
1: 0
2: 1
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906153565 Original CRISPR TGAGTGCCAAGCTCAGAGCC TGG (reversed) Intronic
900406761 1:2496177-2496199 TGTGTGCTAAGGGCAGAGCCCGG - Intronic
900615776 1:3565079-3565101 TGGGTTCCAAGCACAGGGCCTGG + Intronic
900899059 1:5504495-5504517 TGAGTGGCGAGCTCAGGGCCTGG - Intergenic
900990833 1:6097442-6097464 TGAGTGCCTAGAACAGAGCCTGG - Intronic
901082486 1:6591508-6591530 TGGGTGCCCAGCTCAGTGCCTGG + Exonic
901481823 1:9530434-9530456 GGAGTGCCTAACTCAGAGCTGGG - Intergenic
901631977 1:10652406-10652428 TGAGAGCCAGGCTCCAAGCCGGG - Intronic
902140582 1:14350388-14350410 TGAGTGCTCGGCACAGAGCCTGG + Intergenic
902365773 1:15973227-15973249 AGAGTGCTTAGCACAGAGCCTGG + Intronic
902384400 1:16068167-16068189 TCAGAGCCAAGGGCAGAGCCCGG - Intronic
902565565 1:17309001-17309023 TGAGTGCCATGCTCTGTGGCAGG + Intronic
902622224 1:17657124-17657146 TGAGGGCAAAGCACAGGGCCAGG + Intronic
902664607 1:17928649-17928671 AAAGTGCCAAGCACAGTGCCTGG + Intergenic
902736735 1:18406167-18406189 AGAGTGCTTAGCTCAGTGCCTGG - Intergenic
902819622 1:18936054-18936076 CCAGTGCCCAGCACAGAGCCTGG + Intronic
902941228 1:19801314-19801336 TGAGTCCCAGGCTCTGAGCTGGG - Intergenic
903052649 1:20613039-20613061 TGAGTGCCTGGTACAGAGCCTGG + Intronic
903360561 1:22774333-22774355 TGTGTGCCAGGCCCTGAGCCAGG - Intronic
903447670 1:23432612-23432634 CCAGTGCCTAGCGCAGAGCCTGG - Intronic
904187650 1:28718217-28718239 TCAGTGCCTAGCACAAAGCCTGG - Intronic
904260865 1:29286936-29286958 TGAAGGCCAGGCTCAGATCCAGG - Intronic
904292756 1:29498299-29498321 TGAGGGCGATGCCCAGAGCCTGG - Intergenic
904339259 1:29823510-29823532 TGCCTGCAAAGCTCTGAGCCAGG - Intergenic
904465937 1:30707584-30707606 TGTGTGCAAAGCACAGAGCATGG - Intergenic
904492035 1:30866968-30866990 TTAGAGCCAAGGGCAGAGCCTGG - Intergenic
904492190 1:30868033-30868055 CCAGTTCCAAGCACAGAGCCAGG + Intergenic
905246732 1:36620163-36620185 TCAGTGTCCAGCCCAGAGCCTGG - Intergenic
905271141 1:36788406-36788428 TCAGAGCCAAGCACAGTGCCAGG + Intergenic
905275992 1:36818649-36818671 CAAGTGCCCAGCACAGAGCCTGG + Intronic
905349094 1:37332129-37332151 TGTGTGCCAGGCTCAGTGCCAGG - Intergenic
905411125 1:37768894-37768916 TATGTGCCAAGCACAGAGCTGGG - Intergenic
905756654 1:40515731-40515753 TAAAAGCCAAGCTCAGAGACTGG - Exonic
905797073 1:40821877-40821899 TAAATGCCAAGCTCAGTGCCTGG - Intronic
905857582 1:41324128-41324150 TGAGTGTCCAGCACAGAGTCTGG - Intergenic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906212550 1:44020157-44020179 TGTGTGCCAGGCCCTGAGCCGGG + Intronic
906588564 1:47002050-47002072 TGAGTGCCTAGGACAGTGCCAGG + Intergenic
906590023 1:47016185-47016207 TGTGTGCCCAGCTCAAAGACGGG + Intergenic
906613692 1:47220779-47220801 TCAGTGCCTAGCACAGTGCCTGG - Intronic
906686698 1:47767613-47767635 TGTGTGCCCAGTTCAGATCCTGG - Intronic
906787803 1:48631014-48631036 TGGGTGCCGAGTTCACAGCCTGG - Intronic
906790899 1:48657974-48657996 TTAGTGCCTAGCTCAGTGCTTGG + Intronic
907490873 1:54808030-54808052 GGAGTCCCAAGCAGAGAGCCTGG + Intronic
907573559 1:55505901-55505923 AGAGTGCTGAGCTCAGATCCTGG - Intergenic
907579524 1:55558975-55558997 CCAGTGCCCAGCTTAGAGCCTGG + Intergenic
907927605 1:58969172-58969194 CCAGTGCCAATCTCAGTGCCTGG - Intergenic
908165632 1:61454933-61454955 TCAGTGCCTAGCCCAGTGCCTGG - Intronic
908857678 1:68448351-68448373 TCAGTGCCTAGCTCAGTGCCTGG - Intronic
910227853 1:84954767-84954789 TCAGTGCCTAGCACAGTGCCTGG - Intronic
911172552 1:94784566-94784588 TCAGGGCCAAGCTCAGTTCCAGG - Intergenic
913319517 1:117578529-117578551 CCAGTGCCAAGCTCTGAGCAAGG + Intergenic
915531475 1:156504876-156504898 TGTGCCCCAAGCTCAGGGCCAGG + Intergenic
916514616 1:165504210-165504232 TCAGTGCCTAGCACAGAGCCTGG + Intergenic
916801804 1:168222967-168222989 CCAGTGCCAAGCACAGTGCCTGG - Intergenic
917449833 1:175138288-175138310 CCAGTGCCTATCTCAGAGCCTGG + Intronic
917701240 1:177583479-177583501 TTAGTGTCAAGCACAGTGCCTGG - Intergenic
918191694 1:182181712-182181734 CTAGTGCCCAGCCCAGAGCCTGG + Intergenic
918903060 1:190451268-190451290 TGAGTTCTAAGGTCAGAGGCTGG - Intronic
919444814 1:197689782-197689804 TCAGTGCCAAGCATAGTGCCTGG - Intronic
920019433 1:202943425-202943447 CGAGTCCCAAGCTCAGACCAAGG - Intronic
920253346 1:204637478-204637500 TGAGTGCCAAGGGCTGTGCCTGG + Intronic
920275305 1:204800012-204800034 CTAGTCCCAAGCCCAGAGCCAGG - Intergenic
920505202 1:206510793-206510815 AGAGTGCCAGGCCCAGAGCAGGG + Intronic
921065266 1:211618072-211618094 CAAGTGCTAGGCTCAGAGCCTGG - Intergenic
922067315 1:222156873-222156895 TGAGTGCCAGGCACACACCCAGG - Intergenic
922372842 1:224929052-224929074 TTTGTGCCTAGCTCAGTGCCTGG + Intronic
923307734 1:232703585-232703607 CTAGTGCCTAGCACAGAGCCAGG + Intergenic
924009608 1:239650113-239650135 TGAGAGCCAACTCCAGAGCCTGG - Intronic
924173665 1:241367294-241367316 TCAGTGCCTAGATCAGTGCCAGG + Intergenic
924376422 1:243414021-243414043 TGTGTGCCAAGCACTGAGGCTGG + Intronic
1062831995 10:611762-611784 TGAGGGCCAGGCTCAGATCTGGG - Intronic
1063434526 10:6019583-6019605 TGAATGAGAAGCTCAGAGGCTGG + Intronic
1063524776 10:6774813-6774835 TCAGTGCCAGGATCTGAGCCAGG + Intergenic
1064426766 10:15236383-15236405 AGAGTGCCTACCACAGAGCCTGG - Intronic
1065004088 10:21363583-21363605 CCAGTTCCAAGCTCAGTGCCTGG - Intergenic
1065011362 10:21423686-21423708 TGACTGCCAAGCTCAATCCCTGG - Intergenic
1065919387 10:30378808-30378830 TGGGAGCCAAGCGCAGACCCCGG - Intergenic
1066509982 10:36084482-36084504 TCAGTCCCAAGGCCAGAGCCTGG + Intergenic
