ID: 906156562

View in Genome Browser
Species Human (GRCh38)
Location 1:43617419-43617441
Sequence CAGAGAATGGAGAAAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 446}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906156562_906156572 26 Left 906156562 1:43617419-43617441 CCACCCGCTTTCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 30
4: 446
Right 906156572 1:43617468-43617490 CACGTGGGAGAATTCAAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 100
906156562_906156568 10 Left 906156562 1:43617419-43617441 CCACCCGCTTTCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 30
4: 446
Right 906156568 1:43617452-43617474 ACCCTGGACAGCAGTTCACGTGG 0: 1
1: 1
2: 1
3: 8
4: 77
906156562_906156570 11 Left 906156562 1:43617419-43617441 CCACCCGCTTTCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 30
4: 446
Right 906156570 1:43617453-43617475 CCCTGGACAGCAGTTCACGTGGG 0: 1
1: 1
2: 1
3: 9
4: 64
906156562_906156566 -6 Left 906156562 1:43617419-43617441 CCACCCGCTTTCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 30
4: 446
Right 906156566 1:43617436-43617458 TCTCTGCAGTCCATCGACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 142
906156562_906156573 29 Left 906156562 1:43617419-43617441 CCACCCGCTTTCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 30
4: 446
Right 906156573 1:43617471-43617493 GTGGGAGAATTCAAACCTGGAGG 0: 1
1: 0
2: 2
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906156562 Original CRISPR CAGAGAATGGAGAAAGCGGG TGG (reversed) Intronic
900420602 1:2554438-2554460 CAGAGAAGGGAGAAAAGGGACGG + Intergenic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900500070 1:2999992-3000014 GAGAGGATGGAGGAAGCTGGTGG + Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901671257 1:10857556-10857578 AAGAGAAAGGAGAGAACGGGAGG - Intergenic
901872399 1:12145778-12145800 CAGAGGATCGAGGAAGTGGGGGG - Intergenic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
903170256 1:21548098-21548120 CAGAGAAGGGAGGGAGGGGGTGG + Intronic
903455626 1:23484617-23484639 CAGAGGAGGGAGGAAGAGGGAGG - Intergenic
903651092 1:24922845-24922867 CAGGGAATAGAGAAAGGGAGTGG - Intronic
906071290 1:43018525-43018547 CATAGAAGGGTGAAAGCAGGGGG + Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
908424622 1:63994553-63994575 CAGACAATGGAGAAGGCTTGTGG + Intronic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
909960342 1:81832648-81832670 AAGAAAATGAAGAAAGAGGGTGG + Intronic
910495638 1:87824392-87824414 CCAAGAATGGAGAGAGCAGGGGG + Intergenic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
912272392 1:108224363-108224385 TAAAGATTGGAGAAAGCGAGAGG + Intronic
912295829 1:108469958-108469980 TAAAGATTGGAGAAAGCGAGAGG - Intronic
912417563 1:109520409-109520431 CAGAGAAGGGAGCAAGCTTGTGG + Intergenic
912677763 1:111701154-111701176 CAGAGAAGGGACAAAGAGAGAGG - Intronic
912814766 1:112820234-112820256 CAGTGAATGGAGATAGGGGTGGG + Intergenic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913145264 1:115982955-115982977 CAGAGAATGCAGAAAGAGATAGG - Intronic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915471522 1:156128571-156128593 GAGAGAATGGAGAAGCCAGGAGG - Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
916845390 1:168645003-168645025 CAGAGAATGGGGAGAGGGAGGGG + Intergenic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
917766346 1:178222326-178222348 CAGAAAATGTAGAAAATGGGTGG - Intronic
