ID: 906153655

View in Genome Browser
Species Human (GRCh38)
Location 1:43601872-43601894
Sequence CACCCAGTTGGTGCTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 260}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906153639_906153655 28 Left 906153639 1:43601821-43601843 CCCTGCAGGCTGCCTGCCCTCCC 0: 1
1: 1
2: 13
3: 85
4: 633
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153648_906153655 -1 Left 906153648 1:43601850-43601872 CCTACCCTCCTCAGCCCTGGCAC 0: 1
1: 0
2: 3
3: 67
4: 731
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153643_906153655 11 Left 906153643 1:43601838-43601860 CCTCCCTGTCTCCCTACCCTCCT 0: 1
1: 0
2: 28
3: 569
4: 7706
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153644_906153655 8 Left 906153644 1:43601841-43601863 CCCTGTCTCCCTACCCTCCTCAG 0: 1
1: 2
2: 5
3: 74
4: 707
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153642_906153655 12 Left 906153642 1:43601837-43601859 CCCTCCCTGTCTCCCTACCCTCC 0: 1
1: 3
2: 46
3: 810
4: 8515
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153647_906153655 0 Left 906153647 1:43601849-43601871 CCCTACCCTCCTCAGCCCTGGCA 0: 1
1: 2
2: 8
3: 51
4: 552
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153651_906153655 -9 Left 906153651 1:43601858-43601880 CCTCAGCCCTGGCACACCCAGTT 0: 1
1: 0
2: 1
3: 35
4: 360
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153650_906153655 -6 Left 906153650 1:43601855-43601877 CCTCCTCAGCCCTGGCACACCCA 0: 1
1: 0
2: 3
3: 67
4: 587
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153649_906153655 -5 Left 906153649 1:43601854-43601876 CCCTCCTCAGCCCTGGCACACCC 0: 1
1: 0
2: 8
3: 77
4: 628
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153640_906153655 27 Left 906153640 1:43601822-43601844 CCTGCAGGCTGCCTGCCCTCCCT 0: 1
1: 1
2: 10
3: 89
4: 719
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153641_906153655 16 Left 906153641 1:43601833-43601855 CCTGCCCTCCCTGTCTCCCTACC 0: 1
1: 2
2: 29
3: 812
4: 10753
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260
906153645_906153655 7 Left 906153645 1:43601842-43601864 CCTGTCTCCCTACCCTCCTCAGC 0: 1
1: 1
2: 6
3: 87
4: 717
Right 906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG 0: 1
1: 0
2: 1
3: 29
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906153655 Original CRISPR CACCCAGTTGGTGCTCAGTG AGG Intronic
900125914 1:1068903-1068925 CGCCTAGTTTGTCCTCAGTGGGG + Intergenic
900208412 1:1441295-1441317 CACCCAGCTGGTGGGCGGTGTGG - Exonic
900400222 1:2469992-2470014 CACCCAGGTGCTGCTCTCTGGGG - Intronic
900649509 1:3724012-3724034 CACCCACGTGGTGCCCAGCGGGG - Intronic
901807279 1:11746619-11746641 CACACAGTTGCTGAGCAGTGGGG - Intronic
902427496 1:16336013-16336035 AACCCAGGAGGTGTTCAGTGAGG - Intronic
902604452 1:17561146-17561168 CACGTAGTAGGTGCTCAGTAAGG + Intronic
