ID: 906153596

View in Genome Browser
Species Human (GRCh38)
Location 1:43601571-43601593
Sequence GGGATGCTTTGGCGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 0, 2: 2, 3: 85, 4: 935}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906153589_906153596 10 Left 906153589 1:43601538-43601560 CCTGGGGTGATTGTGTAATGTAT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 906153596 1:43601571-43601593 GGGATGCTTTGGCGGGTGGAAGG 0: 1
1: 0
2: 2
3: 85
4: 935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906153596 Original CRISPR GGGATGCTTTGGCGGGTGGA AGG Intronic
900646294 1:3710187-3710209 TGGATGCTGGGGCGGGGGGAGGG + Intronic
901130411 1:6959301-6959323 GGGAGGCTGGGGCAGGTGGAGGG + Intronic
901419051 1:9137910-9137932 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
901498033 1:9633546-9633568 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
901662453 1:10807096-10807118 TGGATGAATTGGCGGGTGGATGG - Intergenic
901662461 1:10807132-10807154 TGGATGAATTGGCGGGTGGATGG - Intergenic
902861380 1:19248748-19248770 GGGAGGCTGAGGTGGGTGGATGG - Intronic
902902143 1:19525111-19525133 AGGATGCTGTGGTGGGAGGATGG + Intergenic
902918294 1:19651797-19651819 GGGAAGCTGAGGCGGGAGGATGG - Intronic
903314909 1:22495753-22495775 GGGAGGCCAAGGCGGGTGGATGG - Intronic
903669347 1:25026203-25026225 GGGAGGCTGAGGCGGGTGGGTGG + Intergenic
904231855 1:29080626-29080648 GGGAGGCTGGGGAGGGTGGATGG - Intronic
904528589 1:31153701-31153723 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
904723244 1:32526872-32526894 GGGAGGCTGAGGCGGGAGGATGG + Intronic
905045711 1:34998880-34998902 GGGAGGCTGAGGCGGGAGGATGG + Intronic
905047140 1:35014361-35014383 GGGAGGCTGAGGCGAGTGGATGG + Intronic
905177008 1:36142925-36142947 GGGAGGCTGAGGCGGGAGGATGG + Intronic
905462929 1:38133336-38133358 GAGATGGTGTGGCGGGGGGATGG - Intergenic
905673881 1:39811652-39811674 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
905920994 1:41718572-41718594 GGGATGCTAAGCCGGGTGGCTGG - Intronic
905998952 1:42407143-42407165 GGGAGGCTGCGGTGGGTGGATGG - Intronic
906030970 1:42719765-42719787 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
906072938 1:43030655-43030677 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
906153596 1:43601571-43601593 GGGATGCTTTGGCGGGTGGAAGG + Intronic
906207209 1:43993199-43993221 GGGAGGCTGAGGCGGGAGGATGG + Intronic
906522268 1:46474655-46474677 GGGATGGGCTGGCGGGTGGGGGG - Intergenic
906522948 1:46477986-46478008 GGGATTCTTTGGGGGCTGGGAGG - Intergenic
906639709 1:47434379-47434401 AGGAAGCGTTGGCGGGCGGAGGG - Intergenic
907233037 1:53018500-53018522 GGGAGGCTGAGGCGAGTGGATGG + Intronic
907333938 1:53688350-53688372 GGGAAGACGTGGCGGGTGGAAGG + Intronic
907371280 1:54005133-54005155 TGGATGGTTTGGGGGGTGGGGGG + Intergenic
907929791 1:58988702-58988724 GGGATACTTTCGAGGGTGAAAGG + Intergenic
909448140 1:75770244-75770266 GGGAGGCTGAGGCGGGAGGATGG + Intronic
909523913 1:76600941-76600963 GGGAGGCTGAGGTGGGTGGATGG + Intronic
909715496 1:78702148-78702170 GGGAGGCTGTGGTGGGGGGAGGG + Intergenic
909746531 1:79104695-79104717 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
910220883 1:84888756-84888778 GGGATGGCTTGGCAGGTGGCAGG - Intronic
910234663 1:85023318-85023340 GGGAGGCTGAGGCGGGAGGATGG - Intronic
910258966 1:85277507-85277529 GGGAAGCCGAGGCGGGTGGATGG - Intergenic
910287865 1:85575124-85575146 AGGAGGCTAAGGCGGGTGGATGG + Intronic
910582102 1:88839845-88839867 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
910793107 1:91071525-91071547 GGGAGGCTTTGGAGGGGGCAGGG + Intergenic
911047776 1:93642777-93642799 GAGAGGCTTAGGTGGGTGGAGGG + Intronic
911114531 1:94233047-94233069 GGGTGGCTTTGGCGGGCAGATGG - Intronic
911764989 1:101663466-101663488 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
911778218 1:101842292-101842314 GGGAGGCTGGGGCAGGTGGATGG + Intronic
911811825 1:102292688-102292710 GGGGTCTTTTGGAGGGTGGATGG - Intergenic
911950167 1:104163269-104163291 GGGAGGCTGTGGGGGGAGGAGGG + Intergenic
912347637 1:108979419-108979441 GGGAAGCTAAGGCGGGAGGATGG + Intronic
912356250 1:109056323-109056345 GGGAGGATGAGGCGGGTGGATGG + Intergenic
914254907 1:145953949-145953971 GGGAGGCTGAGGCGGGTGGGAGG + Intronic
914726776 1:150334560-150334582 GGGAGGCTGAGGCGGGTGGATGG - Intronic
914930024 1:151922690-151922712 GGGATAATTTGGTGGGTAGAGGG + Intergenic
915247223 1:154565039-154565061 GGGAGGCTGGGGCAGGTGGATGG - Intergenic
915390715 1:155541003-155541025 GGGAGGCTGAGGCGGGAGGATGG + Intronic
915501114 1:156318456-156318478 GGGAGGCTAAGGCAGGTGGATGG - Intronic
915971214 1:160356556-160356578 GGGAAGATTTGGTGGGTGGATGG - Intronic
916689894 1:167180125-167180147 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
917749201 1:178038874-178038896 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
917889996 1:179426920-179426942 GGGAGGCTGAGGCTGGTGGATGG + Intronic
918311137 1:183286329-183286351 GGGAGGCTGAGGTGGGTGGATGG - Intronic
919075326 1:192806787-192806809 GGGAGGCTGAGGCAGGTGGAAGG - Intergenic
919349319 1:196429081-196429103 GGGAGGCTGAGGCAGGTGGATGG - Intronic
919409453 1:197226146-197226168 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
919577815 1:199333569-199333591 GGGAGGCTATGGCAGGAGGATGG + Intergenic
920025321 1:202989870-202989892 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
920163811 1:204020740-204020762 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
920698995 1:208203595-208203617 GAGTTGCCTTGGCGGATGGAAGG - Intronic
921357961 1:214304317-214304339 GGGAGGCTGAGGCAGGTGGATGG + Intronic
921860746 1:220039889-220039911 GGGATGCTGAGGCCGGAGGATGG + Intronic
922110618 1:222551401-222551423 GGGAAGCTGAGGTGGGTGGATGG + Intergenic
922508002 1:226137762-226137784 GGGAAGCTGAGGTGGGTGGACGG - Intergenic
922524777 1:226292397-226292419 GGGAGGCTAAGGCAGGTGGATGG - Intronic
922553536 1:226515632-226515654 GGGAGGCTGAGGTGGGTGGAGGG - Intergenic
922676860 1:227558740-227558762 GGGCTGCTTTCCCGGGGGGAAGG + Intergenic
922729839 1:227943875-227943897 GGGATGCTGAGGTGGGAGGACGG + Intronic
922732554 1:227958708-227958730 GGGCTGCTTTGGGGTTTGGAGGG - Intergenic
922809066 1:228406081-228406103 GGGAGGCCTGGGCGGGTGGGAGG - Intronic
922964345 1:229675575-229675597 TGGATGGTTGGGTGGGTGGATGG - Intergenic
923054332 1:230414317-230414339 GGGATGCTTTGGTGGGAAGGAGG - Intronic
923396600 1:233571830-233571852 GGGAGGCTGAGGCGGGAGGACGG + Intergenic
923403994 1:233642657-233642679 GTGATGCTGTGGGGGATGGACGG + Intronic
923418362 1:233787628-233787650 GGGATGCTGAGGCAGGAGGATGG + Intergenic
923432718 1:233938659-233938681 GGGATGGATTGGTGGGTGGATGG + Intronic
923492497 1:234496541-234496563 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
923629449 1:235640250-235640272 GGGATGCTTAGGCAGGTTGGGGG + Intronic
924281792 1:242445579-242445601 GGGAGGCCGAGGCGGGTGGATGG - Intronic
924515660 1:244763582-244763604 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
924530656 1:244891109-244891131 GTGAGGCTGTGGCAGGTGGAGGG - Intergenic
924594729 1:245435167-245435189 TGGATGGTTGGGTGGGTGGATGG - Intronic
924720855 1:246621753-246621775 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1062922721 10:1292202-1292224 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1062943872 10:1445181-1445203 TGGATGGGTTGGTGGGTGGATGG - Intronic
1063580997 10:7306947-7306969 GGGATGCTTTGGCATGAGGATGG - Intronic
1063926130 10:10979429-10979451 GGGAGGCCTAGGCCGGTGGATGG + Intergenic
1064562640 10:16608068-16608090 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1064740866 10:18432729-18432751 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1065095306 10:22274807-22274829 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1065153017 10:22841611-22841633 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1065190548 10:23204192-23204214 GGGCTGCTCTGGCGCATGGAGGG + Exonic
1065765334 10:29024641-29024663 GGGAGGCTGAGGCAGGTGGAAGG + Intergenic
1066189193 10:33040126-33040148 GGGAGGCCTAGGCGGGAGGATGG + Intergenic
1066380515 10:34897449-34897471 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1067050992 10:43020823-43020845 GGGAGGCTGAGGCTGGTGGATGG - Intergenic
1067484788 10:46638322-46638344 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1067809140 10:49413493-49413515 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1067960708 10:50845712-50845734 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1068041145 10:51825784-51825806 GAGATGGTTTGGGGTGTGGAGGG + Intronic
1068583107 10:58765293-58765315 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1068662194 10:59634039-59634061 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1068696424 10:59972572-59972594 GGGAGGCCAAGGCGGGTGGATGG - Intergenic
1069400715 10:68042516-68042538 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1069401286 10:68049669-68049691 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1069410607 10:68149536-68149558 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1069673391 10:70230146-70230168 GGGAGGCTGAGGCGGGTGGAGGG - Intronic
1070707402 10:78650437-78650459 AGGATGATTTGGTGGATGGAGGG + Intergenic
1071096675 10:81983376-81983398 GGGATGCTTTCTCTGATGGATGG + Intronic
1071625558 10:87164945-87164967 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1072255285 10:93615050-93615072 GGGAGGCCACGGCGGGTGGATGG + Intronic
1072267200 10:93742249-93742271 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1072445820 10:95497709-95497731 GGGATGATTTAAGGGGTGGAAGG - Intronic