917941038 1:179921845-179921867 ATGAGATTGGAGAAAGCGAGAGG - Intronic
918114200 1:181483079-181483101 CAAAGGTTGGAGAAAGAGGGAGG - Intronic
918374109 1:183891535-183891557 CAGAGAATGGTGGAACCGGATGG - Intronic
918509298 1:185292850-185292872 CAGAATATGGAGAGAGCTGGAGG - Intergenic
920302281 1:204996500-204996522 CAGAGAAGGGAAAGAGAGGGAGG + Intronic
921036967 1:211389269-211389291 CAGAAAGAGGAGAAAGCAGGTGG - Intergenic
921063428 1:211606021-211606043 CAGAGAATGCAGAAAGGCTGTGG - Intergenic
921213017 1:212915977-212915999 CTGGGAATGGAGAAAGCATGCGG - Intergenic
921333890 1:214066894-214066916 CAGAGACTGGAAAAAGAGGAGGG + Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922663386 1:227449011-227449033 CAGAGAATGGGGAAAGATAGTGG + Intergenic
922866930 1:228868328-228868350 GAGAGACTGGAGAAAGCAGCTGG + Intergenic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
1062972485 10:1659794-1659816 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972515 10:1659915-1659937 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972546 10:1660036-1660058 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062983202 10:1743270-1743292 GAGAGAAAGGAGGAAGCCGGAGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1064050672 10:12056832-12056854 CAGAGAAGAGAGAAAGGAGGGGG - Intergenic
1064493607 10:15885349-15885371 CAGAGATTTGAGAAAGATGGAGG - Intergenic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066625199 10:37398856-37398878 CAGAGGAGGGAGAAAGGGAGGGG - Intergenic
1067031044 10:42879058-42879080 CAGAGAAGGGATAAAGCCAGGGG + Intergenic
1069246866 10:66217819-66217841 TAGAGACAGGAGATAGCGGGAGG + Intronic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070972503 10:80579082-80579104 CAGAGAAGGGAGATAGGTGGAGG + Intronic
1071412672 10:85412461-85412483 CATTGGATGGAGAAAGCAGGAGG - Intergenic
1072252739 10:93594522-93594544 CAGAGGACTGAGAGAGCGGGGGG - Intronic
1073082194 10:100867250-100867272 CAGGGAATGGAGAAAGCTAGGGG - Intergenic
1074149985 10:110750488-110750510 CAGAGAAGGAAGAACGCGTGGGG + Intronic
1074600286 10:114907097-114907119 GAGAGAATGGAAGAAGCTGGAGG - Intergenic
1074618726 10:115094482-115094504 AAGAGAATGGGGAAAGAGAGAGG - Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076437219 10:130454514-130454536 CTGAGAGTGGGGAAATCGGGTGG + Intergenic
1076492904 10:130875660-130875682 CAGATAAGGAAGAAAGGGGGTGG - Intergenic
1077346618 11:2061046-2061068 TGGAGAATGCAGAAAGGGGGAGG - Intergenic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1079195146 11:18319724-18319746 CAAAGACTTGAGAAAACGGGTGG + Intronic
1080237647 11:30090511-30090533 CATAGTATGGAGAAAGCAGTAGG + Intergenic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083746765 11:64741390-64741412 GAGAGAAGGGAGAAAGGGGAGGG + Intronic
1084188838 11:67489672-67489694 CAGAGAATGAGGAGACCGGGTGG - Intronic
1086087288 11:82968258-82968280 TACAGAATGGAGAAAATGGGGGG + Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1087185449 11:95187910-95187932 GTGAGGATGGAGAAAGTGGGTGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087471448 11:98580819-98580841 GAAAGAAAGAAGAAAGCGGGAGG + Intergenic
1090178426 11:124672950-124672972 CACAGTATGGAGAAAGCAGAAGG - Intronic
1090386721 11:126361609-126361631 CAGGGAGTGGAGAACGCAGGGGG - Intronic
1090420346 11:126571106-126571128 CAGAGAATGGAGACAGAGCATGG - Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1091261262 11:134236255-134236277 CAGAGAATGCAGCAACCGCGAGG + Intronic