1067726592 10:48775278-48775300 TGAGGGCCATGCACAGAGCGGGG + Intronic
1068516203 10:58028447-58028469 CCAGTGCCAAGCACAGTGCCTGG + Intergenic
1068795838 10:61079106-61079128 TGGGAGCCTAGCTAAGAGCCAGG + Intergenic
1069738072 10:70670508-70670530 TGGGGGCCTAGCTCAGAGTCTGG - Intergenic
1069851312 10:71406951-71406973 GAAGTGCTAAGCTCAGGGCCTGG - Intronic
1070168581 10:73915711-73915733 TGAGTGCCAACCTGAGGGTCAGG + Intronic
1070657564 10:78281938-78281960 TGAGTGCCAGGCACAGAGCCAGG + Intergenic
1070748160 10:78947664-78947686 TGAGGGCTGAGCTCACAGCCTGG - Intergenic
1072189932 10:93070727-93070749 TGTCTCCCAAGCTCAGGGCCTGG - Intergenic
1072901575 10:99412279-99412301 TGCATGCCAAGCTCAAAGTCTGG + Intronic
1074338991 10:112607496-112607518 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1074436807 10:113441256-113441278 TGAGTGGTCAGCACAGAGCCTGG - Intergenic
1075266458 10:121003149-121003171 TAAGTGCCAAGCTCTGTGCCAGG + Intergenic
1075432571 10:122400830-122400852 CCAGTGCCAAGCACAGTGCCTGG - Intronic
1075995190 10:126871386-126871408 CCAGTGCCAAGCACAGTGCCTGG - Intergenic
1076020912 10:127072281-127072303 TCAGTGCCTAGCACAGTGCCTGG - Intronic
1076508459 10:130994322-130994344 TGAAGGCAAAGCACAGAGCCTGG + Intergenic
1076527308 10:131120117-131120139 CGATTGGCAAGCTCAGAGGCTGG - Intronic
1077600260 11:3569710-3569732 TGAGTGGCAGGGTCAGAGACTGG - Intergenic
1078084051 11:8223224-8223246 ACAGTGCCAAGCACAAAGCCTGG - Intergenic
1078149731 11:8748362-8748384 CCAGTGCCCAGCACAGAGCCTGG + Intronic
1078633891 11:13030939-13030961 TATGTGCCTTGCTCAGAGCCTGG - Intergenic
1078633960 11:13031499-13031521 TCAGTGCCTAGCTCATATCCTGG - Intergenic
1078907404 11:15700388-15700410 TAAGTACCAAGCCCAGAGCCTGG + Intergenic
1078922690 11:15845259-15845281 GCAATGCCCAGCTCAGAGCCTGG - Intergenic
1078931920 11:15919358-15919380 TCAGTGTCCAGCTCAGAGCCTGG + Intergenic
1079041881 11:17066969-17066991 CCAGTGCCCAGCACAGAGCCTGG - Intergenic
1079640560 11:22799842-22799864 TGGGTGCCTAGCACAGTGCCGGG - Intronic
1080427293 11:32167928-32167950 CGAGTGCCTAGCATAGAGCCTGG + Intergenic
1080892626 11:36422539-36422561 TGAGTGGCAAGCTCAGAGTTGGG - Intronic
1081465401 11:43312103-43312125 TGAGCGACAAGCCCAGGGCCCGG - Exonic
1081623282 11:44631813-44631835 TGAGTGCCTAGCTCAGTGCCTGG + Intergenic
1083180315 11:60981062-60981084 TGAGCGCCAAGCACAGGGACTGG + Intronic
1083617172 11:64032058-64032080 TGGATGCCCAGCACAGAGCCTGG + Intronic
1083625508 11:64070037-64070059 GGAGTGCTTAGCACAGAGCCTGG - Intronic
1083935051 11:65865677-65865699 TGAGTGCCAAGCTCAGGAAGTGG + Intronic
1084155707 11:67311483-67311505 GGGGTGCCAAGCACAGAGCCAGG - Intronic
1084176973 11:67428009-67428031 TGAGTGGCCAGCTCACTGCCAGG - Intergenic
1084188623 11:67488805-67488827 TGAGGGCCTACCTCAGAGCTGGG - Intronic
1084256172 11:67944324-67944346 TGAGTGTCAGGGTCAGAGACTGG - Intergenic
1084816589 11:71650975-71650997 TGAGTGTCAGGGTCAGAGACTGG + Intergenic
1085030629 11:73269017-73269039 TGTGAGCCCAGCCCAGAGCCAGG + Intronic
1085035319 11:73296542-73296564 TGGGTGGCAAGCCCAGAGCCTGG - Exonic
1085496403 11:76973549-76973571 TGAGTGCCCAGCTCAGGGTTGGG + Intronic
1085515696 11:77110648-77110670 TGGGTGCCAGGCACAGGGCCAGG - Intronic
1085526749 11:77168406-77168428 TAAGTGCTTAGCTCATAGCCTGG - Intronic
1086137815 11:83460243-83460265 TCATTGCCCAGCTCAGTGCCTGG - Intronic
1086336471 11:85806144-85806166 TGAGTGCCAGGAACAGTGCCAGG + Intronic
1086788753 11:91007382-91007404 TGAAGGCCAGGCTGAGAGCCAGG - Intergenic
1086953458 11:92913529-92913551 TCGGTGCCTAGCTCAGAGCCAGG + Intergenic
1088984360 11:114892495-114892517 CAAGTGCCAAGCACAGTGCCAGG + Intergenic
1089342715 11:117770244-117770266 TGGGTGCCAGGCACAGTGCCAGG - Intronic
1089886712 11:121831917-121831939 AAAATGCCAAGCACAGAGCCTGG + Intergenic
1091622001 12:2096001-2096023 TCTGTGCCTAGCCCAGAGCCTGG - Intronic
1091718866 12:2797888-2797910 TGAGATCCAGGCTAAGAGCCAGG + Intronic
1092113570 12:5982107-5982129 TGAGGGCCAAGCTCACGGGCTGG + Intronic
1092426404 12:8379056-8379078 TGAGTGTCAGGGTCAGAGACTGG - Intergenic
1092534934 12:9378846-9378868 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1093170612 12:15856168-15856190 AGCTTCCCAAGCTCAGAGCCTGG - Intronic
1094045279 12:26159841-26159863 TGAGTACCAAGCCCAGTGCCTGG + Intronic
1095158117 12:38883069-38883091 TAAATGCCCAGCTCAGCGCCTGG - Intronic
1096385078 12:51190013-51190035 GGAGTGACCAGCCCAGAGCCTGG + Exonic
1096620537 12:52861970-52861992 TCAGTGCCAAGCACTGTGCCGGG + Intergenic
1098602324 12:72346643-72346665 CGAGTGCCAACCTTAGAGCCTGG + Intronic
1098979119 12:76936018-76936040 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1100271414 12:93028976-93028998 GGAGAGCCAAGCTCAGGCCCAGG + Intergenic
1100663059 12:96721407-96721429 TCACTGCCTAGATCAGAGCCTGG - Intronic
1101659541 12:106753598-106753620 AGAGTGCTCAGCGCAGAGCCTGG - Intronic
1101787982 12:107902938-107902960 TGAGTGCCTAGCACAGTGTCGGG - Intergenic
1102013380 12:109632530-109632552 TCAGTGCAAAGCTCAGAGACAGG + Intergenic
1102231085 12:111262938-111262960 TAAGTGCTAAGCACAGGGCCCGG - Intronic
1102404249 12:112658954-112658976 TGAGTGTTAAGCACAGTGCCTGG - Intronic
1102411542 12:112724629-112724651 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1103378716 12:120477390-120477412 CCAGTGCCCAGCACAGAGCCAGG - Intronic
1103441668 12:120967610-120967632 TGTGTGCCCAGCCCAGAGCTGGG + Intergenic
1103571837 12:121850017-121850039 CCAGCGCCAAGCTCAGTGCCTGG + Intronic