1072567459 10:96629011-96629033 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1072587251 10:96793560-96793582 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1072677882 10:97482069-97482091 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1073002416 10:100295490-100295512 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1073079016 10:100845463-100845485 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1073336755 10:102715275-102715297 GGGAGGCCTAGGCGGGCGGATGG - Intronic
1073366178 10:102943321-102943343 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1074020800 10:109580591-109580613 GGGATGGATGGGTGGGTGGATGG + Intergenic
1074101062 10:110355190-110355212 GGGATGCTGAGGCTGGGGGAGGG + Intergenic
1074960725 10:118443002-118443024 GGGAGGCTGTGGCGGGTAGATGG + Intergenic
1075327304 10:121544206-121544228 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1075339877 10:121638397-121638419 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1075561456 10:123471563-123471585 TGGATGGGTTGGTGGGTGGATGG - Intergenic
1076160654 10:128242216-128242238 GGGATGTTGGGGCTGGTGGAGGG + Intergenic
1076710209 10:132329173-132329195 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1077070475 11:668581-668603 GGGAAGCTGAGGTGGGTGGATGG + Intronic
1077205703 11:1342903-1342925 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1077492016 11:2865582-2865604 GGGAGGCTGAGGTGGGTGGAGGG + Intergenic
1077537576 11:3131841-3131863 TGGATGGTTTGGTGGGTGGATGG - Intronic
1077676245 11:4195465-4195487 TGGATGGATGGGCGGGTGGATGG - Intergenic
1078261925 11:9717528-9717550 GGGAGGCTTAGGTGGGAGGATGG + Intronic
1078736549 11:14025661-14025683 GTGGTGGTTTGGCAGGTGGAGGG + Intronic
1078996448 11:16705520-16705542 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1079095849 11:17509649-17509671 GGGGTGGGTTGGAGGGTGGAGGG + Exonic
1079275869 11:19037224-19037246 GGGAGGCTTAGGTGGGAGGATGG + Intergenic
1080494772 11:32806378-32806400 GGGAGGCTGAGGCGGGTGGGGGG + Intergenic
1080827933 11:35863466-35863488 GGGGCGTTTTGGAGGGTGGAGGG - Intergenic
1081419098 11:42851163-42851185 GGGTGGTTTTGGAGGGTGGAAGG + Intergenic
1081573511 11:44305772-44305794 GCGCTGCTTTTGCGGGTGGGTGG + Intronic
1081928345 11:46849466-46849488 GGGAGGCTGAGGCGGGCGGATGG - Intergenic
1082635928 11:55593676-55593698 GGGATGCTGAGGCTGGAGGATGG + Intergenic
1083288156 11:61674263-61674285 TGGATGCATAGGCGAGTGGATGG + Intergenic
1083638632 11:64133613-64133635 GGGAGGCTGGGGCGGGTGGCAGG - Intronic
1083639232 11:64136463-64136485 GGGATGCGTTGGCAGCTGCAAGG + Intronic
1083715994 11:64577296-64577318 TGGATGGTTTGGTGGTTGGATGG + Intergenic
1083909603 11:65698487-65698509 GGGAGGCCGAGGCGGGTGGATGG + Intergenic
1083948823 11:65942416-65942438 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1083957799 11:65995554-65995576 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1084413337 11:69016452-69016474 TGGATGGTCTGGTGGGTGGATGG - Intergenic
1084413360 11:69016552-69016574 TGGATGGTTTGGTGGGTGGATGG - Intergenic
1084413388 11:69016656-69016678 TGGATGGTTTGGTGGATGGATGG - Intergenic
1084413393 11:69016676-69016698 TAGATGGTTTGGTGGGTGGATGG - Intergenic
1084413409 11:69016744-69016766 TGGATGGTTTGGTGGATGGATGG - Intergenic
1084413433 11:69016836-69016858 TGGATGGTTTGGTGGATGGATGG - Intergenic
1084537429 11:69765262-69765284 GGGAGGCTGAGGCGGGTGGGTGG + Intergenic
1084628623 11:70329984-70330006 GGGAGGCTAAGGCGGGAGGATGG - Intronic
1085109605 11:73876022-73876044 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1085316874 11:75550650-75550672 GGGGTGCCTTGGCTGGTGGAGGG + Intergenic
1085718652 11:78894751-78894773 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1087475434 11:98627720-98627742 GGGATGCCGAGGTGGGTGGATGG - Intergenic
1087639058 11:100735853-100735875 GGGAGGCTGAGGCGGGTGGATGG - Intronic
1088291744 11:108246061-108246083 GGGAGGCTGAGGCGGGTGGATGG - Intronic
1088314195 11:108490438-108490460 GGGAGGCTGAGGCGAGTGGATGG - Intronic
1088356773 11:108952317-108952339 GGGAGGCTGTGGTGGGAGGAAGG + Intergenic
1088481198 11:110297327-110297349 GACATGCTTTGGCAGTTGGAAGG + Intergenic
1088881790 11:113978608-113978630 GGGAAGCTTAGGCAGGTGGATGG - Intronic
1089504027 11:118951523-118951545 GGGAGGCTATGGCGGGAGGATGG - Intronic
1089549768 11:119264584-119264606 GGGATGCTGAGGTGGGAGGATGG - Intronic
1090017467 11:123098930-123098952 GGGAGGCTGAGGAGGGTGGATGG - Intronic
1090289613 11:125530935-125530957 GGTAGGCTGAGGCGGGTGGATGG - Intergenic
1092214326 12:6670187-6670209 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1092235743 12:6807839-6807861 GGGAGGCTGAGACGGGTGGATGG + Intronic
1092238248 12:6822739-6822761 AGGAGGCTTTGGAGGGAGGAGGG - Intronic
1092390310 12:8071400-8071422 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1092439360 12:8484291-8484313 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1092548414 12:9471507-9471529 GGGATGATATGGAGGGTGGCAGG - Intergenic
1094110313 12:26855100-26855122 GGGAAGCTGAGGTGGGTGGATGG - Intergenic
1094196767 12:27757904-27757926 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1094504589 12:31050942-31050964 GGGATGATATGGAGGGTGGCAGG + Intergenic
1094650311 12:32369650-32369672 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1094685953 12:32714893-32714915 GGGATGCTGAGGTGGGAGGATGG + Intronic
1095753876 12:45741300-45741322 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1096087976 12:48879035-48879057 GGGAGGCAGAGGCGGGTGGATGG + Intergenic
1096118191 12:49068673-49068695 GGGAAGCTGAGGCGGGCGGATGG - Intronic
1096342713 12:50815628-50815650 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1096350021 12:50890012-50890034 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1096438815 12:51620880-51620902 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1096711685 12:53461946-53461968 GGAAGGCTGAGGCGGGTGGATGG - Intronic
1098461361 12:70736430-70736452 GGCATGCTTTGGGGGTTGGGAGG - Intronic
1098553664 12:71793973-71793995 GGGAGGCTGAGGTGGGTGGATGG + Exonic
1099450550 12:82802103-82802125 GGGAGGCTCTGGCAGGGGGAAGG + Intronic
1099864396 12:88260794-88260816 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1100199928 12:92287498-92287520 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1100307874 12:93367637-93367659 GGGAGGCTTAGGTGGGAGGATGG + Intergenic
1100500812 12:95172269-95172291 GGGATGCTGAGGCAGGAGGATGG + Intronic
1100526741 12:95426608-95426630 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
1100558487 12:95722384-95722406 GGGAGGCCATGGAGGGTGGATGG + Intronic
1101420141 12:104544017-104544039 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1102130037 12:110520449-110520471 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1102260006 12:111437863-111437885 TGGAGGGTTTGCCGGGTGGATGG - Intronic
1102561923 12:113768459-113768481 GGGAGGCTGAGGCGGGCGGATGG + Intergenic
1102668338 12:114596054-114596076 GGGAGACTGAGGCGGGTGGATGG + Intergenic
1102740633 12:115204466-115204488 GGGATGTTTTGCTGGGAGGAGGG - Intergenic
1102849043 12:116221133-116221155 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1102927706 12:116839373-116839395 AGGATGGTTGGGTGGGTGGATGG + Intronic
1102927719 12:116839410-116839432 GGGATGGGTGGGTGGGTGGATGG + Intronic
1102929296 12:116850257-116850279 GGGAGGCTGAGGCGGGAGGATGG - Exonic
1102938118 12:116914337-116914359 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1103509325 12:121463816-121463838 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1103584857 12:121945020-121945042 GGGAGGCTGAGGCGGGTGGATGG - Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103633379 12:122281589-122281611 GGGAAGCTGAGGCGGGAGGATGG + Intronic
1103815985 12:123656844-123656866 GGGAGGCTCAGGCGGGTGGATGG + Intronic
1104003266 12:124873949-124873971 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1104374342 12:128250648-128250670 GGTGTGTGTTGGCGGGTGGACGG - Intergenic
1104432052 12:128724490-128724512 GGGATGGTGTGGAAGGTGGAAGG + Intergenic
1104830928 12:131750794-131750816 GGGAGGCTGTGGCAGGAGGATGG - Intronic
1104906715 12:132217474-132217496 GGGATGCATGGGTGGGTGAATGG - Intronic
1104925721 12:132313165-132313187 GGGATGGGTGGGTGGGTGGATGG - Intronic
1104926028 12:132314216-132314238 GGGATGGGTCGGTGGGTGGATGG - Intronic
1105375919 13:19844203-19844225 GGGAGGCTAAGGTGGGTGGATGG + Intronic
1105878145 13:24578314-24578336 GGGAAGCTGAGGCGGGTGGGTGG - Intergenic
1106134712 13:26965424-26965446 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1106158998 13:27183861-27183883 AGGACACTTGGGCGGGTGGAGGG - Intergenic
1106768186 13:32936936-32936958 GGGATGCTTTGGTTGGCGGATGG + Intergenic
1107057413 13:36121864-36121886 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1107129844 13:36883509-36883531 GGGAGGCTTTGGCAGGCAGATGG + Intronic
1107584239 13:41826767-41826789 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1107859898 13:44650742-44650764 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1108266260 13:48711897-48711919 GGGCAGCTTTGGAGGGTGGGGGG + Intergenic
1108365069 13:49702971-49702993 GGGAGGCTTAGGCGGGAGAATGG - Intronic
1109435936 13:62302697-62302719 GGGAGGCTGAGGAGGGTGGATGG + Intergenic
1110419750 13:75292913-75292935 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1110616733 13:77550144-77550166 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1111082155 13:83324632-83324654 GGGACTTTTTGGAGGGTGGATGG + Intergenic