904484427 1:30815375-30815397 CCCCCAGTAGGTGCTCTGTAAGG + Intergenic
904864914 1:33570773-33570795 CATCCAGTGGCTGGTCAGTGTGG + Intronic
904989843 1:34583416-34583438 CTCCCAGGTGGTGATTAGTGAGG + Intergenic
906143962 1:43549234-43549256 CCCACAGCTGGTGTTCAGTGAGG - Intronic
906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG + Intronic
908065198 1:60395911-60395933 CAGCGAGATGGTGCCCAGTGAGG + Intergenic
910557684 1:88554195-88554217 CACATAGTTGGTGCTCATTATGG + Intergenic
910657861 1:89636217-89636239 CACCTAGTAGGTGCTCAGTAAGG + Intronic
910813796 1:91266409-91266431 CACCCAGCTGGTATTCACTGTGG + Intronic
915522950 1:156458670-156458692 CACACAGTATGTGTTCAGTGGGG - Intergenic
916445645 1:164869379-164869401 GACCCACTTGGAGCCCAGTGTGG - Intronic
918508197 1:185280879-185280901 CCCCCTGTTGCTTCTCAGTGTGG + Intronic
921048238 1:211492317-211492339 CCTCCAGCCGGTGCTCAGTGTGG + Exonic
922718231 1:227887698-227887720 CACCCAGGTGGTGATGAGGGCGG + Intergenic
922819586 1:228474866-228474888 CACCCAGCTGGTGTCCACTGGGG - Intergenic
923678431 1:236100081-236100103 CACCCAGTGGGTGCTGGCTGAGG + Intergenic
1064177890 10:13091122-13091144 CATCCAGTTGGTTGCCAGTGAGG - Intronic
1064661559 10:17612878-17612900 CACCCAGCTGGAGTGCAGTGGGG - Intronic
1066370719 10:34815780-34815802 AAAGCAGTTTGTGCTCAGTGCGG + Intergenic
1068782614 10:60937879-60937901 CACATAGTAGGTGCTCAGTAAGG - Intronic
1070467140 10:76734786-76734808 CAACCAGTAGGTGCTCAGTAAGG - Intergenic
1070698837 10:78584108-78584130 CACAGAGTTGGTGCTCAGGAAGG - Intergenic
1070959919 10:80491445-80491467 CACCCAGTTGCTCCTCTCTGTGG + Intronic
1071672607 10:87622987-87623009 TACCCAGTTGATGCCCAGCGTGG - Intergenic
1072511632 10:96131704-96131726 CACACAGTGGGTGTTCATTGTGG - Intronic
1074783057 10:116815962-116815984 GGCCCAGTCAGTGCTCAGTGAGG - Intergenic
1075192795 10:120326504-120326526 CACACAGTGAGTGCTCAGTAAGG + Intergenic
1075626335 10:123966752-123966774 CAAGCAGTGGGCGCTCAGTGGGG - Intergenic
1076537807 10:131193918-131193940 CCCCCTGTGGGGGCTCAGTGAGG - Intronic
1076687114 10:132203159-132203181 TGCCCAGTTGGACCTCAGTGTGG + Intronic
1077183704 11:1227394-1227416 CACCCAGGTGGCACTCACTGTGG - Exonic
1078091420 11:8266859-8266881 CACACAGGTGATGCTCAGAGAGG + Intronic
1079090852 11:17479222-17479244 CACCCACATGGTGGGCAGTGTGG - Intergenic
1079108009 11:17586311-17586333 CATCCTGCTGCTGCTCAGTGAGG - Intronic
1079704177 11:23592681-23592703 AACCCAGTAGATGCTCAGTTGGG - Intergenic
1080753070 11:35168489-35168511 CACTCAGTGAGTGCTCACTGTGG + Intronic
1083191551 11:61055981-61056003 CACTCAGTTGGTTCGGAGTGGGG - Intergenic
1083582831 11:63836178-63836200 CACATAGTAGGTGCTCAGTAGGG + Intergenic
1083607942 11:63990113-63990135 GACCAGGCTGGTGCTCAGTGGGG + Intronic
1084580843 11:70022280-70022302 CACACAGTAGGTGCTCAATAAGG + Intergenic