1104000715 12:124858066-124858088 TGCATGCCAGGCTCAGATCCAGG + Intronic
1104441426 12:128796644-128796666 TGAGTGCCCAGGACAGAGCCTGG - Intronic
1104749099 12:131227235-131227257 TCAGTGCCAAGATCAAACCCAGG + Intergenic
1105451122 13:20501331-20501353 TGACTGCAAAGCTCACAGTCTGG + Intronic
1106862768 13:33928476-33928498 TGAATATCAAGCTCAGAGCATGG - Intronic
1107313312 13:39103830-39103852 TGAGTGCCAAGCGCATTGCCTGG + Intergenic
1108681865 13:52787467-52787489 TGTGTGCCAGGCTCTGTGCCAGG - Intergenic
1110220073 13:73062506-73062528 TCACCACCAAGCTCAGAGCCTGG + Exonic
1112113069 13:96323882-96323904 TCAGTGCCAAGAACAGTGCCTGG + Intronic
1112399760 13:99065853-99065875 TGAGTGCCAAGCACTGTGCTAGG - Intronic
1113695298 13:112342006-112342028 TCAGAGCCCAGCCCAGAGCCTGG + Intergenic
1113753730 13:112793973-112793995 TCAGGGCCAAAATCAGAGCCAGG + Intronic
1113759162 13:112835588-112835610 TGCCAGCCCAGCTCAGAGCCAGG - Intronic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1115378633 14:32707611-32707633 CCAGTGCCAAGCACAGTGCCTGG + Intronic
1117553674 14:56862401-56862423 TGTGTGCCAGGCACAGGGCCAGG + Intergenic
1118609368 14:67528212-67528234 TGAGTGCCAAGAACTGAGCTAGG + Intronic
1119163939 14:72476762-72476784 AGAGTCCCAGGCACAGAGCCCGG + Exonic
1119916538 14:78407155-78407177 TGAGTGGGAAGCTTAGAGCTTGG + Intronic
1120634442 14:86934173-86934195 TGTCTGCCAAGCGCAGAGCAGGG + Intergenic
1121005755 14:90489626-90489648 TGAGAGCCCAGCTCTGGGCCAGG - Intergenic
1121443047 14:93960926-93960948 CCAGTGCCCAGCTTAGAGCCTGG - Intronic
1121452913 14:94020746-94020768 TGAGTACCTAGCACAGTGCCAGG - Intergenic
1122290934 14:100680187-100680209 TGAGAGCTCAGCTCAGAGCCTGG + Intergenic
1122455509 14:101847568-101847590 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1202902883 14_GL000194v1_random:53350-53372 CGTGTGTCCAGCTCAGAGCCAGG - Intergenic
1123997639 15:25729878-25729900 CCAGTGCCTACCTCAGAGCCTGG + Intronic
1125582379 15:40795457-40795479 TGTGTGTCAAACTCTGAGCCTGG - Intronic
1126796520 15:52264390-52264412 TCAGTGCCAAGCTCTGGGACAGG + Intronic
1128551589 15:68601225-68601247 TGAGTGCCAAGCTCTGTGCCAGG + Intronic
1128795571 15:70463999-70464021 TATGTGCCAAGCTCAAAGCTGGG + Intergenic
1129198255 15:73983686-73983708 TGAGTGCCCAGCGCTGAGCTGGG - Exonic
1129248243 15:74293015-74293037 TGAGTGCCCAGCTCTGACCAGGG + Intronic
1129275282 15:74441404-74441426 TGAGTGCCTAGCTCAATGCCTGG + Intergenic
1129385451 15:75193734-75193756 TGAGTGCCTATTTCTGAGCCAGG + Intergenic
1129846770 15:78771451-78771473 GGAGGGCCTGGCTCAGAGCCAGG + Intronic
1130040595 15:80403203-80403225 TGTGTGCCAGGCACAAAGCCAGG - Intronic
1130091123 15:80822213-80822235 CCAGTGCCGAGCCCAGAGCCTGG + Intronic
1130150789 15:81310050-81310072 TGATTGCCAAGCTCAGGACCAGG + Exonic
1131122622 15:89832062-89832084 TGAGGGCCAAGCTCAGTTCTAGG - Exonic
1131523364 15:93133614-93133636 TGAGTTTGTAGCTCAGAGCCTGG - Intergenic
1131793674 15:95991502-95991524 TAAATGCCAAAATCAGAGCCTGG + Intergenic
1132321291 15:100927353-100927375 GCAGTGCCAAGCTCAGATGCAGG - Intronic
1132396063 15:101475230-101475252 TGAGTGACGAGCCCAAAGCCTGG + Intronic
1132400328 15:101501276-101501298 TGAGTGCCAGGCCCAGGTCCAGG - Intronic
1132630051 16:912914-912936 TCAGCGCCAAGGTCAGGGCCAGG + Intronic
1132765846 16:1533825-1533847 TGAGTGCCAGGCTCCGGGCAGGG - Exonic
1133371894 16:5251510-5251532 TGAGTGGCAGGGTCAGAGACTGG + Intergenic
1133732329 16:8588601-8588623 TTAGTACCCAGCTCAGTGCCTGG - Intronic
1134047671 16:11112986-11113008 TTAGTGCCTAGTACAGAGCCTGG + Intronic
1134810001 16:17159200-17159222 TGTTTGCCAAGCCCAGTGCCAGG - Intronic
1135159067 16:20077499-20077521 TTAGTGCCAAGAGCAGTGCCAGG + Intergenic
1135161122 16:20097276-20097298 TGGGTACCAAGCTCAGTACCTGG - Intergenic
1135725808 16:24853194-24853216 TGGGTGCCAAGCTCTGTGCTAGG - Intronic
1136056788 16:27695660-27695682 CCAGTGCCAAGAACAGAGCCTGG + Intronic
1136298046 16:29314742-29314764 CCAGAGCCCAGCTCAGAGCCTGG - Intergenic
1136572978 16:31107945-31107967 TGAGTGCCTAGAACAGTGCCAGG - Exonic
1137627289 16:49917289-49917311 ACAGTGCCAAGCACAGACCCCGG - Intergenic
1137837133 16:51603406-51603428 TGAGTGCTAGGCTCAGTACCTGG - Intergenic
1138553919 16:57761427-57761449 TGAGTTCCAAGTGCAGAGCGTGG - Exonic
1138560883 16:57800433-57800455 TGTGTGCCCAGCTCTGTGCCAGG - Intronic
1138581021 16:57940392-57940414 TGAGGGCCACGCTCTGTGCCAGG + Intronic
1138982087 16:62281757-62281779 TTAGTGCCAAGCCCAGTGTCAGG - Intergenic
1139278963 16:65753390-65753412 TGAGAGCCAAGCACACTGCCAGG + Intergenic
1139405505 16:66714565-66714587 TGTGTGCCTAGCACAGTGCCTGG - Intergenic
1139429149 16:66901820-66901842 TGAGTGGCAGGCACAGGGCCAGG - Intergenic
1139436292 16:66938436-66938458 TGAATGCCAAGCCCTGATCCAGG - Intronic
1139645283 16:68324939-68324961 TCTGTGCCAAGCACAGAGCCAGG + Intronic
1140437224 16:74957411-74957433 TGAGTGCAGAGCACTGAGCCTGG - Intronic
1140477729 16:75247370-75247392 TGAGGGCCATTCTCAGAGCCAGG - Intronic
1140780755 16:78294267-78294289 TCTGTGCCAAGCCCAGTGCCGGG + Intronic
1140945965 16:79768766-79768788 TGACTGCCAGGCTCAGAGCAAGG + Intergenic
1141243256 16:82282810-82282832 TGAGTGCCCAGCTCTAAACCAGG - Intergenic
1142059692 16:88021247-88021269 CCAGAGCCCAGCTCAGAGCCTGG - Intronic
1143008566 17:3853090-3853112 TTAGTGTCTAACTCAGAGCCTGG + Intergenic
1143636611 17:8167493-8167515 TACATGCCAAGCCCAGAGCCTGG + Intergenic
1144038734 17:11389753-11389775 TCAGTGCCAAGACCAGTGCCAGG - Intronic