1111111407 13:83715155-83715177 GGGAAGCTGAGGCGGGTGAATGG - Intergenic
1111242848 13:85498290-85498312 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
1111773023 13:92623059-92623081 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1111861097 13:93707225-93707247 GGGGCTCTTTGGAGGGTGGAGGG + Intronic
1112602684 13:100872342-100872364 GGGATGCTGTGGCGGGAGGATGG - Intergenic
1112781986 13:102910900-102910922 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1113417035 13:110136670-110136692 GGTATGCTTTGGGGTGTGAAAGG - Intergenic
1113604337 13:111594824-111594846 GGGGTGGTCTGGAGGGTGGATGG - Intronic
1113910109 13:113837685-113837707 GGGATGCTGGGGAGAGTGGACGG + Intronic
1114450541 14:22822402-22822424 GGGCTGCTTGGCCAGGTGGAGGG - Intronic
1114563177 14:23607967-23607989 GGGAGGCCGAGGCGGGTGGATGG + Intergenic
1115531681 14:34333720-34333742 GTGATGCTTTGGGGTGTGGGTGG - Intronic
1115817617 14:37179505-37179527 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
1116107810 14:40533072-40533094 GGGATCTTTTGGAGGGCGGAGGG + Intergenic
1116897921 14:50335189-50335211 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1117298927 14:54404817-54404839 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1117383368 14:55187554-55187576 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1117398025 14:55330684-55330706 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1117406386 14:55408211-55408233 GGGAGGCTGAGGCTGGTGGATGG + Intronic
1117595799 14:57326101-57326123 GGGATGCTAAGACGGGAGGATGG + Intergenic
1117698186 14:58387667-58387689 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1118271716 14:64349407-64349429 GGGAGGCTTAGGTGGGAGGATGG - Intergenic
1118640416 14:67787141-67787163 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1118650931 14:67893564-67893586 GGGAGGCTGGGGCGGGAGGATGG + Intronic
1119061710 14:71481372-71481394 GGGATGCTGAGGTGGGAGGATGG + Intronic
1119216164 14:72870833-72870855 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1119357951 14:74022441-74022463 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1119702787 14:76766679-76766701 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1120363725 14:83539884-83539906 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1120682377 14:87495724-87495746 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1121085930 14:91146110-91146132 GGGAGGCTGAGGAGGGTGGATGG - Intronic
1121195872 14:92071354-92071376 GGGAGGCCGAGGCGGGTGGATGG + Intronic
1121311204 14:92936136-92936158 GGGTTGCTTTGGCTGTTGAAGGG - Intergenic
1121363187 14:93281374-93281396 GGGAGGCTGAGGCGGGTGGATGG - Intronic
1121533175 14:94672778-94672800 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1121917109 14:97845055-97845077 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1122347498 14:101069641-101069663 GGGATGCTTTGGTGCGTGTCTGG + Intergenic
1122439547 14:101720659-101720681 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1122563371 14:102633046-102633068 GGGATGCTGAGGCAGGAGGATGG - Intronic
1122589515 14:102837241-102837263 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1122731504 14:103802506-103802528 GGGATGCCTTAGTGGGTAGAAGG - Intronic
1123434009 15:20241760-20241782 GGGATGCCTAGGCAGGAGGATGG + Intergenic
1124911404 15:33924559-33924581 GAGAGGCTGTGGCAGGTGGATGG - Intronic
1125655691 15:41355087-41355109 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1125908817 15:43417938-43417960 GGGAGGCTGGGGCGGGTGGATGG + Intronic
1126464452 15:48948799-48948821 GGGAGGCTTAGGTGGGAGGATGG + Intronic
1126476028 15:49065983-49066005 TGGAGGCTGAGGCGGGTGGATGG + Intergenic
1127110816 15:55667844-55667866 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1127268961 15:57383876-57383898 GGGAGGCCTAGGTGGGTGGATGG - Intronic
1127835416 15:62787133-62787155 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128138879 15:65284920-65284942 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1128328205 15:66738790-66738812 GGGATGCTTTGGCAGTTTGAGGG + Intronic
1128503855 15:68251433-68251455 GGGAGGCAGAGGCGGGTGGATGG + Intronic
1129358153 15:75006411-75006433 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1130508629 15:84570411-84570433 GGGAGGCTTGGGTGGGAGGAGGG - Intergenic
1131140399 15:89972407-89972429 GGGAGGCTGTGGCAGGAGGAGGG + Intergenic
1131341667 15:91608360-91608382 GGGGTGTTTTGGAGGGTGGAGGG + Intergenic
1131611351 15:93967676-93967698 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1131641145 15:94295187-94295209 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1131786408 15:95916878-95916900 GTGATGGTGAGGCGGGTGGAAGG - Intergenic
1131824461 15:96307154-96307176 GGGATGCTGAGGTGGGAGGATGG - Intergenic
1132255420 15:100372869-100372891 GGGAGGGGTTGGGGGGTGGAAGG + Intergenic
1132377002 15:101335062-101335084 GGGATGCTGAGGTGGGAGGATGG - Intronic
1132674465 16:1115952-1115974 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1133123443 16:3627376-3627398 GGGAGGCTTAGGTGGGAGGATGG - Intronic
1133193237 16:4150108-4150130 GGGAAGCTTAGGCAGGAGGATGG - Intergenic
1133236806 16:4391181-4391203 GGGAGGCTGTGGTGGGAGGACGG + Intronic
1133331045 16:4974304-4974326 GGGAGGCTGGGGCGGGAGGATGG - Intronic
1133462694 16:6000810-6000832 TGGATGAGTTGGTGGGTGGATGG + Intergenic
1133971978 16:10574787-10574809 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1133995550 16:10745223-10745245 GGGAGGCCGAGGCGGGTGGATGG + Intronic
1134634839 16:15784395-15784417 CGGATGCTTTGAAGGGTGCAGGG + Intronic
1134663855 16:16003989-16004011 TGGATGCATTGGTGGGTGGGTGG + Intronic
1134842577 16:17413675-17413697 GGGAGGCTAAGGCAGGTGGATGG - Intronic
1135256707 16:20947062-20947084 GGGAGGCTGAGGCTGGTGGATGG - Intronic
1135356052 16:21769929-21769951 GGGAGGCTTAGGTGGGTGGGAGG + Intergenic
1135454542 16:22586068-22586090 GGGAGGCTTAGGTGGGTGGGAGG + Intergenic
1135518380 16:23154191-23154213 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1135543776 16:23352262-23352284 TGGATGCATGGGTGGGTGGACGG + Intronic
1135657087 16:24259779-24259801 GGGAAGCTTTGGCAGGTGATGGG + Intronic
1135912061 16:26570526-26570548 GGGAAGCTCTGGTGGGTGGAGGG - Intergenic
1136619513 16:31418676-31418698 GGGATGCCTTTGTGGGTGAATGG + Intronic
1136850605 16:33609354-33609376 GGGATGCCTAGGCAGGAGGATGG - Intergenic
1136909230 16:34133027-34133049 GGGATGCTTTCCCCGGGGGAAGG + Intergenic
1137421419 16:48338045-48338067 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1137456095 16:48618965-48618987 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1137896214 16:52215820-52215842 GGGGTCTTTTGGAGGGTGGAGGG - Intergenic
1138168449 16:54825359-54825381 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1138496937 16:57414634-57414656 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1138547677 16:57729391-57729413 TGGATGAGTGGGCGGGTGGATGG + Intronic
1139101264 16:63770316-63770338 GGGTTGCTTGGGCAGCTGGAGGG - Intergenic
1139235276 16:65331687-65331709 GGGATCTATTGGAGGGTGGAGGG - Intergenic
1139449006 16:67015526-67015548 GGGAGGCTGTGGCGGGCAGATGG + Intergenic
1139509756 16:67420573-67420595 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1139896662 16:70293175-70293197 GGGATTCTGAGGTGGGTGGATGG + Intronic
1140566512 16:76049063-76049085 GGGAGGCTGTGGTGGGAGGAGGG + Intergenic
1140850090 16:78927033-78927055 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1140881132 16:79199165-79199187 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1141155582 16:81594357-81594379 GGGAGGCTGAGGCTGGTGGATGG - Intronic
1141481801 16:84311631-84311653 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1141605770 16:85152528-85152550 TGGATGCTTAGGCTGGTGTAAGG + Intergenic
1141619030 16:85226986-85227008 GGGATGCGTGGGTGGCTGGATGG - Intergenic
1141987042 16:87586816-87586838 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
1142124059 16:88401488-88401510 TGGATGCTGGGGTGGGTGGATGG + Intergenic
1142124136 16:88401814-88401836 TGGATGCTTGGGTGGATGGATGG + Intergenic
1142152481 16:88518789-88518811 TGGATGCATGGGTGGGTGGATGG + Intronic
1142152571 16:88519158-88519180 TGGATGCATGGGTGGGTGGATGG + Intronic
1142179746 16:88662644-88662666 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1142367488 16:89657728-89657750 GGGATGCTCTCGCGAGAGGATGG + Exonic
1142437630 16:90072124-90072146 GGGATGCTGAGGCGGGAGAATGG + Intronic
1203112219 16_KI270728v1_random:1457803-1457825 GGGATGCCTAGGCAGGAGGATGG - Intergenic
1142529335 17:568484-568506 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1142547397 17:714533-714555 GGGAGGCCGCGGCGGGTGGACGG - Intronic
1142627172 17:1199485-1199507 GGGATATTTTTGGGGGTGGAAGG + Intronic
1143478428 17:7215911-7215933 GGGAGGCTTGGGCGGGTGGCAGG - Intronic
1143569733 17:7748733-7748755 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1144720473 17:17466079-17466101 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1145048010 17:19634350-19634372 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1145091919 17:19993173-19993195 GGGAGGCCCAGGCGGGTGGATGG + Intergenic
1145751043 17:27355208-27355230 GGGAAGCTGAGGCGGGTGGATGG - Intergenic
1146115911 17:30138670-30138692 TGTATACTTTGGGGGGTGGAGGG + Intronic
1146921324 17:36714517-36714539 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1146965438 17:37024717-37024739 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1147230519 17:39014692-39014714 AGGATAATTTGGTGGGTGGAGGG - Intergenic