1085517807 11:77121682-77121704 CACACAGCAGGTGCTCAGTAAGG + Intronic
1090568943 11:128026353-128026375 CCCCCAGTGGATGCCCAGTGGGG + Intergenic
1090664285 11:128904728-128904750 CACCCAGTGGGTGTTGAGTGGGG + Intronic
1094462564 12:30712935-30712957 CACCCTGTTGGTGGTCAGGCTGG + Intronic
1096526755 12:52214619-52214641 CACCCAGTAGGTGCTTCGGGAGG - Intergenic
1097589818 12:61560954-61560976 CACCCAGTTTGTGATGACTGTGG + Intergenic
1098308375 12:69123729-69123751 GATCCAGTTGTTGGTCAGTGGGG + Intergenic
1098949476 12:76624631-76624653 ATGGCAGTTGGTGCTCAGTGTGG - Intergenic
1099487788 12:83249556-83249578 TTCCCAGTTGGGGCTCTGTGAGG - Intergenic
1102452259 12:113050613-113050635 CATCCAGATCGTGCTCAGGGTGG - Intergenic
1102774211 12:115504819-115504841 ACCCCAGATGGGGCTCAGTGTGG - Intergenic
1105447876 13:20473276-20473298 CACCCACATGCTGCTCACTGTGG + Intronic
1107908787 13:45085939-45085961 AACCAGGTTGGTGCTCACTGAGG + Intergenic
1109145469 13:58773707-58773729 CACCCAGTGGATCCGCAGTGGGG - Intergenic
1110470542 13:75854856-75854878 CACCCTTTTGGTGCTCTGAGGGG + Intronic
1110851364 13:80248929-80248951 TACCCAGTTGGTTCTGAGTTAGG - Intergenic
1117508357 14:56424629-56424651 CACCCAGGTGGTGCTCGCAGGGG - Intergenic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1121005648 14:90489158-90489180 GAACCAGGTGGGGCTCAGTGGGG + Intergenic
1122156583 14:99753704-99753726 CACATAGTAGGTGCTCAGTGGGG + Intronic
1122264339 14:100539668-100539690 CACCCATTTTGTGCCCAGCGAGG + Intronic
1122269524 14:100562317-100562339 CATGCAGTAGGTGCTCATTGAGG - Intronic
1122519853 14:102335534-102335556 CACACAGTAGGTGCTCACTGGGG + Intronic
1124147405 15:27140323-27140345 CACCCAGCTGGTGTCCATTGTGG + Intronic
1124570437 15:30858070-30858092 CACCAAGTTTGTGTCCAGTGAGG + Intergenic
1125172018 15:36776391-36776413 AACACGGTAGGTGCTCAGTGAGG - Intronic
1125811649 15:42547389-42547411 CTCCCAGTTGGTTCCCAGAGAGG + Exonic
1126959732 15:53978261-53978283 CACACAGTTAGTTGTCAGTGCGG + Intergenic
1127392481 15:58517920-58517942 CAGCTAGTTGGTGCAAAGTGGGG + Intronic
1127852854 15:62929161-62929183 CATTCAGTGGGTGCTCAATGAGG - Intergenic
1127997465 15:64161917-64161939 CAGGCAGTCGGTGCTCAGTGAGG + Intronic
1128083849 15:64872801-64872823 CAAACAGTAGGTGCTCTGTGAGG - Intronic
1128499835 15:68220230-68220252 CACATAGTTGGTGTTCAGTGAGG - Intronic
1128726129 15:69989814-69989836 CACCCACTAGGTGCTGGGTGTGG + Intergenic
1128780982 15:70358525-70358547 CGCCCATTTTGTGCTGAGTGGGG + Intergenic
1129169489 15:73799000-73799022 CAGCCTGTTGGTGCTCAGAGGGG + Intergenic
1129243787 15:74267809-74267831 CATACAGTAGGTGCTCAGTTTGG + Intronic
1130060862 15:80569047-80569069 CATGCAGATGGTGCTCAGTCAGG + Intronic
1130520771 15:84658985-84659007 CACACAGTAGGTGCTCAGAATGG + Intergenic
1130851396 15:87797707-87797729 CACCCTGTGGGTGTTCGGTGAGG + Intergenic