1091438529 12:494497-494519 TAGAAAATGGAGGAAGAGGGAGG - Intronic
1094307557 12:29037703-29037725 ATGAGAATGGGGAAAGCGGGAGG - Intergenic
1096076045 12:48805549-48805571 CAGAGAAGGGAGACAGCAGGAGG - Intergenic
1097151054 12:56980178-56980200 GAGAGGATGGAGAAAGATGGTGG - Intergenic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1098183907 12:67876797-67876819 AAGAGAATGGAGAAAGGCAGAGG + Intergenic
1099195754 12:79613843-79613865 CAGAAAATGGACAAGGCCGGGGG + Intronic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1100205213 12:92341168-92341190 CAGAGACAGGAGCAAGCTGGTGG + Intergenic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101968339 12:109295813-109295835 GGGAGAGTGGAGGAAGCGGGTGG - Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102466806 12:113135059-113135081 CTGGGAGGGGAGAAAGCGGGGGG - Intronic
1105401321 13:20098697-20098719 GAGAGAATGGAGAAAGTGCAGGG + Intergenic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1107296477 13:38914480-38914502 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
1107406629 13:40120465-40120487 CAAAGAATGTAGAAACAGGGAGG + Intergenic
1108701962 13:52951291-52951313 CAGAGAATGAAGAAACCAGAAGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1109272383 13:60268775-60268797 CTGAGAATGGAAAAAGCATGGGG + Intergenic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1113246270 13:108399202-108399224 GAAAGAATGGAGAAAGTGGATGG + Intergenic
1113281019 13:108787894-108787916 CAGATGATGGAGATAGTGGGAGG - Intronic
1113498229 13:110750790-110750812 CAGAGAATGGAGAAATAGAAAGG - Intergenic
1114389342 14:22290064-22290086 CAGAGAATTGAGAGAGCTAGTGG - Intergenic
1114658021 14:24327706-24327728 CAGAGACAGGAGGAAGTGGGGGG + Intronic
1116380486 14:44261823-44261845 CAGAGAGGGGACAAAGAGGGTGG + Intergenic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118915350 14:70098335-70098357 TAGAGATTGGGGAAAGGGGGAGG - Intronic
1119031034 14:71192911-71192933 CACAGGATGGAGAAAGAGAGGGG + Intergenic
1119098413 14:71855913-71855935 CAGAGAATGAAGAAATTGGAAGG - Intergenic
1119104298 14:71909603-71909625 GAGAGAAAGGAGAGAGAGGGGGG + Intergenic
1119821117 14:77616773-77616795 CAGCGAAGGGAAAAAGCGGCGGG + Exonic
1120522751 14:85543822-85543844 CAGAGAAAGGAGTAACCAGGAGG - Intronic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1122584948 14:102799261-102799283 CAGAGAGTTGACACAGCGGGAGG + Intronic
1123057908 14:105580706-105580728 CAGAGATGGGAGAAAAAGGGAGG - Intergenic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1126781011 15:52139059-52139081 CAGGGATTGAAGAAAGCTGGAGG + Intronic
1128261100 15:66233641-66233663 CAGGGAATGGGGAAAGGGCGTGG - Intronic
1129268715 15:74408492-74408514 CAGAGAAGGGAACAAGGGGGAGG + Intergenic
1130519974 15:84654748-84654770 CAGAGAAGAGAGGAAGCGGCCGG + Intergenic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1130809393 15:87360574-87360596 AAGAGACTGGAGAAAAGGGGAGG - Intergenic
1131348845 15:91677936-91677958 CAGAGAGTAGAAAAAGAGGGAGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132371319 15:101301352-101301374 CAGAGGATGGAAAAAGGAGGTGG - Intronic
1133580514 16:7140205-7140227 CAGAAAATGGACAAATTGGGAGG - Intronic
1134335222 16:13292947-13292969 AAGAGAATGGAGAGAGCAGATGG + Intergenic
1135297996 16:21300193-21300215 CAGAGAATTGAGAAAGTGAGAGG - Intronic
1135375647 16:21944690-21944712 CAGAGAATTGAGAAAGTGAGAGG - Intergenic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1137253365 16:46756413-46756435 CAGAGAATGAAGAAATATGGAGG + Intronic