1144624393 17:16837413-16837435 TGAGTGCCCAGCACAGTGCCAGG - Intergenic
1144882035 17:18435307-18435329 TGAGTGCCCAGCACAGTGTCAGG + Intergenic
1145014678 17:19388394-19388416 TCAGTGCCCATCACAGAGCCTGG + Intergenic
1145150198 17:20509079-20509101 TGAGTGCCCAGCACAGTGTCAGG - Intergenic
1145248101 17:21283134-21283156 TGAGTGCCAAGCCCTAGGCCAGG + Intergenic
1145973396 17:28970081-28970103 GAAGTGCCCAGCTCAGGGCCTGG - Intronic
1146162131 17:30565724-30565746 TGAGTGCCCAGCACAATGCCAGG - Intergenic
1146794102 17:35769474-35769496 AGAGTGCCATGGGCAGAGCCAGG - Intronic
1146935011 17:36808015-36808037 TAAGTGCCAGGCTCGGAGCCAGG - Intergenic
1147041422 17:37722317-37722339 CCAGTGCCAAGCACAGTGCCTGG - Intronic
1147317652 17:39628422-39628444 TGATTGCCAAGCTGAGGGGCGGG + Intronic
1147328105 17:39679741-39679763 TGAGTGCCAGGCTGAGGGCTAGG - Intronic
1147578527 17:41616134-41616156 TGAGTGCCCAGCACAGTGCCAGG - Intergenic
1148722890 17:49767410-49767432 TCAGTGCCTAGCTCAGTGTCTGG - Intronic
1148732400 17:49845487-49845509 TGTGTGCAAGGCTCAGTGCCAGG - Intronic
1148969400 17:51466171-51466193 TGAATGCCAAGCTCTGTGGCAGG - Intergenic
1149295302 17:55256716-55256738 TCAGTGCCCAGCACAGTGCCTGG + Intergenic
1149468781 17:56899747-56899769 CTAGTGCCTAGCACAGAGCCTGG - Intronic
1149511030 17:57241936-57241958 TGAGTGTCCAGCTCTGTGCCAGG - Intergenic
1149781281 17:59398371-59398393 TTATTACTAAGCTCAGAGCCTGG - Exonic
1150284289 17:63946599-63946621 TGAGGGGAAGGCTCAGAGCCAGG + Intronic
1151178060 17:72305343-72305365 TAAGTGTCCAGCTCAGTGCCTGG + Intergenic
1151349237 17:73521886-73521908 TGTGTGCCAAGCCCTCAGCCAGG - Intronic
1151458776 17:74242337-74242359 CTGGTGCCAAGCTCAGTGCCTGG + Intronic
1151525025 17:74659194-74659216 TAAGTGCTAAGCCCAGTGCCTGG - Intergenic
1151525108 17:74659842-74659864 TGAGTGCCTAGCACAGTACCTGG + Intergenic
1152458783 17:80430714-80430736 TGGGTGCCAGGCTCTGTGCCCGG + Intronic
1153711534 18:7804451-7804473 TGGTTACAAAGCTCAGAGCCCGG - Intronic
1153972531 18:10239457-10239479 TGAGTGACAAGCTCCCTGCCAGG + Intergenic
1154290395 18:13101718-13101740 CAAGTGCCAGGCTCAGAGCGGGG - Intronic
1156510709 18:37634341-37634363 TGAATGAAAAGCACAGAGCCTGG - Intergenic
1156526807 18:37775556-37775578 TGAGTGCCAGGGTCTGAGGCAGG + Intergenic
1156704128 18:39859366-39859388 TGAGTGGCAAGCTAATATCCAGG - Intergenic
1157477775 18:48034464-48034486 AGAAGGCCAAGCCCAGAGCCAGG + Intronic
1158700450 18:59741107-59741129 TAAGTGCCTAGCACAGTGCCTGG - Intergenic
1159361362 18:67408244-67408266 TGAATGCCATGCTAAGAACCAGG + Intergenic
1159845473 18:73454284-73454306 GGAGTGCCGAGATCAAAGCCTGG + Intergenic
1160142810 18:76340404-76340426 TTAGTGACCAGCTCAGTGCCTGG - Intergenic
1160218147 18:76952413-76952435 TCAGAGCCCAGGTCAGAGCCTGG - Intronic
1161064649 19:2231639-2231661 TGAGCCCCAAGCCCCGAGCCTGG + Exonic
1161076680 19:2289323-2289345 TGAGAGCAAAGCTCACACCCGGG - Intronic
1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG + Intronic
1161319428 19:3634130-3634152 TGAGGGCCAAGTTCAGGGCTAGG + Intronic
1161332476 19:3694873-3694895 TGTTTGCCCAGCCCAGAGCCGGG - Intronic
1161622206 19:5304102-5304124 TTAGTGCTCAGCCCAGAGCCTGG - Intronic
1161631131 19:5356185-5356207 TCAGTGACTAGCTCAGGGCCTGG + Intergenic
1161960537 19:7520632-7520654 AGAGTGCCCGGCCCAGAGCCAGG - Exonic
1162110283 19:8396361-8396383 TGTGTGCCAAGCACTGTGCCAGG + Intronic
1162531539 19:11238966-11238988 TGAGTGCTTAGAACAGAGCCTGG - Intronic
1162762435 19:12896683-12896705 TGGGTTCGATGCTCAGAGCCAGG - Intronic
1163574664 19:18103661-18103683 TGAGTAGCAAGCTCAGAGCCTGG - Intronic
1163598969 19:18236717-18236739 TGTGTGCCAAGTACAGGGCCTGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1164145717 19:22511304-22511326 CCAGTGCCCAGCACAGAGCCTGG + Intronic
1164758391 19:30708109-30708131 TGAATGCCAAGCCCAGTGCCTGG - Intronic
1165044324 19:33092677-33092699 TGAGTGCCAGGCCTAGAGTCAGG - Intronic
1165095041 19:33405677-33405699 GGAGTGCCAAGCTCCAAGCGTGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166041122 19:40203690-40203712 CGAGTGCCTAGCACAGTGCCTGG + Intronic
1166626052 19:44356850-44356872 CGGGTGCCAAGCTGAGAGCCTGG + Intronic
1166834045 19:45656205-45656227 GCATTGCCAAGCTCATAGCCTGG + Intergenic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
1167260399 19:48454713-48454735 TCAGTGACAGGCTCAGCGCCAGG + Exonic
1167744321 19:51341729-51341751 TGAGGGCCAAGATTTGAGCCCGG - Exonic
1168340062 19:55617578-55617600 CCAGTGCCCAGCTCAGGGCCTGG - Exonic
1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG + Intronic
1168723763 19:58569727-58569749 TGAGGGCCCAGCTCAGGGGCTGG + Intronic
925743962 2:7029352-7029374 TGGGTGCCAAGCACTGAGCTGGG + Intronic
925767099 2:7246782-7246804 AGAGTGCCATCATCAGAGCCAGG - Intergenic
925888018 2:8410304-8410326 TAAGTGCCAAGGCCAGTGCCAGG - Intergenic
926220411 2:10932379-10932401 TGCTTGCCAAGCTGAGAGCCTGG - Intergenic
926350300 2:11987889-11987911 TGAGTGCCAAACCCTGTGCCAGG + Intergenic
926424655 2:12729901-12729923 TAAGTGCCCAGCACAGTGCCTGG + Intronic
926688358 2:15715836-15715858 CCAGCGCCAAGCTCAGGGCCTGG + Intronic
927520011 2:23692973-23692995 GGAGAGCCCTGCTCAGAGCCTGG - Intronic
928093322 2:28389948-28389970 TGAGTGCTAAAATCAGAGCCAGG - Intergenic
928230443 2:29494169-29494191 TGGGTGACAGGCTCTGAGCCAGG - Intronic
928338566 2:30421357-30421379 TGAATACCAAACTCAGAGCCAGG - Intergenic
928375418 2:30769583-30769605 CCAGTGCCAAGCACAGTGCCTGG + Intronic
929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG + Intergenic