1131050080 15:89341936-89341958 CAGACAGTGGGTTCTCAGTGGGG - Intergenic
1131254770 15:90854869-90854891 CACACAGCAGGTGCTCAGGGAGG - Intergenic
1131460600 15:92614974-92614996 CGGCCAGGTGGTGCTGAGTGTGG - Intergenic
1132345016 15:101102843-101102865 GACCTTGTTGGTGCTCTGTGAGG + Intergenic
1133307635 16:4820873-4820895 CAGCCAGCAAGTGCTCAGTGAGG + Intronic
1133425899 16:5689182-5689204 CACACAGGTGGTGCTCAGTATGG + Intergenic
1134562934 16:15226411-15226433 CACACAGTAGGTGCTCATAGTGG - Intergenic
1134923471 16:18138044-18138066 CACACAGTAGGTGCTCATAGTGG - Intergenic
1135991437 16:27221104-27221126 CACCCAGCAGGTGCACAGCGCGG - Intronic
1136147176 16:28322381-28322403 CACCCATGTGGTGCTTATTGCGG - Exonic
1136297084 16:29309760-29309782 CACACAGATGCTGCTCAATGTGG - Intergenic
1136547942 16:30965880-30965902 GACCGACTTGGGGCTCAGTGGGG + Exonic
1137696757 16:50466777-50466799 CACCCAGTGGGTGCGGAATGGGG + Intergenic
1137894961 16:52201628-52201650 CATGCAGTTTGTCCTCAGTGAGG + Intergenic
1138226293 16:55298225-55298247 CACCCAGTTGGAGCTCACAGTGG - Intergenic
1138610105 16:58116499-58116521 CATCCAGTGGGTGGACAGTGTGG - Intronic
1139356406 16:66369374-66369396 CACACAGTAGGTGCTCAGTAAGG - Intronic
1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG + Exonic
1141986404 16:87583062-87583084 CACACAGGTGGTGGCCAGTGGGG - Intergenic
1142058635 16:88015864-88015886 CACACAGATGCTGCTCAATGTGG - Intronic
1142709661 17:1716123-1716145 CACCCACCTGGTGCTGGGTGTGG + Intergenic
1146226794 17:31074124-31074146 CACCCACTTTGTGCACAGTCAGG + Intergenic
1146500032 17:33356341-33356363 CTCCCAGTTGGTTAGCAGTGGGG + Intronic
1148237168 17:45976580-45976602 CATCCAGTTGGGGTGCAGTGTGG + Intronic
1153028482 18:691872-691894 CACTCAGCAGGAGCTCAGTGGGG + Intronic
1153303913 18:3615322-3615344 CACATAGTTGGTGCTGATTGGGG + Intronic
1153979329 18:10295910-10295932 CACCCATTTCCTTCTCAGTGAGG - Intergenic
1154013430 18:10595228-10595250 CACATAGTTAGTGCTCAGTAAGG + Intergenic
1154152655 18:11918823-11918845 CACATAGTTAGTGCTCAGTAAGG + Intergenic
1154293020 18:13127161-13127183 CACTCAGCTGGAGCTCAGGGAGG - Intergenic
1154477386 18:14776213-14776235 CACACAGTTGGTACTCAGAAAGG - Intronic
1157153574 18:45243181-45243203 CATTCAGTGGGTGCTCAGTGAGG + Intronic
1157402219 18:47398079-47398101 CAGCCAGCTGGTGCTGAGTAGGG + Intergenic
1157568440 18:48696353-48696375 CCCCCTGTTGGTGCTGACTGGGG + Intronic
1160821627 19:1061748-1061770 CCCACAGATGGTGCTCAGTGAGG - Intronic
1161066838 19:2242834-2242856 CTCCCAGGTGTTACTCAGTGAGG + Intronic
1162042820 19:7980709-7980731 CACACAGTAGGTGCTGAGTGAGG + Intronic
1162894145 19:13754900-13754922 CACACAGTAGGTGCTCAGTAAGG + Intronic
1163249586 19:16118541-16118563 GACCCAGATGGTGCCCACTGTGG - Intronic
1163451385 19:17379331-17379353 CTCCAGGGTGGTGCTCAGTGAGG + Intergenic
1164208435 19:23076614-23076636 CACCCAGTTGCTCCTCTGAGAGG - Intronic