1137655513 16:50154534-50154556 GAGTGAATGGATAAAGGGGGGGG - Intronic
1137898389 16:52238259-52238281 CGTAGAATGGAGAAAGGAGGAGG + Intergenic
1140345521 16:74209328-74209350 AAGAAAATGGAGGAAGAGGGAGG + Intergenic
1141238949 16:82246743-82246765 CAGAGAATGTAGAATGGAGGAGG + Intergenic
1142189186 16:88709781-88709803 CAGAGACTGGTGAAAGGGGCGGG - Intronic
1142405291 16:89885117-89885139 AAGAGAATGGAGAGAGCGTCAGG - Intronic
1142442340 16:90106905-90106927 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
1142713674 17:1736706-1736728 CTGAGAATGGAGGGAGGGGGAGG - Intronic
1143998677 17:11032316-11032338 GAGAGAAAGGAGAAACGGGGTGG - Intergenic
1144315974 17:14061966-14061988 CAGAAAAAGGAAAAAGCAGGAGG - Intergenic
1145296396 17:21595965-21595987 GAGAGAAGGGAGAAAAGGGGAGG + Intergenic
1146566807 17:33920553-33920575 CAGAGAAGGGAGACAGGGAGGGG + Intronic
1146936469 17:36815353-36815375 CAGAGACTGCGGAAAGCGAGGGG + Intergenic
1147133637 17:38422935-38422957 CAGAGAAAGGAGGGAGAGGGTGG - Intergenic
1147630971 17:41931337-41931359 CAGAGAATGGAGATTGCAAGTGG - Intronic
1147643256 17:42017906-42017928 CAGAGAACGATGAAAGCTGGGGG - Intronic
1147805776 17:43129992-43130014 CAAAGAATGGAGAAAACTGGGGG + Intergenic
1147811433 17:43172679-43172701 CAAAGAATGGAGAAAATTGGGGG + Intronic
1149040061 17:52177318-52177340 CATAGACTAGAGAAAGCGGTTGG + Intergenic
1149807134 17:59629158-59629180 CAGAGACTGGAGAAAGAGATGGG - Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1152268616 17:79310650-79310672 CAGAGGCTGGGGAATGCGGGAGG - Intronic
1153119049 18:1699248-1699270 CAGAGAAGGCAGAAAACGGTGGG - Intergenic
1153532439 18:6061696-6061718 CAGAGAAGGGAGAAAAAGAGAGG - Intronic
1155685074 18:28538550-28538572 CATAGAAGGGACAAAGTGGGAGG - Intergenic
1155845415 18:30699514-30699536 CAGAGAATGCTGGAAGAGGGGGG + Intergenic
1156379566 18:36545437-36545459 CAAAGAATGGAGCCAGCTGGAGG + Intronic
1156487012 18:37472765-37472787 CAGAGAAGGGAGAAATTGGGAGG + Intronic
1156653254 18:39252346-39252368 GAGAGATTGGAGAAGGTGGGGGG - Intergenic
1157017619 18:43736343-43736365 CAGAGAATTAAGATAGCTGGTGG + Intergenic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1157678416 18:49584562-49584584 CAGAGGAGGGACAAAGAGGGAGG - Intronic
1158428726 18:57363828-57363850 GAGAAAATGGAGAAACAGGGAGG + Exonic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159954270 18:74508181-74508203 CAGAGGATGGAGGAGGCGTGGGG + Intronic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1162791205 19:13064011-13064033 CTGGAAATAGAGAAAGCGGGTGG + Intronic
1164563968 19:29312670-29312692 CAGAGAATGCACAAAGGGGCAGG + Intergenic
1164891514 19:31827595-31827617 AAGAGAATAGAGAAACCGGAGGG - Intergenic
1165454112 19:35900765-35900787 AAGAGGAGGGAGAAACCGGGGGG + Intronic
1165933053 19:39372761-39372783 CTGAGAAGGGAGAAAGAAGGAGG + Intronic
1167353138 19:48988135-48988157 CAGAGAAAGGAGGCAGCGAGTGG - Intronic
1167695693 19:51014605-51014627 CAGAGAATGGGGATAGGTGGGGG + Exonic
1168675486 19:58275030-58275052 CAAATAAGGGAGAAAGGGGGTGG + Intronic
1168691889 19:58382283-58382305 CAAAGGATGGAGAAAGGGAGTGG - Intergenic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925635743 2:5940367-5940389 AATAGAATGGAGAAGGCTGGAGG - Intergenic
925870425 2:8265327-8265349 CAGAGAAAGGAGAGAGCTTGGGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927164723 2:20306498-20306520 CAAACAAGGGATAAAGCGGGTGG + Intronic