929664925 2:43826564-43826586 TGAGTTTTAAGCACAGAGCCTGG - Intronic
931073325 2:58680686-58680708 AAAGTGCCTAGCACAGAGCCAGG + Intergenic
931163970 2:59725326-59725348 TGTGTGCCAGGCTCAGAGCTGGG - Intergenic
931692337 2:64845876-64845898 TCAATGCCAAGCACAGAGCCTGG + Intergenic
932068300 2:68589978-68590000 TTAGTGCCAAGCTCTGCTCCAGG + Intronic
932435534 2:71700789-71700811 TGAGTGTCAGGGGCAGAGCCGGG + Intergenic
933699676 2:85245488-85245510 TGAGCTACAAGGTCAGAGCCAGG + Intronic
934503776 2:94877043-94877065 GGTGTGTCCAGCTCAGAGCCAGG + Intergenic
934562174 2:95319046-95319068 TGAGTGCCTTGCACAGAGCCTGG + Intronic
934564952 2:95333672-95333694 TGAGTGCCTAGGACAGTGCCTGG + Intronic
934769590 2:96899373-96899395 TGAGTGCCAGGCTCTGTGCCAGG - Intronic
936519920 2:113205292-113205314 AGAGTGCCAAGCTCAGGGCTTGG + Intronic
937019139 2:118634182-118634204 TGGGAGCCAAGCACAGAGCAAGG + Intergenic
937593364 2:123642348-123642370 TCAGTACCTAGCTCAGTGCCTGG + Intergenic
937971000 2:127549414-127549436 TGAGTGCCACGCTCACTACCTGG - Intronic
938390123 2:130898440-130898462 CTAGTGCCAAGCACAGGGCCTGG + Intronic
938547395 2:132347306-132347328 AGGGTGCCAAGCGGAGAGCCTGG - Intergenic
939961956 2:148572927-148572949 TGAGTGCCAAGCTCTGTGCTAGG - Intergenic
940840935 2:158580953-158580975 TGAGCGCCAGGCTCTGTGCCAGG - Intronic
941578974 2:167271329-167271351 TGTGTTCCAAGCTCACAGCAAGG + Intergenic
941789256 2:169533419-169533441 AGAATGCCAAGCTCAAATCCTGG + Intronic
943236432 2:185326759-185326781 TCAGTGCTTAGCACAGAGCCTGG - Intergenic
943708484 2:191061589-191061611 TGTGTGCCCAGCTCTGAGCTTGG - Intronic
944216307 2:197259673-197259695 CTAGTGCCAAGCTCAGCACCTGG - Intronic
945009714 2:205448027-205448049 CCAGTGCTAAGCACAGAGCCTGG - Intronic
946171429 2:217898272-217898294 TGACTCCAGAGCTCAGAGCCAGG + Intronic
946415121 2:219536380-219536402 TGGGTGCCAGGCTCAGTGCTGGG + Intronic
946426046 2:219597682-219597704 TGGGTGCCCAGCTCCGGGCCAGG + Intergenic
1168730811 20:79407-79429 TGAGTGCCAGGACCAGATCCTGG + Intergenic
1168852070 20:983910-983932 TGAGTGGCAAACTCAAAGCCAGG + Intronic
1171257779 20:23703895-23703917 TAAGTGCCAGTCCCAGAGCCAGG - Intergenic
1171265264 20:23766560-23766582 TAAGTGCCAGTCCCAGAGCCAGG - Intergenic
1171274859 20:23847906-23847928 TAAGTGCCAGTCCCAGAGCCAGG - Intergenic
1171876263 20:30580061-30580083 AGGGTGCCAAGCGGAGAGCCTGG - Intergenic
1172206527 20:33166662-33166684 TGAGGGCAGTGCTCAGAGCCTGG - Intronic
1172646721 20:36474834-36474856 TGAGTGCCAAGTGCTGTGCCAGG + Intronic
1173643158 20:44617429-44617451 GGAGTGCCAAACTCACACCCAGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1173851969 20:46224313-46224335 CTAGTGCCTAGCACAGAGCCAGG + Intronic
1173911347 20:46673340-46673362 TGTGTGCCAAGCACAGTGCTAGG + Intronic
1173929695 20:46808168-46808190 TGAGTGCCAGGCTCTGCGCTAGG + Intergenic
1174334515 20:49849432-49849454 TGTGTGGCAAGCTGGGAGCCCGG - Intronic
1174396480 20:50250097-50250119 TGAGATCCCAGCACAGAGCCTGG - Intergenic
1174403979 20:50292050-50292072 TGAGTGCCAGGCACTGAGCTGGG - Intergenic
1174443992 20:50578227-50578249 TCAGTGTCAAGCCCAGGGCCTGG + Intronic
1174551485 20:51365823-51365845 AGACTTCCAAGTTCAGAGCCTGG + Intergenic
1175162213 20:57017354-57017376 TGAGTGCCCAGCTCATTGTCTGG - Intergenic
1175415362 20:58797267-58797289 TGAGTGCCAGGCACAGTGCTGGG - Intergenic
1175487018 20:59353904-59353926 TGGCTGCCAGGCGCAGAGCCTGG - Intergenic
1175574636 20:60051852-60051874 GAAGTGCCAAGCTCAGAACTTGG - Intergenic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1176059395 20:63165742-63165764 TCAGGGCCAAGCTCATGGCCAGG + Intergenic
1176622247 21:9068117-9068139 CGTGTGTCCAGCTCAGAGCCAGG - Intergenic
1178436836 21:32567419-32567441 TGAGTGCAGAGCACAGATCCTGG + Intergenic
1178799767 21:35781856-35781878 TGAGCACCAAGCTCAGTACCTGG + Intronic
1178809953 21:35872465-35872487 TCACTGCCAAGCCCAGTGCCTGG + Intronic
1178973130 21:37198965-37198987 CCAGTGCAAAGCTCGGAGCCAGG - Intronic
1179551004 21:42143976-42143998 AGAGCGCTAAGCTCAGGGCCTGG - Intergenic
1180976569 22:19851948-19851970 TGGGTACCAGGCTCAGACCCAGG - Exonic
1181637484 22:24181186-24181208 AGAGGGCGAAGCTCAGACCCTGG - Intergenic
1181808891 22:25391645-25391667 AAAGTGCCTAGCTCAGGGCCTGG - Intronic
1181970154 22:26683809-26683831 TAGGTGCCTAGCACAGAGCCTGG - Intergenic
1181991527 22:26840520-26840542 TGTGTGCCAGGCCCAGAGCTAGG + Intergenic
1182409616 22:30172481-30172503 TTAGTGCCCAGCTCATGGCCTGG + Intronic
1183262693 22:36806078-36806100 GGAGTGCCCAGCACAGTGCCTGG + Intronic
1183329401 22:37211490-37211512 GGCGTGCCAAGCACAGTGCCGGG + Intronic
1183450249 22:37890175-37890197 TGAGTGCCCAGTGCAGTGCCTGG + Intergenic
1183495169 22:38139167-38139189 TGTGTGCCCAGCTCAAAGCCTGG - Intronic
1183544738 22:38449414-38449436 TGAGTGCCAGGCTCAGCGCTGGG - Intronic
1183603173 22:38851789-38851811 CGAGTGTGCAGCTCAGAGCCTGG + Intergenic
1183703770 22:39464396-39464418 TACGTGCCAGGCACAGAGCCAGG - Intronic
1184101824 22:42344791-42344813 TGTGGGCCAGGCCCAGAGCCAGG - Intergenic
1184169006 22:42747983-42748005 TGATTGCCGAGCACAGAGCAAGG + Intergenic
1184522090 22:45000791-45000813 AAAGTGCCCAGGTCAGAGCCCGG + Intronic
1184784501 22:46665189-46665211 TCTGTGCCCAGCACAGAGCCCGG - Intronic
1184992856 22:48182390-48182412 TGTGTGCCCAGTACAGAGCCAGG + Intergenic
1185173347 22:49305804-49305826 AGAGGGTCCAGCTCAGAGCCTGG - Intergenic
1185365636 22:50435433-50435455 TGAGTGCAGAGCACACAGCCAGG - Intronic
949726183 3:7048253-7048275 GGAGTACCAAGCTCAGAGTTGGG + Intronic