1147373536 17:40010720-40010742 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1147471588 17:40667188-40667210 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1147480813 17:40761393-40761415 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1147564792 17:41529426-41529448 CGCATGCTTTGGGGGATGGAAGG - Intergenic
1148050329 17:44766963-44766985 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1148470187 17:47888459-47888481 GGGAGGCTGAGGCGGGCGGATGG - Intergenic
1148585620 17:48777489-48777511 GGGAGGCCGAGGCGGGTGGATGG + Intronic
1150017018 17:61568329-61568351 GGGAGGCTGGGGCGGGAGGATGG - Intergenic
1150174396 17:63035183-63035205 GGGATCTTTTTGCTGGTGGAGGG - Intronic
1150270498 17:63861357-63861379 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
1150710146 17:67524201-67524223 GTGAGGCTGTGGCGGGAGGATGG + Intronic
1150722828 17:67628140-67628162 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1151066242 17:71153152-71153174 GGGATGCCTTGGCAGGAGAATGG + Intergenic
1151190234 17:72392954-72392976 GGGATGCCTGGGAGGGAGGAAGG - Intergenic
1151196632 17:72436297-72436319 GGGAGGCTTAGGTGGGAGGATGG - Intergenic
1151401174 17:73857051-73857073 AGGAAGCTTTGGTGGGAGGAGGG - Intergenic
1151596663 17:75082164-75082186 GGGATGCTTTGGGGGTGGAATGG - Intergenic
1151641702 17:75400100-75400122 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1151783352 17:76262374-76262396 GGGATGCTGAGGCAGGAGGATGG - Intergenic
1151883166 17:76906671-76906693 TGGATGCTGTGGGAGGTGGAAGG + Intronic
1152029199 17:77831176-77831198 GGGCTGCTTTGGCTGGGGGCAGG - Intergenic
1152271255 17:79326199-79326221 AGCCTGCTTTGGCAGGTGGAGGG - Intronic
1152767093 17:82147614-82147636 TGGATGATTGGGCGGGTGGGTGG + Intronic
1152767498 17:82149046-82149068 CGGATGGTTGGGTGGGTGGATGG + Intronic
1152806076 17:82356976-82356998 GGGAAGTGTTGGCGGGTGCAGGG - Intergenic
1152882472 17:82826878-82826900 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1153196537 18:2604441-2604463 GGGAGGCCAAGGCGGGTGGATGG + Intronic
1153448613 18:5200423-5200445 GGGAAGCTGAGGCAGGTGGATGG - Intergenic
1153673088 18:7430938-7430960 GGGATGCTGAGGTGGGAGGATGG + Intergenic
1153789879 18:8568751-8568773 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1154154595 18:11934079-11934101 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1154303392 18:13213908-13213930 GGGATGCTCTGTGGGGTGCAGGG + Intergenic
1154330136 18:13422591-13422613 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1154942659 18:21130405-21130427 GGGAGGCTTAGGCGGGAGGATGG - Intergenic
1155015632 18:21836007-21836029 GGGAGGCTAAGGCAGGTGGATGG + Intronic
1155147402 18:23095430-23095452 GGGAGGCTGAGGCGGGAGGAGGG + Intergenic
1155524445 18:26702213-26702235 AGTGTGCTTTGGGGGGTGGAGGG + Intergenic
1155540425 18:26863521-26863543 GGGATGCTTTTAGGGGAGGAAGG + Intronic
1156291392 18:35751373-35751395 GGGAAGCTGAGGTGGGTGGATGG + Intergenic
1156333424 18:36147660-36147682 GGGAGGCTGAGGCGGGGGGAGGG - Intronic
1156347524 18:36271064-36271086 GGGAGGCTGTGGCGGGAGGATGG - Exonic
1156403579 18:36761848-36761870 GGGATGCTTTGGAGTGTGAAAGG + Intronic
1156764861 18:40640380-40640402 TGGATGCTTTGGCTGTTAGAGGG + Intergenic
1156925375 18:42571229-42571251 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
1157353178 18:46909485-46909507 GGGAGGCCATGGTGGGTGGATGG - Intronic
1157735269 18:50042695-50042717 GGGATGCTTTGTGGGGAGGGAGG - Intronic
1158888342 18:61849804-61849826 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1159737079 18:72113372-72113394 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1160687155 19:442424-442446 TGGATGGATGGGCGGGTGGATGG + Intronic
1160687340 19:442984-443006 TGGATGCATGGGTGGGTGGATGG + Intronic
1160692530 19:466529-466551 TGGATGAGTTGGTGGGTGGATGG + Intronic
1160692590 19:466750-466772 TGGATGGTTGGGTGGGTGGATGG + Intronic
1160790834 19:922927-922949 GGGAGGCTTAGGCGGGAGGATGG - Intergenic
1160926832 19:1550471-1550493 GGGATGGATGGGTGGGTGGATGG - Intergenic
1161123270 19:2541808-2541830 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1161347710 19:3776445-3776467 GGGATGGGTGGGTGGGTGGATGG + Intergenic
1161405067 19:4086857-4086879 GGGAGGCCGAGGCGGGTGGACGG + Intergenic
1161422839 19:4185109-4185131 TGGATGCTTGGGCAGATGGATGG + Intronic
1161495357 19:4583434-4583456 GGGATGCTGGGGCGGCCGGAAGG - Intergenic
1161523234 19:4737692-4737714 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1161570751 19:5029720-5029742 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1161749256 19:6082535-6082557 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1161974203 19:7599791-7599813 TGGATGGATGGGCGGGTGGATGG - Intronic
1161974275 19:7599991-7600013 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974281 19:7600011-7600033 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974287 19:7600031-7600053 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974293 19:7600051-7600073 TGGATGGATGGGCGGGTGGATGG - Intronic
1161974410 19:7600375-7600397 TGGATGAGTGGGCGGGTGGACGG - Intronic
1161974420 19:7600415-7600437 TGGATGGATGGGCGGGTGGATGG - Intronic
1162126258 19:8501010-8501032 GGGAGGCTGAGGCGGGTGGAGGG - Intronic
1162388442 19:10374942-10374964 GGGAAGCCAAGGCGGGTGGATGG + Intronic
1162506248 19:11087247-11087269 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1162622155 19:11852184-11852206 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1162626979 19:11892516-11892538 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1162830739 19:13282677-13282699 GGGATGCCTGGGCGGGGGGTTGG + Intronic
1163377723 19:16944049-16944071 GGGATGGCTTGGCAGGTGCAGGG - Intronic
1163411141 19:17155418-17155440 GGGAGGCTTACGCAGGTGGATGG - Intronic
1163546477 19:17943861-17943883 GGGACCCTCTGGCGGGAGGACGG - Exonic
1163670956 19:18628275-18628297 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1163732022 19:18954803-18954825 TGGATGGATGGGCGGGTGGATGG - Intergenic
1163793775 19:19323721-19323743 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1164202996 19:23033916-23033938 GGGATCTTTTGGCTGGGGGAGGG + Intergenic
1164650895 19:29890610-29890632 TGGATGCATGGGTGGGTGGATGG - Intergenic
1164852453 19:31495758-31495780 GGGAAGCTGAGGTGGGTGGAGGG + Intergenic
1164920432 19:32085030-32085052 TGGATGCGTAGGTGGGTGGATGG + Intergenic
1165300737 19:34966973-34966995 GGGATAATTTGGTGGGTGGGGGG - Intergenic
1165358213 19:35317134-35317156 GGGAGGCTGAGGCTGGTGGATGG + Intergenic
1165546025 19:36536818-36536840 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1165557040 19:36643006-36643028 GGGAAGCCAAGGCGGGTGGATGG - Intronic
1165651129 19:37491108-37491130 GGGAGGCCATGGCAGGTGGATGG + Intergenic
1165671450 19:37682816-37682838 AGGAGGCTGTGGCGGGAGGATGG + Intronic
1165733565 19:38161935-38161957 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1165816611 19:38646493-38646515 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1166032312 19:40141413-40141435 GGGATGCTGAGGTGGGAGGATGG + Intergenic
1166035425 19:40164790-40164812 GGGAGGCTTTGGTGGGGAGAGGG - Intergenic
1166213124 19:41320001-41320023 GGGATGCTGCAGCGGTTGGAAGG - Intronic
1166340945 19:42136424-42136446 GGGAGGCTGAGGCGGGTGGATGG - Intronic
1166668627 19:44696864-44696886 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1167018641 19:46858475-46858497 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1167144283 19:47672615-47672637 GGGATGTTTTGGAGGGTTGGAGG + Intronic
1167165115 19:47793902-47793924 GAGAGGCTTTGGCAGGAGGATGG - Intergenic
1167338867 19:48903395-48903417 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338887 19:48903459-48903481 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338893 19:48903475-48903497 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338922 19:48903571-48903593 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338942 19:48903635-48903657 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338972 19:48903731-48903753 TGGATGGATGGGCGGGTGGATGG + Intronic
1168023895 19:53629752-53629774 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1168025094 19:53638082-53638104 GGGAGGCTGAGGCGGGCGGATGG + Intergenic
1168123529 19:54269570-54269592 GGGAGGCTGAGGCGAGTGGAAGG + Intronic
1168432246 19:56290617-56290639 GGGAGGCTGTGGTGGGAGGAAGG + Intronic
1168623609 19:57898701-57898723 GGGAGGCCGAGGCGGGTGGATGG + Intronic
1168641420 19:58034186-58034208 TGGACGCTCTGGCGGGCGGAGGG - Intronic
925306230 2:2849571-2849593 GGGATGCTTTTGGGAGTGGACGG + Intergenic
925347814 2:3183067-3183089 TGGATGCATAGGTGGGTGGATGG - Intergenic
925976228 2:9143828-9143850 GGGAGTCTGAGGCGGGTGGATGG + Intergenic
926086071 2:10021151-10021173 GGGAAGCTGAGGCGGGTGGATGG - Intergenic
926101250 2:10119825-10119847 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
926110878 2:10183064-10183086 GGGAGGCTAAGGCGGGAGGATGG + Intronic
926671614 2:15582004-15582026 GGGAGGCTGAGGCGGGAGGACGG + Intergenic
927094789 2:19739326-19739348 GGGCTGTTTTGGAGGCTGGATGG + Intergenic
927631872 2:24781394-24781416 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
927782433 2:25950459-25950481 GGGAGGCTGAGGCAGGTGGATGG - Intronic
927791968 2:26017352-26017374 GGGATGCTGAGGCCGGAGGATGG - Intergenic
927799027 2:26079897-26079919 GGGAGGCTGAGGCAGGTGGATGG - Intronic
927819932 2:26255258-26255280 GGGAGGCTGAGGCAGGTGGATGG + Intronic
927914774 2:26928453-26928475 GGGAGGCTGAGGTGGGTGGATGG + Intronic
928108395 2:28487900-28487922 GGGAGGCTGAGGTGGGTGGATGG + Intronic