1165177676 19:33941972-33941994 CAACCAGTTGGTCCCCAGTCTGG + Intergenic
1165435712 19:35793580-35793602 CACCCAGCTGTGACTCAGTGTGG + Intergenic
1166726120 19:45028804-45028826 CACCCACTGGGTGCCCAGTAAGG + Intronic
1167980960 19:53274868-53274890 CACCCAGTCAGTGATGAGTGTGG + Intergenic
1167985433 19:53310492-53310514 CACCCAGTCAGTGATGAGTGTGG - Intergenic
1168170685 19:54586657-54586679 CAGCCAGTTAGGGCTCAGAGAGG + Intronic
925887655 2:8407036-8407058 CACCAAGCTGGGGCTCTGTGTGG - Intergenic
926140191 2:10363922-10363944 GACTCAGCTGGTGCTCAGGGAGG + Intronic
926939581 2:18120472-18120494 CACACACTTGGTCCTCACTGAGG + Intronic
928603375 2:32922472-32922494 CCTGCACTTGGTGCTCAGTGAGG + Intergenic
929567982 2:43001642-43001664 CTCACAGTAGGTGCTCAGTTAGG - Intergenic
930555159 2:52886065-52886087 CACCCAGTGGTGGCTCTGTGTGG + Intergenic
931055866 2:58470400-58470422 AACCCAGTTTGTGCAGAGTGAGG - Intergenic
932423041 2:71612634-71612656 CACCCAGATGCTGCCCAGGGAGG + Exonic
932579158 2:72982501-72982523 CACACAGTCAGTGCTCAATGTGG - Intronic
932730938 2:74221669-74221691 CACCCAGAAGGTGCTCAGCCAGG + Intronic
932876389 2:75456595-75456617 ATCACAGTTGGTGATCAGTGTGG + Intergenic
933918710 2:87022895-87022917 CACCCTCTTGTTGCCCAGTGTGG - Intergenic
933919080 2:87026507-87026529 AACTCATTTGGGGCTCAGTGAGG + Intergenic
934003914 2:87743400-87743422 AACTCATTTGGGGCTCAGTGAGG - Intergenic
934004285 2:87747020-87747042 CACCCTCTTGTTGCCCAGTGTGG + Intergenic
934144191 2:89075459-89075481 GCCCCAGTAGGGGCTCAGTGTGG - Intergenic
934225052 2:90125089-90125111 GCCCCAGTAGGGGCTCAGTGTGG + Intergenic
935767244 2:106381034-106381056 CACCCTCTTGTTGCCCAGTGTGG + Intergenic
935845974 2:107165995-107166017 CACACAGTTGGAACTAAGTGAGG + Intergenic
936547865 2:113407975-113407997 CAAGCAGTAGGTGCTCAGAGTGG + Intergenic
936942863 2:117903588-117903610 GACCAAGTTCCTGCTCAGTGGGG - Intergenic
937019405 2:118636470-118636492 CACCAAGCAGTTGCTCAGTGAGG - Intergenic
937287697 2:120763533-120763555 CATCCAGTGGGTGCTCTGGGGGG + Intronic
937943411 2:127308919-127308941 CACACAGGTGGTGCTCATTAAGG + Intronic
939341320 2:140898763-140898785 CTCCCAGTTGGTTCCCAGAGAGG - Intronic
939405470 2:141750034-141750056 TAGCCAGTGAGTGCTCAGTGAGG + Intronic
941918169 2:170825540-170825562 CAGCCAGTTGTTGCCAAGTGGGG - Intronic
944907324 2:204275580-204275602 CACCCAGTTGGTGTTTGCTGCGG - Intergenic
946064011 2:216970629-216970651 CCGACAGTTGCTGCTCAGTGGGG + Intergenic
947634781 2:231674427-231674449 CATCCAGCTGGTACACAGTGAGG - Intergenic
947767221 2:232645434-232645456 GGCACAGTGGGTGCTCAGTGAGG - Intronic
947893412 2:233645890-233645912 CCCCCAGTTGTTGCTCTGTTTGG + Intronic
948542248 2:238699218-238699240 CCCACAGTTGGTCCTCAGGGTGG + Intergenic
948655757 2:239475873-239475895 AACCGACCTGGTGCTCAGTGAGG - Intergenic
948975163 2:241459406-241459428 CACCCAGTTGCTGGGCTGTGCGG + Intronic