950307900 3:11930379-11930401 TGAATGCCAAGGTCAGGTCCCGG - Intergenic
950651398 3:14409581-14409603 TGTGTGCCAGGCACAGGGCCAGG + Intronic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
950663655 3:14482173-14482195 TGGATGCCAAGCTAAGAGCTGGG + Intronic
950691497 3:14661952-14661974 TGTGTGCCCAGCTCTGTGCCAGG + Intronic
951755640 3:26087929-26087951 TGTGGGCCAAGCCCAGGGCCTGG - Intergenic
953245179 3:41184547-41184569 TGATTGCCAGGCTCAGTGACTGG + Intergenic
953737764 3:45510901-45510923 CCAGTGCCTAGCTCAGTGCCAGG + Intronic
954121943 3:48504618-48504640 TGAGTGCCAAGGTCTGCGCTGGG - Intronic
954329218 3:49880639-49880661 TGGGTGCCATGCTCAGGGCCAGG + Intergenic
954475768 3:50744214-50744236 AGAGTGCCAAGCTCACAGAGTGG - Intronic
954883385 3:53851236-53851258 TGAGTGCCAGGCACAGAGAGAGG + Intronic
955065109 3:55527060-55527082 TCAGTGCCTAGCACAGTGCCTGG + Intronic
955410095 3:58649926-58649948 TGAGGGCCAAGCCCGGTGCCTGG + Intronic
956906003 3:73766064-73766086 TGTGTGCCAAGCTCTGTGCTAGG + Intergenic
956906004 3:73766070-73766092 TGGGTGCCTAGCACAGAGCTTGG - Intergenic
959087025 3:101862395-101862417 TCAGTGCCTAGCACAGTGCCTGG + Intergenic
959108492 3:102093744-102093766 CCAGTGCCTAGCTCAGAGCCTGG + Intergenic
959400668 3:105898259-105898281 CGAGTGCCAAGCACATTGCCTGG - Intergenic
959667466 3:108937665-108937687 TGTGTGCAAAGCACAGTGCCTGG - Intronic
960176315 3:114521977-114521999 TCAGTGCCTAGTACAGAGCCTGG - Intronic
960682506 3:120263825-120263847 TGCTGGCCCAGCTCAGAGCCGGG - Intronic
960712508 3:120545201-120545223 ACAGTGCCAAGTTCAGATCCAGG + Intergenic
961283030 3:125778363-125778385 TGAGTGTCAGGGTCAGAGACTGG + Intergenic
961457192 3:127030119-127030141 AAAGTGCCAAGCCCAGAGCAAGG + Intronic
961566821 3:127769888-127769910 TGAGTGCTCAGCTCAGTGACCGG + Intronic
962771124 3:138611039-138611061 TTAGTGCCCTGCCCAGAGCCTGG + Intronic
962852656 3:139319458-139319480 TGGGTGCAGAGCCCAGAGCCAGG + Intronic
962956071 3:140268063-140268085 TTAGTGCCAAGCTCTGAGCTTGG + Intronic
964478900 3:157122655-157122677 GGAGTGCCTAGCACAGAGCCGGG - Intergenic
965386325 3:168050437-168050459 TGAGTGCACAGTTCAGGGCCTGG - Intronic
965629095 3:170712312-170712334 CCAGTGCCCAGCACAGAGCCTGG - Intronic
965807583 3:172558160-172558182 TGGGAGACAAGCCCAGAGCCTGG - Intergenic
966718536 3:183038071-183038093 TAAGTGCCAGGCTCTGATCCAGG + Intronic
966742951 3:183250936-183250958 GGAGTGCTGAGCTCAGAGCCTGG - Intronic
967023628 3:185544787-185544809 TCAGTGCCAAGAACAGGGCCTGG + Intronic
967963142 3:194941167-194941189 TGAGTGCCTGGCACAGCGCCTGG + Intergenic
968752920 4:2399535-2399557 CAAGTCCCAAGCTCAAAGCCTGG + Intronic
968973914 4:3811276-3811298 CGAGTGCCAGGCTCAGAGGCAGG - Intergenic
969291255 4:6241518-6241540 CCAGTGCCCAGCTCAGGGCCTGG - Intergenic
969484186 4:7462680-7462702 TGCGTGCCAGACCCAGAGCCAGG - Intronic
969512252 4:7625450-7625472 CTAGTGCCTAGCACAGAGCCAGG + Intronic
969739253 4:9012382-9012404 TGAGTGGCAGGGTCAGAGACTGG + Intergenic
969798437 4:9543895-9543917 TGAGTGGCAGGGTCAGAGACTGG + Intergenic
970576582 4:17434839-17434861 TGTCTGCCTAGCTCAGTGCCTGG - Intergenic
972346322 4:38195499-38195521 TGAGTACCAAGCTCAGTGCCAGG - Intergenic
972532021 4:39969814-39969836 TCAGTGCCAAGCTTAATGCCTGG - Intronic
973777714 4:54258231-54258253 TGGGTGCCCAGGTCTGAGCCTGG + Intronic
973812358 4:54583919-54583941 TGTGTGCCAAGCACTGTGCCAGG - Intergenic
973965412 4:56156961-56156983 TCAGTGCCAAGAGCAGTGCCTGG + Intergenic
974010771 4:56605276-56605298 CCAGTGCCAAGCACAGGGCCTGG - Intergenic
974019668 4:56681731-56681753 TGGATGCCAAGCTAAGAGCCTGG + Intronic
974626367 4:64432317-64432339 AGAGTGCCAGGCTGAGAGCATGG + Intergenic
974786928 4:66630520-66630542 TCAGTGCCCAGGTCAGAGTCTGG + Intergenic
981410573 4:144425551-144425573 TGAGTTCCTAGCTCAGTGCCTGG - Intergenic
982036796 4:151353872-151353894 TGAGTGCCAAGCACTGGGCAGGG - Intergenic
984598259 4:181696647-181696669 TCAGTGCCTAGCACAGGGCCTGG + Intergenic
984679514 4:182591063-182591085 TCAGTGCCTAGAACAGAGCCTGG + Intronic
984945267 4:184965621-184965643 TGAGTGCCAGGATGAGTGCCAGG + Intergenic
984945270 4:184965633-184965655 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945324 4:184965864-184965886 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945367 4:184966047-184966069 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945489 4:184966529-184966551 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945522 4:184966664-184966686 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945617 4:184967032-184967054 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945714 4:184967402-184967424 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945786 4:184967675-184967697 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
984945814 4:184967785-184967807 TGAGTGCCAGGATGAGTGCCGGG + Intergenic
985398773 4:189572944-189572966 TAAGTGCCAAGCTTCGAGCTAGG + Intergenic
985779856 5:1864836-1864858 TAAGTCCCAGGGTCAGAGCCAGG - Intergenic
986012444 5:3728335-3728357 TGAGTGCCAGGCACAGTACCAGG + Intergenic
986108438 5:4685363-4685385 AGAGTGACCAGCTCAGAGCAGGG + Intergenic
986601308 5:9475764-9475786 TCAGTGCCAAGCAAAGAACCTGG + Intronic
987113819 5:14711513-14711535 TGCCTGCCTAGCTCAGTGCCAGG - Intronic
987381566 5:17290234-17290256 TCAGTGCCAAGCTTCAAGCCCGG - Intergenic
988195447 5:27999456-27999478 TGGGTACCATGCTCAGTGCCTGG - Intergenic
988342824 5:29997088-29997110 TTAGTGCCTAGCAAAGAGCCTGG - Intergenic