928218849 2:29385628-29385650 GGGAGGCTGAGGCAGGTGGATGG - Intronic
928421827 2:31143015-31143037 GGGAGGCTGTGGCAGGAGGATGG + Intronic
928561255 2:32488236-32488258 GGGAGGCTGAGGCGGGAGGATGG + Intronic
929371868 2:41234956-41234978 GGGAAGCTAAGGTGGGTGGATGG + Intergenic
929547481 2:42865062-42865084 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
929683628 2:44015725-44015747 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
930077883 2:47422186-47422208 GGGAGGCTGAGGCGGGTGGATGG - Intronic
931282057 2:60803301-60803323 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
931286886 2:60839828-60839850 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
931400084 2:61924014-61924036 GGAAGGCCATGGCGGGTGGATGG - Intronic
932160986 2:69459366-69459388 GGGAGGCTTAGGTGGGAGGATGG - Intronic
932726134 2:74181247-74181269 GGGAAGCTGAGGCGGGAGGATGG + Intergenic
932824123 2:74924785-74924807 GGGATGCTTTTGCTGGGTGATGG + Intergenic
933290813 2:80436432-80436454 GAGATGCTCTGGGGGGTGGTGGG + Intronic
933361137 2:81286440-81286462 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
933810958 2:86032445-86032467 TGGATGGGTTGGTGGGTGGATGG - Intronic
933840540 2:86282731-86282753 GGGATGTATTGGTGGGAGGAGGG - Intronic
933985292 2:87585986-87586008 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
934098483 2:88628759-88628781 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
935696211 2:105773136-105773158 GGGAGGCTGAGGCAGGTGGATGG - Intronic
936308552 2:111364821-111364843 GGGAGGCCGAGGCGGGTGGATGG + Intergenic
937131473 2:119517397-119517419 GGGAGGCTGAGGCAGGTGGATGG - Intronic
938539982 2:132277927-132277949 GGGAGGCCGAGGCGGGTGGAAGG + Intergenic
938585132 2:132683121-132683143 GGGAGGCTGAGGCAGGTGGATGG - Intronic
938592102 2:132749441-132749463 GGGAGGCCAAGGCGGGTGGATGG - Intronic
938806578 2:134811728-134811750 GGGATGCTGAGGTGGGAGGATGG + Intergenic
939848913 2:147280566-147280588 TGGATGGATGGGCGGGTGGATGG + Intergenic
940908053 2:159186342-159186364 GGGAGGCTGAGGCGGGAGGATGG - Intronic
941510378 2:166400812-166400834 GGGGTCTTTTGGAGGGTGGAAGG + Intergenic
941538495 2:166752733-166752755 GGGATGCCAAGGCAGGTGGATGG + Intergenic
941844715 2:170121404-170121426 TGGATGGGTGGGCGGGTGGATGG - Intergenic
943094987 2:183417584-183417606 GGGTTTCTTTGGCGGGGGGGGGG - Intergenic
944591269 2:201219917-201219939 GGAATGCCTTGGGGCGTGGAAGG + Exonic
944829586 2:203520086-203520108 GGGAGGCTAAGGTGGGTGGATGG + Intronic
944906193 2:204264463-204264485 AGAATTCTTTGGCGGGTGGAAGG - Intergenic
945226449 2:207536050-207536072 GGGAGGCTGAGGCAGGTGGATGG - Intronic
945516505 2:210768819-210768841 GGGATGCTTGGGGCGGTGAATGG + Intergenic
946090197 2:217215729-217215751 GGGAGGCTTAGGCGGGAGGATGG - Intergenic
946158249 2:217820885-217820907 GGGATGCCTGGGTGGATGGATGG - Intronic
946264465 2:218526891-218526913 GGGAGGCTGAGGCGGGTGAATGG - Intronic
946430900 2:219627123-219627145 GGGAAGCTGAGGCGGGAGGAGGG + Intergenic
946810578 2:223520313-223520335 GGGAGGCTATGGCGGGTGTACGG - Intergenic
947254100 2:228142687-228142709 GGGGCGTTTTGGAGGGTGGAGGG + Intronic
948152937 2:235758895-235758917 GGGAGGCTGGGGCGGGAGGACGG - Intronic
948161252 2:235826675-235826697 GGGAGGCTGAGGCGGGTGGTAGG - Intronic
948375326 2:237517138-237517160 TGAATGCATTGGTGGGTGGATGG + Intronic
948459759 2:238123511-238123533 GGGATGCTCTGGGAGATGGAAGG - Intronic
948580291 2:238982728-238982750 GGGATCCATTGGAGGGTGGAGGG - Intergenic
948747117 2:240105067-240105089 GGGAGGCTGAGGCGGGTGCATGG + Intergenic
948875095 2:240821952-240821974 GGGATGCCGAGGTGGGTGGATGG - Intergenic
948878327 2:240841902-240841924 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1168830734 20:844079-844101 GGCATGTCTAGGCGGGTGGATGG + Intronic
1168855613 20:1005558-1005580 GGCATGCTCTGGCGGGGGGCGGG + Intergenic
1168952969 20:1815044-1815066 TGGATGGGTTGGTGGGTGGATGG + Intergenic
1168982029 20:2013023-2013045 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1169019447 20:2318256-2318278 GGGAAGCTGAGGCAGGTGGATGG - Intronic
1169419839 20:5451033-5451055 GGGATGCTGAGGCGGGAGAATGG + Intergenic
1169707431 20:8521462-8521484 GAGATGCTCAGGTGGGTGGATGG + Intronic
1169887585 20:10417504-10417526 GGGATGCTGAGGCTGGAGGATGG + Intronic
1170230178 20:14037777-14037799 AGGAGGCTGAGGCGGGTGGATGG + Intronic
1170627266 20:18039380-18039402 GGGAGGCCAAGGCGGGTGGATGG + Intronic
1171398575 20:24857081-24857103 AGGATGGTTTGGTGGGCGGAGGG - Intergenic
1172123865 20:32613790-32613812 GGGATGGATAGGTGGGTGGACGG + Intergenic
1172293746 20:33793445-33793467 GGGGTGCTTTGATGGGTGGATGG + Intergenic
1172521816 20:35571998-35572020 GGCATTTTTTGGGGGGTGGATGG - Intergenic
1172529261 20:35618859-35618881 GGGCTGCTTTTACAGGTGGACGG - Intronic
1172779923 20:37430451-37430473 TGGATGGATGGGCGGGTGGATGG - Intergenic
1172850544 20:37959845-37959867 GTGATATTTTGGGGGGTGGAGGG + Intergenic
1172899174 20:38321272-38321294 TGGATGTATTGGTGGGTGGATGG + Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1172986918 20:38999036-38999058 GGGAGGCCAAGGCGGGTGGATGG - Intronic
1173186785 20:40846378-40846400 GGGAGCCTTTGGAGGGTGAAAGG + Intergenic
1173798474 20:45879282-45879304 GGGATGTCGAGGCGGGTGGATGG + Intergenic
1174208223 20:48856683-48856705 GAGACTCTTTGCCGGGTGGATGG + Intergenic
1174474596 20:50787499-50787521 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1174625293 20:51909260-51909282 GGGATGCTGAGTCGGGTGGATGG - Intergenic
1175097967 20:56557057-56557079 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1175145919 20:56896125-56896147 GGGATGCTGCGGCGGGAGGATGG - Intergenic
1175486675 20:59351907-59351929 TGGATGGTTTGACGGCTGGATGG - Intergenic
1176187340 20:63788215-63788237 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1176189116 20:63799277-63799299 GGGAGGCTGAGGCTGGTGGATGG - Intronic
1176228718 20:64019344-64019366 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1176268838 20:64224882-64224904 TGGATGCTTGGGCGGATGAAAGG + Intronic
1176426140 21:6549671-6549693 GGGAGGCTGAGGAGGGTGGATGG - Intergenic
1177129138 21:17235030-17235052 GGGATGCTGAGGCAGGAGGATGG + Intergenic
1177285044 21:19039007-19039029 GGGGTCTTTTGGAGGGTGGAGGG - Intergenic
1177670517 21:24219136-24219158 GGGATGCTGAGGCAGGAGGATGG + Intergenic
1177762544 21:25418428-25418450 GTAATGCTTTGGTGGGTGAAAGG - Intergenic
1177984312 21:27954424-27954446 GGGATGCTGAGGCAGGAGGATGG + Intergenic
1178366168 21:31990773-31990795 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1178510543 21:33201742-33201764 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1178532253 21:33385548-33385570 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1178595608 21:33949971-33949993 GGGAGGCTGAGGCGAGTGGATGG - Intergenic
1179017267 21:37604892-37604914 TGGATGGTTGGGCGGGTGGGTGG - Intergenic
1179519415 21:41932280-41932302 GGGATGCTTAGGCGGGCGGAGGG - Intronic
1179701631 21:43157988-43158010 GGGAGGCTGAGGAGGGTGGATGG - Intergenic
1179723239 21:43327342-43327364 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
1179813870 21:43890650-43890672 GGGAGGCCGAGGCGGGTGGATGG - Intronic
1179876888 21:44273152-44273174 GGGAAGATGTGGAGGGTGGAAGG + Intergenic
1179892185 21:44341420-44341442 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1180182434 21:46123982-46124004 GGGATGGGTAGGTGGGTGGATGG + Intronic
1180351763 22:11811661-11811683 GGGAGGCTGTGGCGGGAGAATGG - Intergenic
1180641119 22:17300198-17300220 GGGAGGCCTTGGCGGGAGGATGG + Intergenic
1180743972 22:18074296-18074318 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1180854962 22:19039950-19039972 GGGAGGCTGAGGCGGGAGGAGGG - Intronic
1180881297 22:19205268-19205290 GGGAGGCTGAGGCGGGTGGATGG + Intronic
1180893325 22:19307792-19307814 GGGAGGCTGTGGCAGGTAGATGG - Intergenic
1181133381 22:20747837-20747859 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1181320930 22:22005446-22005468 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
1181734851 22:24873609-24873631 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1181758530 22:25041847-25041869 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1181941370 22:26480274-26480296 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1181943260 22:26495380-26495402 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1181966503 22:26659596-26659618 GGGAGGCTGGGGCGGGAGGATGG + Intergenic
1182037296 22:27209138-27209160 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1182220756 22:28756731-28756753 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1182247808 22:28974060-28974082 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1183237160 22:36627725-36627747 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1183443955 22:37840452-37840474 GGGAGGCTGAGGCGGGTGAATGG + Intronic
1183724974 22:39583436-39583458 TGGATGGGTGGGCGGGTGGATGG - Intronic
1183796706 22:40124554-40124576 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1183817832 22:40318440-40318462 GGGAGGCTGTGGCGGGAGAATGG + Intronic
1184153435 22:42651425-42651447 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1184417085 22:44358630-44358652 GGGATGGTTAAGCTGGTGGAGGG + Intergenic
1184463543 22:44655173-44655195 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1184644280 22:45887929-45887951 GGCAGGCTTTGGAGGGTGGCAGG + Intergenic
1184697042 22:46145598-46145620 GGGCAGCTTTGGCAGGGGGACGG + Intergenic
1184738141 22:46411092-46411114 GGGAGGCTGTGGCAGGAGGATGG + Intronic
1184787873 22:46680610-46680632 GGGATGAATGGGTGGGTGGATGG - Intergenic