1168827334 20:822785-822807 CGCCCAGCTGGTGCTCACTTTGG - Intergenic
1169235251 20:3925273-3925295 CACCCAGGTGGAGTGCAGTGGGG + Intronic
1170500863 20:16974526-16974548 CAGCCAGTTGGGGAGCAGTGCGG + Intergenic
1172287842 20:33753485-33753507 CACACAGCTGGTGCTCAGGATGG - Intronic
1172672565 20:36644426-36644448 CACAGAGTGGGTGCTCAGTAAGG + Intronic
1172810971 20:37647943-37647965 CACACAGTAGGTGCTCAATAAGG - Intergenic
1172867834 20:38113423-38113445 CACACAGTGAGAGCTCAGTGTGG + Intronic
1173920079 20:46737717-46737739 CACCAACTAGGTGCTCAGTTAGG + Intergenic
1174046738 20:47739187-47739209 CACCCAGTTTGTGATCTGTTAGG + Intronic
1174364233 20:50046876-50046898 CACACAGTAGGTGCTCAGGGGGG - Intergenic
1174484832 20:50854678-50854700 CACATAGTAGGTGCTCAGTTAGG + Intronic
1174706126 20:52658022-52658044 CACCCAGCTGGAGTGCAGTGGGG + Intergenic
1174793138 20:53498654-53498676 AACCTAGTTGGAGCTCACTGAGG - Intergenic
1175373542 20:58509201-58509223 CAGGTAGTTGGTGCTGAGTGAGG + Intronic
1175705008 20:61170317-61170339 CGCCCCTTTGGTGCTGAGTGAGG + Intergenic
1176120333 20:63451721-63451743 CATCCAGAGGGTGTTCAGTGGGG - Intronic
1180589795 22:16927772-16927794 CAAACAGTAGGTGCTCAGTGGGG - Intergenic
1181311973 22:21949814-21949836 CACCCATTTGGTGTGCAGTGGGG - Intronic
1181924233 22:26345269-26345291 CACCCAGTTAGTAAACAGTGGGG + Intronic
1182526842 22:30925873-30925895 CACCTTGATGGGGCTCAGTGGGG + Intronic
1183684199 22:39351967-39351989 CACCCCATGGGTGCTCAGAGGGG - Intronic
1184508482 22:44918223-44918245 CACCCATGTGGTGGTCAGTGAGG + Intronic
1184553185 22:45216519-45216541 CAGCCAGTTGCTGCACCGTGAGG - Intronic
1185070277 22:48652293-48652315 CTACCAGTTGGTGCTCAGCCTGG + Intronic
950008908 3:9708672-9708694 CACCCAGCTGGAGTGCAGTGGGG + Intronic
950151352 3:10689876-10689898 CACAAAGTAGGTCCTCAGTGAGG + Intronic
950562871 3:13745561-13745583 CACCCAGTAGGTGCTTATTAAGG - Intergenic
950657560 3:14446059-14446081 CACGCAGTAGCTGCTCAGTAAGG + Intronic
952152532 3:30607612-30607634 CACCCAGTAGGCATTCAGTGAGG - Intronic
953050088 3:39333039-39333061 CATCAGGTTGGTGCTCATTGTGG + Exonic
953180327 3:40588921-40588943 CACACAGTAGGTGCTCAGTTAGG + Intergenic
953886182 3:46715551-46715573 CTCCCAGTGGGTGCTGACTGTGG - Exonic
954524747 3:51260269-51260291 CATCCGGTTTGTGCTCAGTCTGG + Exonic
954656489 3:52197387-52197409 CACCCTGCTGGTGCCCAGGGTGG + Intergenic
954746679 3:52791438-52791460 CACTCAGCAGGTGCTCACTGCGG - Intronic
957268803 3:78002937-78002959 CATCAAGTTGGTGCTCATCGAGG - Intergenic
961011598 3:123440148-123440170 CACACAGTAGGTGCTCAGTGAGG - Intronic
961123411 3:124393966-124393988 CATCGAGTTGGTTCTCAGTATGG - Intronic
962325704 3:134430343-134430365 CACCCTGCTGGTGGACAGTGTGG + Intergenic
966718484 3:183037451-183037473 CCCCCAGTTCCTGCTGAGTGGGG + Intronic
966854077 3:184182164-184182186 CACCCCGCTTGTGTTCAGTGGGG - Exonic