991419352 5:66425773-66425795 GGAGTGCCAAGAGCAGAGGCAGG + Intergenic
992524722 5:77597435-77597457 TGAGGGCCAAACTCAGATCAGGG - Intronic
992620290 5:78585740-78585762 TAAGTGCCTAGCACAGTGCCCGG - Intronic
993110152 5:83646749-83646771 TGGGTTCCCAGCTCAGTGCCTGG - Intronic
995282831 5:110355070-110355092 TCACTGCCTGGCTCAGAGCCTGG + Intronic
996585438 5:125082801-125082823 TGTGGGCCAAGGTCAGAGCAAGG + Intergenic
996589450 5:125129531-125129553 TGTGTGCCAAGCTCCGTGCTGGG + Intergenic
996647119 5:125829412-125829434 TGTGTGCTAATGTCAGAGCCTGG + Intergenic
996698979 5:126429957-126429979 TGAGTAAAAAGCTCAGTGCCAGG - Intronic
997227389 5:132219360-132219382 TGAGTGCCTAGATCAGTGCCTGG - Intronic
997640123 5:135443519-135443541 AGAGTGCTTGGCTCAGAGCCTGG + Intergenic
997724811 5:136111789-136111811 TTAGTCCCAGGCTCAGAGCTTGG + Intergenic
998014573 5:138722129-138722151 TGAGTTCCAGGCTCAGGGCTTGG + Intronic
998226160 5:140328106-140328128 AAAGTGCCTAGCTCAGGGCCAGG - Intergenic
998430152 5:142063672-142063694 TCAGTGCCAGGCACTGAGCCTGG + Intergenic
998562153 5:143181596-143181618 TCAGTGCCAAGCACAGTGGCTGG + Intronic
998593566 5:143503397-143503419 TCAGTGCCAAGCACAGAGCTGGG + Intergenic
998640508 5:144005057-144005079 AGAGTGCTTAGCACAGAGCCTGG - Intergenic
999158204 5:149473577-149473599 TGAATGCCAGGCACAGAGACAGG - Intergenic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
999975708 5:156909999-156910021 TGAATTCCAAGCACAAAGCCAGG + Intergenic
1000448635 5:161356937-161356959 TAAGTGCCAAGTGCAGTGCCTGG - Intronic
1001599364 5:172919046-172919068 CCAGCGCCAAGCACAGAGCCAGG - Intronic
1001760603 5:174205000-174205022 AGAATACCAAGCTCAGACCCAGG - Intronic
1001828297 5:174764382-174764404 AGAGTGACACGCCCAGAGCCGGG + Intergenic
1002077774 5:176719278-176719300 TGTGTCCCAAGCACAGAGCCTGG + Intergenic
1002087380 5:176784719-176784741 TGAGTGCCAAGCAGAGAGGAAGG + Intergenic
1002315772 5:178342090-178342112 TCAGTGCCCAGCTCTGAGCCAGG + Intronic
1002461942 5:179378274-179378296 TCAGTGCCCAGCCCAGTGCCTGG + Intergenic
1002829493 6:806318-806340 TGTGTAGCAATCTCAGAGCCAGG + Intergenic
1002932798 6:1645976-1645998 TGCGTGCCAGGCACAGTGCCAGG - Intronic
1004161257 6:13215184-13215206 CCAGTGCCAAGCACGGAGCCTGG - Intronic
1004334209 6:14749513-14749535 TGAGTGGCAAGGGCAGAGCCAGG - Intergenic
1004785247 6:18961223-18961245 TTAGTACCTAGCACAGAGCCTGG - Intergenic
1005403855 6:25464467-25464489 AGAGTGCCAAGCACAGGGCCGGG + Intronic
1006379615 6:33689944-33689966 CCAGTGCCCAGCTCAGAGCCTGG - Intronic
1006786215 6:36669133-36669155 CTAGAGCCAAGTTCAGAGCCAGG - Intergenic
1006851348 6:37101085-37101107 CCAGTGCCTAGCTCAGTGCCTGG + Intergenic
1007496769 6:42265343-42265365 TGTGTGCCAAGCATAGAGCTAGG - Intronic
1008621699 6:53277449-53277471 TGAGTGCCAGGCCCAGCACCTGG + Intronic
1010230283 6:73528563-73528585 CTAGTGCCTAGCTCAGTGCCTGG - Intergenic
1013170718 6:107634653-107634675 TGGGCGCCAGGCTCAGGGCCTGG - Exonic
1014305224 6:119732893-119732915 TCAGTGCCCAGCTCAGTACCTGG - Intergenic
1015019355 6:128453464-128453486 AAAGGGCCAAGCTCAAAGCCTGG + Intronic
1016346008 6:143114926-143114948 AAAGTGCCCAGCACAGAGCCTGG + Intronic
1016466562 6:144331326-144331348 TAAGTGCCAAGTTCTGTGCCAGG - Intronic
1017772315 6:157652802-157652824 TGTGTGCCAGGCACAGGGCCAGG + Intronic
1018202739 6:161410550-161410572 TGTGTGTCCAGCTCAGACCCGGG - Intronic
1018287709 6:162258291-162258313 TCTGTGCCAAGCACAGTGCCAGG - Intronic
1019073285 6:169367114-169367136 TGGGTGCCGTGCTCAGTGCCTGG - Intergenic
1019232773 6:170582724-170582746 TGAGTGCCTAGCACAGTGTCGGG - Intronic
1019316812 7:390777-390799 GCAAAGCCAAGCTCAGAGCCTGG + Intergenic
1020502849 7:8944709-8944731 TGTGTGCCTAGCACATAGCCAGG - Intergenic
1021157863 7:17234254-17234276 TCTGTGTCAACCTCAGAGCCAGG - Intergenic
1021655225 7:22867873-22867895 TGAGGCCACAGCTCAGAGCCAGG - Intergenic
1021734145 7:23626603-23626625 TGGGTACCAAGCTCAGTACCTGG - Intronic
1022475032 7:30704491-30704513 TGAGAGCCAAGCCAAGAGCATGG + Intronic
1022672772 7:32471764-32471786 TGAAGGCCAAGTTGAGAGCCTGG - Intergenic
1022966783 7:35481557-35481579 TCAGTGCCGAGCACAGTGCCTGG + Intergenic
1023889921 7:44384731-44384753 TGTCTGTCAAGCTCAGAGCATGG - Exonic
1028931171 7:96414740-96414762 TGAATGCCTAGCGCAGGGCCTGG + Intergenic
1029034329 7:97503110-97503132 TCAATGCCAAGCACAGTGCCTGG + Intergenic
1029076735 7:97940643-97940665 AGAGCGCAGAGCTCAGAGCCTGG + Intergenic
1029184036 7:98725840-98725862 TGTGTGCCAGGCCCTGAGCCAGG + Intergenic
1029900565 7:104034836-104034858 TGATTGCCAGGCACTGAGCCAGG - Intergenic
1029987078 7:104931842-104931864 TGACTGTCAAAGTCAGAGCCTGG - Intergenic
1030921800 7:115399431-115399453 TGTGTGCCAGACCCAGAGCCAGG + Intergenic
1031845473 7:126800550-126800572 TGAGCTGCAAGCTCAGAGGCTGG - Intronic
1031997578 7:128242731-128242753 CAAGTGCCAAGGACAGAGCCAGG + Intronic
1032447396 7:131996354-131996376 TGAGTGCCTAGAACAGAACCAGG + Intergenic
1032841502 7:135717599-135717621 TGTGTGCAAAGCTCAGACTCAGG - Intronic
1033584123 7:142761651-142761673 TGACTGCAAAGCTCCCAGCCAGG + Intronic
1033822520 7:145151284-145151306 TAAGTGCCTAGATCAGTGCCTGG + Intergenic
1034094375 7:148392899-148392921 TGAGTTCCTAGCTCAGTGCTGGG - Intronic
1034213218 7:149383089-149383111 ACAGTGTCCAGCTCAGAGCCTGG - Intergenic
1034267112 7:149786382-149786404 TGAGAGCTAAGCTGACAGCCAGG + Intergenic
1034447294 7:151120199-151120221 TGAGCGCCGAGCTCCCAGCCAGG + Intronic
1034497166 7:151430042-151430064 TGACTGCAAACCTCTGAGCCTGG - Exonic