1185374564 22:50476099-50476121 GGGACGCCATGGTGGGTGGATGG - Intergenic
949342169 3:3041853-3041875 GGGAGGCTGAGGCGGGAGGATGG + Intronic
949348641 3:3100905-3100927 GGGAGGCCGAGGCGGGTGGATGG + Intronic
950079391 3:10210274-10210296 GGGAGGCTGAGGCGGGAGGATGG + Intronic
951771015 3:26257833-26257855 GGGAGGCCTTGGTGGGAGGATGG + Intergenic
952351376 3:32542338-32542360 GGGATGCTGAGGTGGGAGGATGG - Intronic
952415332 3:33085035-33085057 GGGAGGCTGAGGCGGGTGGATGG + Intronic
952474432 3:33692062-33692084 GGGAGGCTGTGGTGGGAGGATGG + Intronic
953065843 3:39470122-39470144 GGCATCCTTTCGCGGGTTGACGG + Intronic
953334358 3:42081114-42081136 GGGAGGCCCAGGCGGGTGGATGG - Intronic
953558142 3:43963142-43963164 GGGATGCTGAGGTGGGAGGATGG + Intergenic
953889235 3:46738298-46738320 GGGAGGCTGGGGTGGGTGGATGG + Intronic
954032776 3:47831748-47831770 GGGAGGCTGAGGCGGGAGGATGG - Intronic
954561998 3:51564675-51564697 GGGAGGCTGAGGTGGGTGGATGG + Intronic
954701593 3:52453512-52453534 AAGATGCTTTGGAGGGTGGAGGG - Intronic
954878166 3:53816948-53816970 GGGAGGCTGAGGCGGGAGGATGG - Exonic
954916309 3:54151088-54151110 GGGATGCATTAATGGGTGGATGG + Intronic
955272047 3:57510397-57510419 GGGAGGCTGAGGTGGGTGGATGG + Intronic
955368096 3:58328478-58328500 GGGAAGCTGAGGCAGGTGGACGG - Intergenic
955400281 3:58586582-58586604 GGGAGGCTGAGGCGGGAGGATGG + Intronic
955491803 3:59490321-59490343 GGGGTCTTTTGGAGGGTGGAGGG - Intergenic
955635996 3:61030207-61030229 GGGAGGCTGAGGTGGGTGGATGG - Intronic
955769487 3:62373609-62373631 GTGATGGTTTTGCCGGTGGAAGG + Intronic
955937807 3:64119209-64119231 GGGATCTATTGGAGGGTGGAGGG + Intronic
956395571 3:68822709-68822731 GGGAGGCTGAGGCGGGTGGATGG - Intronic
956451033 3:69375052-69375074 TGGATGCTTGGATGGGTGGATGG - Intronic
956596597 3:70973843-70973865 GGGATGTGTTGGGGGGTGGGGGG - Intronic
957832752 3:85544470-85544492 GGGAGGCTGAGGCGGGTGAATGG + Intronic
957928898 3:86851655-86851677 GTGATCCTTTTGCTGGTGGAGGG - Intergenic
959930884 3:111980897-111980919 CGGATGGGTGGGCGGGTGGATGG + Intronic
960334677 3:116401519-116401541 GGGAGGCTAAGGCAGGTGGATGG - Intronic
960391108 3:117078602-117078624 GGGAGGCTGTGGTGGGAGGATGG - Intronic
960806385 3:121587425-121587447 GGGAGGCTGTGGCAGGTGGATGG - Intergenic
961420681 3:126800748-126800770 AGAATGCTTGGGCAGGTGGAAGG - Intronic
962720743 3:138172488-138172510 GGGAGGCTGTGGTGGGAGGATGG + Intronic
962752839 3:138446648-138446670 GGGAGGCTGAGGCAGGTGGATGG + Intronic
963790848 3:149580849-149580871 GGGAGCCTGAGGCGGGTGGATGG - Intronic
963876293 3:150479169-150479191 GGGAGGCTAAGGCAGGTGGATGG + Intergenic
964413742 3:156426242-156426264 TGGAAGCTGTGGCAGGTGGAAGG - Intronic
964504285 3:157381463-157381485 GGGAGGCTGAGGTGGGTGGATGG + Intronic
965059257 3:163762483-163762505 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
965354253 3:167654654-167654676 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
965527674 3:169738876-169738898 TGGAGGCTGAGGCGGGTGGATGG - Intergenic
965578049 3:170238121-170238143 GGGAGGCCGAGGCGGGTGGATGG + Intronic
966612079 3:181877690-181877712 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
966704803 3:182900804-182900826 GGGAGGCCGAGGCGGGTGGATGG + Intronic
967021505 3:185527132-185527154 GGGAGGCTGAGGCGGGAGGATGG + Intronic
967514309 3:190348818-190348840 GGGGTCTTTTGGAGGGTGGAGGG - Intronic
967563703 3:190948241-190948263 GGGACGTTTTGGAGGGTGGAGGG - Intergenic
967682287 3:192378348-192378370 GGGAGGCTGAGGTGGGTGGATGG - Intronic
968080622 3:195843877-195843899 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
968596879 4:1490277-1490299 GGGGTGCTTTGGCGGCTGAGCGG + Intergenic
969309979 4:6347470-6347492 GGGAAGCTTTGGGGGCTGCAGGG + Intronic
969487548 4:7480749-7480771 GGGAGCCTGGGGCGGGTGGAGGG - Intronic
969524057 4:7695341-7695363 TGGATGGATTGGTGGGTGGATGG + Intronic
969524178 4:7695725-7695747 TGGATGGATTGGTGGGTGGATGG + Intronic
969565369 4:7974315-7974337 TGGATGGATTGGTGGGTGGATGG - Intronic
969565481 4:7974725-7974747 TGGATGCATGGGTGGGTGGATGG - Intronic
970184790 4:13439584-13439606 GGGAGGCTGAGGCAGGTGGATGG - Intronic
970941333 4:21637541-21637563 GGGAGACTGAGGCGGGTGGATGG + Intronic
971194659 4:24461026-24461048 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
971390400 4:26180161-26180183 GGGATCTTTTTGAGGGTGGAGGG + Intronic
971437104 4:26639297-26639319 GGGAGGCTCTGGTGGGAGGATGG - Intronic
971484398 4:27144620-27144642 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
972454716 4:39242359-39242381 GGGAGGCTAAGGCGGGAGGATGG - Intronic
974038917 4:56841231-56841253 GGGAGGCTTAGGCAGGAGGATGG - Intergenic
974486539 4:62512949-62512971 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
974746604 4:66086490-66086512 GGGAAGCTGTGGCAGGAGGATGG - Intergenic
974852432 4:67420115-67420137 GGGAGGCTGTGGCAGGTGAATGG + Intergenic
974986790 4:69037325-69037347 GGGGTGTATTGGAGGGTGGAGGG - Intronic
974999652 4:69206462-69206484 GAGATGTATTGGAGGGTGGAGGG + Intronic
975015785 4:69417097-69417119 GAGATGTATTGGAGGGTGGAGGG - Intronic
975596652 4:76052966-76052988 GGGAGGCTGAGGCAGGTGGATGG - Intronic
976113887 4:81706032-81706054 GGGAGGCCGAGGCGGGTGGATGG + Intronic
976296009 4:83473037-83473059 GGGAGGCTGAGGGGGGTGGATGG + Intronic
977776919 4:100931632-100931654 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
978740695 4:112134809-112134831 TGGAGGCTGTGGCGGGAGGATGG + Intergenic
978789535 4:112646207-112646229 GGGAGGCCAAGGCGGGTGGATGG - Intronic
978911139 4:114065468-114065490 GGGGTCTTTTGGAGGGTGGAGGG - Intergenic
980198397 4:129621649-129621671 GGGAGGCTGAGGAGGGTGGATGG - Intergenic
980466728 4:133196281-133196303 AGGATGATTTGGTGGGTGGGGGG + Intronic
980968546 4:139547152-139547174 GGGACCCTTTGGCAGCTGGAGGG - Intronic
980970886 4:139566103-139566125 GGGAGGCTGAGGTGGGTGGATGG - Intronic
981154171 4:141414361-141414383 GGGATGAGTGGGCTGGTGGAGGG + Intergenic
981322910 4:143413786-143413808 GGGATGCTCTGGGAAGTGGAAGG - Intronic
982191290 4:152858185-152858207 GGGAGGCTGAGGTGGGTGGATGG + Intronic
982215643 4:153080655-153080677 GGGATGTTTTGGAGGGTCTATGG - Intergenic
982345592 4:154354163-154354185 GGGAGGCTGAGGCAGGTGGATGG - Intronic
982441037 4:155436274-155436296 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
983397645 4:167221118-167221140 GGGAGGCTGAGGCGGGAGGATGG + Intronic
983611202 4:169647144-169647166 GGGAGGCTGAGGTGGGTGGATGG + Intronic
983868524 4:172797482-172797504 GGGAGGCTGAGGCGGGCGGATGG - Intronic
983937819 4:173515252-173515274 GGCATTCTTTGGCGGGGGGCAGG - Intergenic
984261340 4:177446037-177446059 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
984491189 4:180437089-180437111 TGGATCCTGGGGCGGGTGGAAGG + Intergenic
984792027 4:183623963-183623985 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
984903883 4:184609350-184609372 GGGATAATTTGGTGGGTGGGGGG - Intergenic
984980530 4:185276593-185276615 GGGAGGCTGGGGCGGGAGGATGG + Intronic
985427505 4:189845015-189845037 GGGATGTTTTGGGGGTTGGGGGG - Intergenic
985560558 5:584031-584053 TGGATGGGTGGGCGGGTGGATGG + Intergenic
986078188 5:4359829-4359851 GGGAGGCTTAGGAGAGTGGATGG + Intergenic
986309245 5:6539411-6539433 TGGATGCTTGGGTGGGTGGGTGG + Intergenic
986532796 5:8757014-8757036 GGGGTATTTTGGAGGGTGGAAGG - Intergenic
986771424 5:10977555-10977577 GGGATGCTGAGGCAGGAGGAAGG - Intronic
988506129 5:31825045-31825067 GGGATGCGTGGGCGTGTGTAGGG - Intronic
988791071 5:34608267-34608289 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
989145790 5:38248848-38248870 GGGATAATTTGGTGGGTGGAGGG + Intergenic
990210605 5:53479210-53479232 GGGAGGGTCTGGCGGGGGGAGGG + Intergenic
991051313 5:62275315-62275337 GGGAGGCCGTGGCAGGTGGATGG - Intergenic
991063314 5:62400988-62401010 GGGAGGCTAAGGCGGGTGGATGG - Intronic
991595853 5:68304565-68304587 GAGATGCTTTGGGGGAGGGAGGG + Intergenic
992636368 5:78729133-78729155 GGGAGGCTGAGGCGGGTGGATGG + Intronic
992718183 5:79531979-79532001 GGGATGCTGAGGTGGGAGGATGG - Intergenic
992765453 5:79994699-79994721 GGGAGGCTGAGGCGGGAGGATGG + Intronic
992881330 5:81113364-81113386 GTGCTTCTTTGGCAGGTGGAGGG + Intronic
994205756 5:97033728-97033750 GGGATTCTTTGGTGGGTGTTGGG + Exonic
995028298 5:107449540-107449562 GTGCTGCTTTGGCTGTTGGAAGG - Intronic
995209441 5:109520593-109520615 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
995880469 5:116839446-116839468 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
996698926 5:126429372-126429394 GGGATCTATTGGAGGGTGGAGGG + Intronic
996715834 5:126587396-126587418 GGGAGGCCAAGGCGGGTGGATGG + Intronic
997483462 5:134207551-134207573 GGGACGCTAAGGCGGGTGGATGG + Intronic
997538384 5:134640616-134640638 GGGAGGCCAAGGCGGGTGGATGG + Intronic
997546094 5:134709105-134709127 GGGATGCTGAGGTGGGAGGATGG + Intronic
997933197 5:138088856-138088878 GGGGTGGTTTGGCGGGTGACTGG + Intronic
998429909 5:142061873-142061895 GGGAGGCTATGGTGGGAGGATGG + Intergenic
998445752 5:142197172-142197194 GGGATGGTGTGGCGGGGGGAGGG - Intergenic
998839164 5:146234927-146234949 GGGATGCTGAGGTGGGAGGATGG + Intronic
999451322 5:151680473-151680495 GGGAGGCTGAGGCGGGCGGATGG - Intronic
999859734 5:155632933-155632955 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1001281317 5:170388346-170388368 GAGAACCTTTGGCGGGAGGAAGG + Intronic
1001499739 5:172221262-172221284 GGGAGGCTATGGTGGGAGGATGG + Intronic
1001569193 5:172719030-172719052 TGGATGCATGGGTGGGTGGATGG + Intergenic
1001882350 5:175255345-175255367 GGGATGCTTTTGTGGATGCATGG - Intergenic
1002095694 5:176829475-176829497 TGGATGGTTGGGTGGGTGGATGG + Intronic