967506167 3:190255223-190255245 CACACAGGAGGTGCTTAGTGAGG - Intergenic
968130433 3:196189894-196189916 CACCCTGTTTCTGCTCAGGGGGG - Intergenic
968947909 4:3675187-3675209 CACACAGTAGGTGCTCAATAGGG - Intergenic
968980185 4:3843778-3843800 CAGCCAGTGTGTGCTCTGTGAGG - Intergenic
969284530 4:6194697-6194719 CTGCCAGTGGGTGCTCATTGTGG - Intronic
969438086 4:7199989-7200011 CACCCCTCTGGTGCACAGTGGGG + Intronic
969455079 4:7295867-7295889 CACACAGTAGGTGATCAGTGTGG + Intronic
970218388 4:13782927-13782949 CCACCAGTTGGTGATCACTGAGG - Intergenic
970232998 4:13929986-13930008 TACCCAGTTGTTGCTCGGTGTGG - Intergenic
971301515 4:25446085-25446107 GCCCCTGTTGGTGTTCAGTGTGG + Intergenic
971501509 4:27323396-27323418 CACCCAGTTGGTGATAAATTTGG + Intergenic
974029300 4:56761916-56761938 CAGCCAGAAGGGGCTCAGTGAGG + Intergenic
975676969 4:76836831-76836853 TACCCAGTTGATGCTTGGTGGGG + Intergenic
978376844 4:108083045-108083067 TACAAAGTTAGTGCTCAGTGTGG - Intronic
982230625 4:153205360-153205382 GGCCCATTCGGTGCTCAGTGAGG + Intronic
991704339 5:69343979-69344001 CACCCGGTTGGAGTGCAGTGGGG + Intergenic
992000612 5:72432550-72432572 CCCTCAGCTGCTGCTCAGTGGGG - Intergenic
995972880 5:117994133-117994155 CACCAAGTTTGTTTTCAGTGAGG + Intergenic
997465218 5:134083540-134083562 GACCAAGTTTGTGGTCAGTGGGG + Intergenic
997639863 5:135442119-135442141 CACACAGTAGGTCCTCAGTCAGG - Intergenic
1003557804 6:7156515-7156537 AACCCAGATGTGGCTCAGTGCGG - Intronic
1004241152 6:13924181-13924203 CAGCCAGTAGCTGCGCAGTGTGG + Intergenic
1004496224 6:16165782-16165804 CACCCAGCTGGTGTCCACTGAGG - Intergenic
1005495986 6:26388344-26388366 CACCCAGATGGAGCCCAGAGCGG + Intronic
1006327028 6:33362057-33362079 CCCCCAGGAGGTGCTCAGTCAGG + Intergenic
1006796828 6:36737418-36737440 CACCCTCTTGCTGCTCTGTGGGG + Intergenic
1012019852 6:93904954-93904976 GACCCAGTGGGAGCTCAATGTGG + Intergenic
1012444883 6:99297287-99297309 CGCTCAGTTAGTACTCAGTGGGG - Intronic
1015796399 6:137016238-137016260 CACCCAGCTGGGGCTCCATGGGG + Intronic
1018127700 6:160697561-160697583 AACTCATTTGGGGCTCAGTGAGG - Intergenic
1018128069 6:160701166-160701188 CACCCTCTTGTTGCCCAGTGTGG + Intergenic
1018997907 6:168724421-168724443 CTCCCAGTCTGTGCTCAGTTTGG + Intergenic
1022922619 7:35031942-35031964 CTCACAGCTGGTGCTCAGTTGGG + Intronic
1024013109 7:45287528-45287550 CACCCAGTTGGTGTCCAGAGAGG - Intergenic
1027230184 7:76267848-76267870 GGCCCAGGTGGTGCCCAGTGGGG - Intronic
1029106402 7:98179850-98179872 CACGCAGCTGGTCCTCAATGTGG - Intronic
1030133570 7:106223887-106223909 ATCCCAGTAGGTCCTCAGTGTGG + Intergenic
1030170570 7:106598790-106598812 CACCCTTTTGGTGGTGAGTGGGG - Intergenic
1034547149 7:151796625-151796647 CACCCAGTTGGAGCTCGGCAAGG + Intronic
1035353373 7:158261889-158261911 CACACAGTTAGTGCTCAGGAGGG + Intronic