1035260554 7:157659157-157659179 TGAGTCCGAAGCAGAGAGCCCGG - Intronic
1036199363 8:6754534-6754556 TGAGTGCCCAGCTGTGTGCCAGG + Intronic
1036244326 8:7103602-7103624 TGAGTGTCAGGGTCAGAGACTGG + Intergenic
1036256415 8:7210137-7210159 TGAGTGGCAGGGTCAGAGACTGG - Intergenic
1036308465 8:7668722-7668744 TGAGTGGCAGGGTCAGAGACTGG - Intergenic
1036361069 8:8077355-8077377 TGAGTGGCAGGGTCAGAGACTGG + Intergenic
1036889895 8:12589646-12589668 TGAGTGTCAGGGTCAGAGACTGG - Intergenic
1036897502 8:12647807-12647829 TGAGTGTCAGGGTCAGAGACTGG - Intergenic
1036934670 8:12989663-12989685 CGACTGCCCAGGTCAGAGCCTGG + Intronic
1038227747 8:25672569-25672591 GGAGTGGGAAGCTCAGAGCAGGG + Intergenic
1038419242 8:27421806-27421828 GGAGTGCCAAGCCCAGCACCAGG + Intronic
1039094706 8:33871130-33871152 AGAGGACCAAGCTCAGACCCCGG - Intergenic
1039591677 8:38755369-38755391 TTAGTGCCCAGCACAGTGCCTGG - Intronic
1040966228 8:53083460-53083482 TGAGTGCCAAGTGCACAGCATGG - Intergenic
1041415132 8:57599607-57599629 TCAGTGCCTACATCAGAGCCTGG - Intergenic
1042793034 8:72629757-72629779 TCAGTGCCTAGCACAGAGCCTGG - Intronic
1042807310 8:72784850-72784872 TGAGGGGCAAGCTCAGGGCTGGG - Intronic
1043394193 8:79820957-79820979 TCAGTACCAAGCCCAGTGCCTGG - Intergenic
1045252874 8:100496072-100496094 TTAGGGCCCAGCTCTGAGCCAGG - Intergenic
1046676319 8:117112487-117112509 TGAGTGTCAAGGTCTGAGCTGGG + Intronic
1047412445 8:124635076-124635098 TCAATGCCTAGCTCAAAGCCTGG + Intronic
1047494479 8:125399751-125399773 TCAGTGCCTAGCACAGTGCCTGG + Intergenic
1048130046 8:131685891-131685913 TCAGTGCCTAGCACAGAGCCTGG - Intergenic
1048523291 8:135177423-135177445 AGGGGGCCAAGCTGAGAGCCAGG + Intergenic
1048966700 8:139620110-139620132 TCAGTGACAATGTCAGAGCCAGG + Intronic
1049249689 8:141581724-141581746 TGGGTGCCAGGCCCAGAGCCGGG + Intergenic
1049293691 8:141818173-141818195 GGAGTGCCAAGCTCAACCCCAGG + Intergenic
1051068988 9:13139414-13139436 AGAGTGCTAAGCACAGTGCCTGG - Intronic
1051222125 9:14859933-14859955 TGGGTGCCCAGCTCAGTGCTTGG + Intronic
1051376236 9:16405375-16405397 TAAATGCCAAAGTCAGAGCCAGG - Intergenic
1052882681 9:33613815-33613837 TGACTGCAAAGCTCCCAGCCAGG - Intergenic
1052901306 9:33796819-33796841 TGACTGCAAAGCTCCCAGCCAGG + Intronic
1052914670 9:33915692-33915714 TCAGTGCCTAGCACATAGCCTGG - Intronic
1053306762 9:36989857-36989879 TTAGTGCCCAGCACAGGGCCTGG - Intronic
1056243369 9:84670233-84670255 TGAGTGCCCAGCTCCGGCCCAGG - Intronic
1056605164 9:88079278-88079300 TAAGCACCAAGTTCAGAGCCAGG - Intergenic
1057534535 9:95886633-95886655 TCAGTGCCAATCACAGTGCCTGG - Intronic
1057726257 9:97570699-97570721 TCAGTGCCCAGCTCAGGACCTGG + Intronic
1057891876 9:98875749-98875771 TGTGTGCCTAGCCCAGTGCCTGG - Intergenic
1057942172 9:99294811-99294833 CCAGAGCCAAGCCCAGAGCCTGG - Intergenic
1058002149 9:99876899-99876921 TAAGTGCCTAGTTCAGTGCCTGG + Intergenic
1058077355 9:100664505-100664527 TGAGGGGCAAACTCAGAGCGGGG + Intergenic
1058428863 9:104900345-104900367 TCAGAGCCCAGCACAGAGCCTGG - Intronic
1059367687 9:113799495-113799517 TGAGTGCCAGGCACTGAGCTGGG - Intergenic
1059460950 9:114429662-114429684 TGAGTACCAAGCCCCGAGCCAGG - Intronic
1059676540 9:116545757-116545779 TCAATGCCCAGCTCAGTGCCTGG - Intronic
1059861043 9:118462147-118462169 TGAATGCTTAGCTGAGAGCCTGG + Intergenic
1060151616 9:121292532-121292554 TGTGTGCCAAACACAGTGCCAGG + Intronic
1060244259 9:121930831-121930853 TAAGTGCCAAACTCAGCGCGAGG - Intronic
1060247286 9:121957420-121957442 TCAGTGACAGGCTCAGAGCGGGG - Intronic
1060250165 9:121979994-121980016 TCAGTGCCAAGAACAGTGCCTGG - Intronic
1061369633 9:130191226-130191248 TGTGTCCCAAGCCGAGAGCCTGG + Intronic
1061384684 9:130282252-130282274 TGCGTGCTAAGCTCTGTGCCAGG + Intergenic
1062202033 9:135308566-135308588 TGAGAGCCCAGCGCAGAGCCAGG + Intergenic
1062281921 9:135755912-135755934 TGAATGCCAAGGACAAAGCCAGG + Intronic
1185445086 X:253675-253697 TGAGTGCCCTGCTGAGTGCCAGG - Intergenic
1187423449 X:19156515-19156537 TGAGTGCCAAGGTCAGAGCTGGG + Intergenic
1187494717 X:19785063-19785085 CCAGTGCCAAGCACAGTGCCAGG + Intronic
1189163227 X:38832605-38832627 TAAGTGCCAAGCATAGTGCCTGG + Intergenic
1189246359 X:39566456-39566478 TGTGTGCCCAGCACAGTGCCAGG + Intergenic
1189611594 X:42742172-42742194 TAAGTACTAGGCTCAGAGCCTGG - Intergenic
1189984557 X:46542686-46542708 TGTGTGACAACGTCAGAGCCTGG + Intronic
1190870085 X:54417542-54417564 TGAGTGCTATGCTCAGTACCTGG + Intergenic
1191978609 X:66901210-66901232 TGTGTGCCAAGCTATGAGCTTGG - Intergenic
1192033426 X:67539352-67539374 CAAGTGCCTAGCACAGAGCCTGG + Intergenic
1192549220 X:72040663-72040685 TGAGTGCTTGGCACAGAGCCTGG - Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1193416684 X:81233644-81233666 TGGGTGCCAAGCTTGGAGCCAGG + Intronic
1194445028 X:93976337-93976359 TGCGTCCCAAGCACAGAGCTGGG - Intergenic
1196034414 X:111128415-111128437 TGGGTGCCAAGCTATGTGCCAGG + Intronic
1196217767 X:113073415-113073437 TGAGTGCCTAGCACAGTGCCAGG + Intergenic
1196551670 X:117034208-117034230 TTAGTGCCTAGCACAGTGCCAGG + Intergenic
1196938249 X:120750934-120750956 TCAGTGCCAAATTCAGGGCCTGG + Intergenic
1198269987 X:135047719-135047741 TGATGGCCAAGCTTAGAGCCAGG + Intergenic
1198387873 X:136146729-136146751 CATGTGCCAAGCTCAGTGCCGGG - Intergenic
1198806212 X:140497938-140497960 TGAGAGCTAAGCACAGTGCCTGG - Intergenic
1199777856 X:151031362-151031384 TGAGTACCCAGCACAGTGCCTGG - Intergenic
1199855821 X:151758097-151758119 TGGGTGCCAAGCACAGTGCCAGG - Intergenic