1002275331 5:178100756-178100778 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1002550115 5:179982057-179982079 GGGATGGGGTGGCGGGAGGAGGG - Intronic
1002599254 5:180344955-180344977 GGTATGCCTTGGCTGGTGAATGG - Intronic
1003056317 6:2824166-2824188 GGGATGCTGAGGCGGGAGAATGG - Intergenic
1003879558 6:10467627-10467649 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1004204830 6:13582964-13582986 GGGAGGCCTAGGTGGGTGGATGG + Intronic
1004395256 6:15242266-15242288 GGGAGGCTTAGGTGGGAGGATGG - Intergenic
1004697819 6:18050379-18050401 GGGAAGCTATGGTGGGAGGATGG + Intergenic
1005008572 6:21314095-21314117 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1005210555 6:23455457-23455479 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1005523552 6:26623195-26623217 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1006187191 6:32188226-32188248 AGGAGGCTTGGGTGGGTGGAGGG - Intronic
1006501156 6:34459695-34459717 GGGAGGCTGAGGCGGGTGGATGG + Intergenic
1006777205 6:36604363-36604385 GGGAGGCTAGGGCGGGTGGGAGG + Exonic
1006865553 6:37206637-37206659 GGGAAGCTGAGGCGGGAGGATGG - Intergenic
1006884955 6:37373645-37373667 GGGAGGCTGAGCCGGGTGGATGG - Intronic
1007566415 6:42854421-42854443 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1007605366 6:43114041-43114063 GGGCTGCTGGGGCGGGTGGTGGG + Intronic
1007889608 6:45274639-45274661 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1008835419 6:55821421-55821443 GGGAGGCTATGGCAGGAGGATGG - Intronic
1009042307 6:58193721-58193743 GGGACCTTTTGGAGGGTGGAGGG - Intergenic
1009218146 6:60947941-60947963 GGGACCTTTTGGAGGGTGGAGGG - Intergenic
1009739612 6:67726975-67726997 GGGGTCTTTTGGAGGGTGGAGGG + Intergenic
1010243908 6:73644709-73644731 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1011019928 6:82801602-82801624 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1012100059 6:95072551-95072573 GGGATGCTGAGGCGGGAGAATGG - Intergenic
1012366063 6:98442416-98442438 GGGATGCTGTGATGGGAGGATGG - Intergenic
1013206170 6:107947857-107947879 AGAATGGTTTGGTGGGTGGAGGG - Intronic
1013554208 6:111240098-111240120 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1013650618 6:112191219-112191241 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1014134990 6:117878583-117878605 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1015304881 6:131696615-131696637 GGGCTGCATTGGCAGGAGGAAGG + Intronic
1015313873 6:131794956-131794978 GGGAGGCTGAGGCGGATGGATGG - Intergenic
1015473678 6:133635280-133635302 GGCATGCTGTGGCAGCTGGAAGG + Intergenic
1015507227 6:134001157-134001179 GGGAAGCATTGGGGGGTGGTGGG + Intronic
1015637220 6:135289254-135289276 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1015796316 6:137015759-137015781 GGGATGCTGAGGTGGGAGGATGG - Intronic
1016050413 6:139524604-139524626 GGGATGCCGAGGCAGGTGGATGG - Intergenic
1016271050 6:142290781-142290803 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1016803430 6:148189451-148189473 GGGAGGCCAAGGCGGGTGGATGG - Intergenic
1017437899 6:154435232-154435254 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1017575561 6:155798556-155798578 GGGATGCTGCTGCAGGTGGATGG + Intergenic
1017835657 6:158175522-158175544 AGGAGGCTGAGGCGGGTGGATGG + Intronic
1018367058 6:163131201-163131223 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1018688264 6:166320754-166320776 GGGAGGCTGAGACGGGTGGATGG - Intronic
1019182470 6:170199296-170199318 GGGATGCTGAGGCAGGAGGATGG + Intergenic
1019265525 7:115369-115391 GGGAAGCTGTGGCCAGTGGAGGG - Intergenic
1019366763 7:637044-637066 GGGAGGCTAAGGCGGGTGGACGG + Intronic
1019413687 7:917705-917727 GGGAGGCCTAGGCGGGCGGATGG - Intronic
1019546363 7:1578604-1578626 TGGATGAATTGACGGGTGGATGG - Intergenic
1019664286 7:2243666-2243688 GGGATGCTGAGGCAGGAGGATGG + Intronic
1019699474 7:2467508-2467530 GGGAGGCTGAGGCGGGAGGACGG - Intergenic
1019983384 7:4638129-4638151 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1020028289 7:4915031-4915053 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1020095193 7:5364562-5364584 GGGAGGCCGAGGCGGGTGGATGG + Intronic
1020180408 7:5918012-5918034 CGGAGGCTGTGGCTGGTGGAAGG + Intronic
1020248492 7:6448995-6449017 GGGAGGCTGCGGCGGGAGGATGG - Intronic
1020302523 7:6806870-6806892 CGGAGGCTGTGGCTGGTGGAAGG - Intronic
1020518172 7:9152030-9152052 GGGATAATTTGGTGGGTGGGGGG - Intergenic
1020817217 7:12920514-12920536 GGGAGGCATGGGCGGGGGGAGGG - Intergenic
1022735612 7:33073094-33073116 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1022941904 7:35249636-35249658 GAGAAGGTTTGGCGGGTGGAGGG - Intronic
1023372166 7:39522479-39522501 GGGAGGCTTAGGTGGGAGGATGG + Intergenic
1023544923 7:41308397-41308419 GGAATGCTTTGGCAGGTGGTGGG + Intergenic
1023813593 7:43931195-43931217 GGGAGGCTAAGGCAGGTGGATGG + Intronic
1025098195 7:56113850-56113872 GGGATGCTAAGGTGGGAGGATGG + Intergenic
1025143693 7:56486225-56486247 GGGATGCTGAGGCAGGAGGATGG - Intergenic
1025228708 7:57184505-57184527 GGGAGGTTGTGGCAGGTGGATGG + Intergenic
1026248342 7:68644461-68644483 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1026356161 7:69559249-69559271 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1026920210 7:74150046-74150068 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1026970002 7:74461996-74462018 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1026975791 7:74497366-74497388 GGGAAGCTGAGGCGGGAGGATGG - Intronic
1027150841 7:75732618-75732640 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1027376361 7:77554925-77554947 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1027745106 7:82062984-82063006 GGGAGGCTAAGGCAGGTGGATGG - Intronic
1027751533 7:82153775-82153797 GGTAAGGTTTGGTGGGTGGAGGG - Intronic
1028813753 7:95120194-95120216 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1029121198 7:98269582-98269604 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1029204057 7:98858299-98858321 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1029287715 7:99477576-99477598 GGGAGGCTGAGGCTGGTGGATGG - Intronic
1029368036 7:100128744-100128766 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1029426095 7:100494669-100494691 GGGAAATTTTAGCGGGTGGAGGG + Exonic
1029629275 7:101740239-101740261 GGGATGCTGAGGCTGGAGGATGG - Intergenic
1029891585 7:103935582-103935604 GGGATCCTTTGGCATGTAGATGG - Intronic
1030069716 7:105688300-105688322 GGGAGGCTGAGGCGGGTGGATGG + Intronic
1030621064 7:111791807-111791829 GGGAGGCCGAGGCGGGTGGATGG - Intronic
1030684945 7:112476419-112476441 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1030929378 7:115503448-115503470 GGGAGGCTGAGGCAGGTGGATGG + Intergenic
1031100605 7:117475607-117475629 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1031540845 7:122992907-122992929 GGAATGCTTAGGAGGCTGGAGGG - Intergenic
1032113317 7:129095542-129095564 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1032165622 7:129542593-129542615 GGGAAGCTGAGGCGGGCGGATGG - Intergenic
1032343644 7:131099357-131099379 GGGAGGCTGGGGCGGGAGGATGG + Intergenic
1032441251 7:131944705-131944727 GGGATGCCTTGCCTGGAGGAAGG + Intergenic
1032476451 7:132214550-132214572 GGGATGCTGGGGTGGGAGGAAGG - Intronic
1032543581 7:132724281-132724303 GGGATGGTGTGGGTGGTGGAGGG - Intronic
1032701267 7:134381518-134381540 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1032858253 7:135854808-135854830 GGGAGGCTGAGGCGGGAGGATGG - Intergenic
1032871847 7:135994322-135994344 GGGAGGCTTAGGCAGGAGGATGG - Intergenic
1032954808 7:136958694-136958716 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1033132537 7:138757274-138757296 GGGAGGCTAAGGCGGGTGGATGG + Intronic
1033632781 7:143176906-143176928 GGGAGGCCAAGGCGGGTGGATGG + Intergenic
1034419935 7:150984920-150984942 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1034883614 7:154780856-154780878 GTGATGGTTGGGTGGGTGGAGGG + Intronic
1035330267 7:158092067-158092089 GAGATGGTTGGGTGGGTGGATGG + Intronic
1035331336 7:158099028-158099050 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331386 7:158099151-158099173 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331475 7:158099364-158099386 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331513 7:158099457-158099479 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331551 7:158099550-158099572 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331564 7:158099583-158099605 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331603 7:158099675-158099697 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331639 7:158099769-158099791 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035331652 7:158099802-158099824 GGGATGTGTTGGGGGGAGGAAGG - Intronic
1035389351 7:158495415-158495437 GGGAGGCTTTGCCAGGTGCATGG - Intronic
1035591144 8:814746-814768 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1035706565 8:1679740-1679762 AGGAGGCTGAGGCGGGTGGATGG + Intronic
1036175542 8:6534506-6534528 GGGGGGCTGAGGCGGGTGGATGG - Intronic
1036944176 8:13079181-13079203 GGGAAGCTGAGGCAGGTGGATGG - Intergenic
1037037756 8:14189096-14189118 GGGAGGCTGAGACGGGTGGATGG - Intronic
1037081711 8:14795827-14795849 GGGATCTTTCGGAGGGTGGAGGG - Intronic
1037534811 8:19814426-19814448 GGGATGCTGAGGAGGGTGGATGG + Intergenic
1037820310 8:22131906-22131928 GGGATGCTTCCTCGGGTGGAGGG - Intronic
1037954376 8:23042722-23042744 GGGCTGCTGTGGGGAGTGGAGGG - Intronic
1037984173 8:23276443-23276465 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1038146866 8:24905279-24905301 GGAATACTTTGGTGGGTGAAAGG - Intergenic