1037450325 8:19010307-19010329 GGCCCAGTTGGTGCCTAGTGGGG - Intronic
1039394660 8:37215014-37215036 CAGGCAGGTGGTGCTCAGGGTGG + Intergenic
1040015551 8:42696287-42696309 CACCCAGAGGGTGCTCGGTAAGG - Intergenic
1041231383 8:55756677-55756699 CACACAGGTGGTGCGGAGTGGGG + Intronic
1041671903 8:60500124-60500146 CACCTACTGGGAGCTCAGTGGGG - Intergenic
1042208596 8:66354104-66354126 CACCCAGTTTCTGCTGTGTGTGG + Intergenic
1042846937 8:73177704-73177726 CACCCAGCACGTGCTCAGTGAGG - Intergenic
1044311535 8:90698790-90698812 GATCCAGTAAGTGCTCAGTGAGG - Intronic
1044313399 8:90722296-90722318 GACCCAGTAAGTGCTCAATGAGG + Intronic
1047465413 8:125108157-125108179 AACTCAGTTTGTTCTCAGTGTGG - Intronic
1049265036 8:141663325-141663347 CACCCAGTTTGTGGTAACTGTGG - Intergenic
1049351859 8:142168895-142168917 CAGGCAGTTGGTGTTGAGTGGGG + Intergenic
1049409719 8:142467137-142467159 CACTCAGTAGGTGCCCAGTGAGG - Intronic
1055791448 9:79927014-79927036 CATCCAGTTGGTGTCCACTGGGG + Intergenic
1057009897 9:91591514-91591536 GACCCAGGTGGTGCTCACAGGGG - Intronic
1057077229 9:92144369-92144391 CAACCAGTTGGTGCAAATTGGGG + Intergenic
1058904798 9:109474103-109474125 CACCAAGGTGGCGCGCAGTGGGG - Intronic
1059406140 9:114099099-114099121 CATCCAGGTGGTGCTCAGGTGGG - Intronic
1060275999 9:122183048-122183070 CACCCAGTGGGAGCTCAGTAAGG + Intronic
1061258406 9:129466075-129466097 CACACAGTAGGTGCTCAGGAAGG - Intergenic
1061342043 9:129990354-129990376 CTTCCAGTTTCTGCTCAGTGAGG - Intronic
1061396106 9:130343962-130343984 CACCCACTTGGTGGTGTGTGTGG + Intronic
1061506754 9:131036025-131036047 CACATAGTAGGTGTTCAGTGAGG + Intronic
1061706440 9:132456938-132456960 CACCAAGTTGTTGCTCAGGCTGG + Intronic
1061903311 9:133683995-133684017 TACCCAGATGGAGCTCAGAGAGG - Intronic
1061922452 9:133789485-133789507 CTCCCAGCTGGTGCTCAGGATGG + Intronic
1062094131 9:134694368-134694390 CTGCCAGTTCGTGCCCAGTGGGG - Intronic
1185470338 X:377851-377873 CACCCAGTGGGTCCGCCGTGGGG + Intronic
1185891388 X:3825358-3825380 CACACAGTAGGTGCTCACTGGGG - Intronic
1185896495 X:3863772-3863794 CACACAGTAGGTGCTCACTGGGG - Intergenic
1185901613 X:3902198-3902220 CACACAGTAGGTGCTCACTGGGG - Intergenic
1186511050 X:10130059-10130081 CACCCATTTGCTGCTCAGGCAGG + Exonic
1186754936 X:12660765-12660787 CATCCAGATGGTTCTCACTGGGG + Intronic
1187270422 X:17775520-17775542 CGCCCTGGAGGTGCTCAGTGAGG + Intergenic
1187320089 X:18230205-18230227 CGCCCTGGAGGTGCTCAGTGAGG - Intergenic
1187567269 X:20463697-20463719 CAGCCAGTTGGAGCTCCTTGTGG + Intergenic
1192366470 X:70477849-70477871 CACCCAGTTGAAGGTCAGTCTGG + Intronic
1195569685 X:106384628-106384650 CACCCAATTGTTTCTCAGGGGGG - Intergenic
1198437162 X:136628512-136628534 CACCCAATTTCAGCTCAGTGTGG + Intergenic
1199289527 X:146090504-146090526 GACCCAGTGGGTACTCTGTGTGG - Intergenic
1201018406 Y:9626687-9626709 CTACCACTTGGTGCTCAGTTTGG + Intergenic