1038601895 8:28952471-28952493 GGGAGGCCCAGGCGGGTGGATGG - Intronic
1039062716 8:33584577-33584599 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1039973781 8:42342753-42342775 GGGATGCCAAGGCGGGTGGATGG + Intronic
1040386363 8:46917506-46917528 AGGATAATTTGGCGGGTGGGCGG - Intergenic
1040408511 8:47132858-47132880 GGGTTTCCTTGGCGGGTGGGTGG - Intergenic
1040494074 8:47950522-47950544 GGGAGGCTTAGGCGGGAGAATGG + Intronic
1041047381 8:53900379-53900401 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1041629383 8:60068418-60068440 GGTATACTTTTGCGGGTGAAAGG - Intergenic
1041698692 8:60764090-60764112 GGGAGGCTTAGGCGGGAGAATGG - Intronic
1042224678 8:66505893-66505915 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1042295166 8:67210236-67210258 GGGAAGCTGAGGTGGGTGGATGG + Intronic
1042500049 8:69498961-69498983 GGGAGGCTTAGGTGGGAGGATGG - Intronic
1042926091 8:73970135-73970157 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1043011706 8:74889051-74889073 GGGAGGCTGAGGAGGGTGGATGG - Intergenic
1043153363 8:76746298-76746320 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1043446932 8:80328288-80328310 GGGAGGCTGTGGTGGGTGGGTGG + Intergenic
1043451555 8:80372459-80372481 GGGATGCTGAGGCAGGAGGATGG + Intergenic
1043931951 8:86101353-86101375 GGGAGGCTGTGGCAGGAGGATGG + Intronic
1043970178 8:86519949-86519971 GGGAGGCTGAGGCGGGCGGATGG - Intronic
1044591740 8:93919286-93919308 GGGAGGCTGAGGCGGGTGGATGG + Intronic
1044623314 8:94212258-94212280 GGGAGGCTTAGGTGGGAGGATGG - Intronic
1046890241 8:119414858-119414880 GATAGGCTTTGGAGGGTGGAGGG - Intergenic
1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG + Intergenic
1047677757 8:127221657-127221679 GGGAAGCTGAGGCGGGTGGGCGG + Intergenic
1048007461 8:130431129-130431151 GGGATCATTTGGAGGGGGGATGG - Intronic
1048862758 8:138736273-138736295 GTGAAGCTTTGGTGGGTGGGGGG + Intronic
1048975271 8:139668173-139668195 GGAATGTTTTGGAGGGTGGAGGG + Intronic
1049129603 8:140826674-140826696 GGGAGGCGGAGGCGGGTGGATGG + Intronic
1049223515 8:141438710-141438732 GGGATGCATGGGTGAGTGGATGG + Intergenic
1049353902 8:142178386-142178408 GGGATGCACTGGCTGGTGGTGGG - Intergenic
1049464228 8:142743801-142743823 GGGATGGTTGGGTGGATGGATGG + Intergenic
1049582238 8:143418107-143418129 GGGGTGAGTTGGTGGGTGGATGG - Intergenic
1049608355 8:143540467-143540489 GGGAGGCTATGGCAGGAGGATGG - Intronic
1049834950 8:144729573-144729595 GGGAGGCCGAGGCGGGTGGATGG - Intronic
1049842338 8:144780895-144780917 GGGTGGCTGAGGCGGGTGGATGG + Intronic
1050767283 9:9150711-9150733 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1051617526 9:19020454-19020476 GGGATGCTGAGGTGGGAGGATGG - Intronic
1053124442 9:35568395-35568417 GGGAAGCTGAGGCGGGAGGATGG + Intergenic
1053531503 9:38886723-38886745 TGGATGGTGTGGTGGGTGGAAGG - Intergenic
1053800556 9:41761390-41761412 GAGAGGCTGAGGCGGGTGGATGG + Intergenic
1054144636 9:61553445-61553467 GAGAGGCTGAGGCGGGTGGATGG - Intergenic
1054188987 9:61973542-61973564 GAGAGGCTGAGGCGGGTGGATGG + Intergenic
1054203727 9:62111151-62111173 TGGATGGTGTGGTGGGTGGAAGG - Intergenic
1054634635 9:67477214-67477236 TGGATGGTGTGGTGGGTGGAAGG + Intergenic
1055316927 9:75043104-75043126 GGGAGGCTAAGGCAGGTGGATGG - Intergenic
1055442730 9:76352605-76352627 GGGAGGCTGAGGTGGGTGGATGG - Intronic
1055448813 9:76411566-76411588 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1055460110 9:76511623-76511645 GGGAGGCTGAAGCGGGTGGATGG - Intergenic
1056151863 9:83798753-83798775 GGGAGTCTGAGGCGGGTGGATGG - Intronic
1056377533 9:86028951-86028973 GGGAAGCTTAGGCGGGAGAATGG - Intronic
1056587887 9:87940122-87940144 GGAAAGTTTTGGGGGGTGGATGG + Intergenic
1056608980 9:88112823-88112845 GGAAAGTTTTGGGGGGTGGATGG - Intergenic
1056759373 9:89404552-89404574 GGGATGCTGAGGCGGGTGGCTGG - Intronic
1056759389 9:89404600-89404622 GGGATGCTGAGGCGGGTGGCTGG - Intronic
1056759419 9:89404696-89404718 GGGATGCTGCGGTGGGTGGCTGG - Intronic
1056759477 9:89404888-89404910 GGGATGCTGAGGCGGGTGACTGG - Intronic
1056759492 9:89404936-89404958 GGGATGCTGAGGTGGGTGGCTGG - Intronic
1056759537 9:89405080-89405102 GGAATGCTGAGGCGGGTGGCTGG - Intronic
1056759554 9:89405128-89405150 GGGATGCTGAGGCGGGTGGCTGG - Intronic
1056759580 9:89405224-89405246 GGAATGCTGAGGCGGGTGGCTGG - Intronic
1056759596 9:89405272-89405294 GGGATGCTGAGGTGGGTGGCTGG - Intronic
1056984333 9:91347294-91347316 GGGAGGCTGAGGCAGGTGGATGG - Intronic
1057519362 9:95749083-95749105 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1057782738 9:98063165-98063187 GGGAGGCTGGGGCGGGCGGATGG - Intronic
1058055276 9:100442565-100442587 GGGATGCTGAGGCGGGAGGATGG + Intronic
1058178390 9:101766086-101766108 GGGAGGCTGTGGCAGGTGGCAGG + Intergenic
1059124472 9:111670955-111670977 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1059248135 9:112865511-112865533 GGGAGGCTGTGGCAGGAGGATGG + Intronic
1060397130 9:123324240-123324262 GGGAGGCTGAGGTGGGTGGATGG - Intergenic
1060705326 9:125793245-125793267 GGGATGCTGAGGCGGGAGAATGG + Intronic
1061044853 9:128159683-128159705 GGTAGGCTGAGGCGGGTGGATGG + Intergenic
1061846935 9:133393261-133393283 TGGATGGGTGGGCGGGTGGATGG + Intronic
1061905561 9:133694883-133694905 GGGATGTGTGGGCTGGTGGATGG + Intronic
1061964022 9:134003233-134003255 TGGGTGCGTTGGTGGGTGGATGG - Intergenic
1062066820 9:134532814-134532836 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1062148541 9:135004976-135004998 GGGATGGATGGGTGGGTGGATGG + Intergenic
1062289729 9:135789166-135789188 AGGAAGCTTTGGCGGGTGAGGGG - Intronic
1062403907 9:136384542-136384564 GGGAGGCTGGGGCGGGAGGATGG + Intronic
1062526934 9:136981670-136981692 GGGTTGCTTTGGCGGGGAGCCGG - Exonic
1062602813 9:137326419-137326441 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1185467078 X:361538-361560 GGAATGCTTTGGCTCGTGGCCGG + Exonic
1185477983 X:426358-426380 GGGAGGCTGAGGCGGGAGGACGG - Intergenic
1185580957 X:1211326-1211348 TGGATGTATTGGTGGGTGGATGG + Intronic
1185738867 X:2514183-2514205 GGGATGCTGAGGTGGGAGGATGG + Intergenic
1185762721 X:2700905-2700927 TGGATGGTTGGGTGGGTGGATGG - Intronic
1185763310 X:2704817-2704839 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1185775182 X:2797376-2797398 GGCATGCGATGGTGGGTGGAGGG + Intronic
1185977948 X:4742477-4742499 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1186064778 X:5751038-5751060 GGGAGGCCTAGGCGGGAGGATGG - Intergenic
1186150203 X:6666528-6666550 GGGATGCTGAGGGGGGAGGATGG - Intergenic
1186492731 X:9986823-9986845 GGGGTGCTTTGCTGGGGGGAGGG - Intergenic
1186957543 X:14699966-14699988 GGGGTCTTTTGGAGGGTGGAGGG + Intronic
1187175622 X:16893878-16893900 GGGAGGCTGAGCCGGGTGGATGG - Intergenic
1187541555 X:20201376-20201398 GGGAGGCTGAGGCGGGAGGATGG - Intronic
1187865411 X:23719028-23719050 GGGAGGCGAGGGCGGGTGGATGG + Intronic
1187897665 X:23997837-23997859 GGGAGGCTGAGGCGGGAGGACGG + Intronic
1187907565 X:24081863-24081885 GGGAGGCTGAGGAGGGTGGATGG + Intergenic
1188425832 X:30045667-30045689 GGGAGGCAAAGGCGGGTGGATGG - Intergenic
1188460307 X:30418077-30418099 GGGATTCTTTGGCGGGAGTAGGG + Intergenic
1188559109 X:31447757-31447779 GGGAGGCTGAGGTGGGTGGATGG + Intronic
1189070007 X:37853318-37853340 GGGATGCTGAGGCGGGAGAATGG + Intronic
1189309398 X:40009179-40009201 GGGATGACTTGGAGGGGGGAGGG + Intergenic
1189329457 X:40134382-40134404 GGGAGGCTGAGGCGGGAGGATGG + Intronic
1190855831 X:54293935-54293957 GGGAGGCTGAGGCGGGTAGATGG + Intronic
1190891297 X:54571436-54571458 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1191751041 X:64542967-64542989 GGGATGCTGAGGTGGGAGGATGG + Intergenic
1191796279 X:65025251-65025273 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1191807898 X:65155058-65155080 GGGATGCTGAGGTGGGAGGATGG - Intergenic
1192501630 X:71657782-71657804 GGGAGACCTAGGCGGGTGGATGG + Intergenic
1192546941 X:72022123-72022145 GGGCAGCTTTGGTGGGTGGGGGG - Intergenic
1193484727 X:82072541-82072563 GTGAAGCATTGGAGGGTGGAGGG - Intergenic
1193731671 X:85109767-85109789 GGAAAGCCGTGGCGGGTGGATGG + Intergenic
1193762378 X:85483389-85483411 GGGGTCTTTTGGAGGGTGGAAGG - Intergenic
1195082165 X:101381788-101381810 GGGAGGCTGAGGCGGCTGGATGG + Intronic
1195268121 X:103203628-103203650 GGGTTTCTTTGGCGGGGGGGGGG - Intergenic
1195376717 X:104234867-104234889 GGGAGGCTGAGGCGGGAGGATGG + Intergenic
1196603352 X:117627024-117627046 AGGAGGCTGAGGCGGGTGGACGG - Intergenic
1196649193 X:118151616-118151638 GGGAGGCTGAGGCAGGTGGATGG - Intergenic
1196672460 X:118383372-118383394 GGGATGCTAAGGTGGGAGGATGG + Intronic
1196708954 X:118742741-118742763 GGGTTGTTTTGGCGGGGGGCGGG + Intronic
1196829538 X:119765410-119765432 GGGTTTTTTTGGGGGGTGGAAGG + Intergenic
1197714885 X:129699491-129699513 GGGAGGCCGAGGCGGGTGGATGG - Intergenic
1198686435 X:139232665-139232687 TGGATGGGTTGGTGGGTGGATGG - Intergenic
1199340110 X:146667661-146667683 GAGAGGCTTTGGTGGGAGGATGG + Intergenic
1199498398 X:148481018-148481040 GGGAGGCTGAGGCGGGTGGATGG - Intergenic
1199654577 X:149981625-149981647 GGGATGCCGTGGCTGTTGGAGGG + Intergenic
1199728938 X:150611953-150611975 GGGAGGCTGAGGCAGGTGGATGG + Intronic
1200397046 X:155997282-155997304 AGGTTGCTTTAGCTGGTGGAAGG + Intergenic
1201578945 Y:15491002-15491024 GGGAGGCTGAGGTGGGTGGATGG + Intergenic
1202255802 Y:22919047-22919069 GGGATGCTGAGGAGGGTGTATGG + Intergenic
1202408793 Y:24552796-24552818 GGGATGCTGAGGAGGGTGTATGG + Intergenic
1202461990 Y:25117284-25117306 GGGATGCTGAGGAGGGTGTATGG - Intergenic