928156049 2:28877845-28877867 CAGAGATTGGAGAGAGGGGCAGG + Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929827629 2:45321705-45321727 GAGAGAAGGGAGAAAGCAGATGG + Intergenic
929877348 2:45807860-45807882 GAGAGAAAGTAGAAATCGGGTGG - Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
933012736 2:77088551-77088573 CAGCGAATGGAGATAGGGGTGGG - Intronic
933449934 2:82435780-82435802 CTTACAATGGAGAAACCGGGAGG - Intergenic
933982938 2:87568419-87568441 GAGGGAAAGGAGAAAGAGGGAGG - Intergenic
934619485 2:95795430-95795452 AAGAGAAGGTAGACAGCGGGGGG - Intergenic
934641405 2:96029127-96029149 AAGAGAAGGTAGACAGCGGGGGG + Intronic
934724525 2:96607087-96607109 CAGAGAAGGGAGAAAAAGAGAGG + Intronic
934816042 2:97327318-97327340 CAGAGAATTGGAAAAGCAGGAGG + Intergenic
934821654 2:97381166-97381188 CAGAGAATTGGAAAAGCAGGAGG - Intergenic
935021476 2:99236710-99236732 AAGAGAATGGAGAAAGGCAGAGG + Intronic
935302909 2:101709023-101709045 CACAGAAGGGAGAAAGGAGGGGG + Intronic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
936041892 2:109156122-109156144 CAGACAATGCAGAAATTGGGAGG - Intronic
936310903 2:111382376-111382398 GAGGGAAAGGAGAAAGAGGGAGG + Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936646778 2:114381277-114381299 AAGAGAATGGAGAAATCATGAGG + Intergenic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937964393 2:127491388-127491410 GAGAGCATGGAGAAAGAGAGGGG - Intronic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938241980 2:129749233-129749255 CAGAGAATTCAGAATGTGGGTGG + Intergenic
939290890 2:140193628-140193650 TAGAGAATGGGGAAAGTAGGGGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
941704266 2:168641182-168641204 CAGAGAAGGGTGAAATGGGGCGG - Intronic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
942963799 2:181864957-181864979 CAAAGAATGCAGAAAGCAGAGGG + Intergenic
944251983 2:197587602-197587624 CAGCGAAGGGAGAAAGGGGTAGG - Intronic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946166742 2:217869147-217869169 CAGAGAGTGGACCAAGAGGGAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946416166 2:219540807-219540829 CAGAGAATGTAGAAACAGGCAGG + Intronic
946444588 2:219727377-219727399 TAGGGAGTGGAGAAAGCTGGAGG + Intergenic
946677464 2:222177078-222177100 CACAGGATGGAGACAGCAGGAGG - Intergenic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947285169 2:228506166-228506188 CAGAAAGTGGACAAAGTGGGTGG + Intergenic
947348358 2:229217475-229217497 CAGAAAATGGAGAGAGATGGAGG + Intronic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948109824 2:235445479-235445501 CAGAGCATGGAGGAAACAGGTGG - Intergenic
948381998 2:237557130-237557152 GAGAGAACGGAGAGAGCGGGAGG - Intergenic
948859718 2:240746911-240746933 CAGAGAAGGGAGACAGGGTGGGG + Intronic
1169252688 20:4072429-4072451 CATAGGATGGAGAAACCTGGAGG + Intronic
1169994193 20:11538204-11538226 CAAATAATGGAGAAAACGTGGGG - Intergenic
1170042199 20:12050740-12050762 CAGAGGGTGGAGTAAGAGGGAGG - Intergenic
1170226003 20:13992565-13992587 CAGAGACTGGGGAATGGGGGTGG + Intronic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1171144944 20:22773592-22773614 CTGAGAATGGAGAAATCTGGAGG + Intergenic
1172113935 20:32562921-32562943 GAGAGAGTGGAGAAGGAGGGTGG + Intronic
1172795418 20:37533815-37533837 CAGAGAATGGAGTAAGCTCCAGG + Intergenic
1173182211 20:40814036-40814058 AAGAGAAAGAGGAAAGCGGGAGG - Intergenic
1173201302 20:40957203-40957225 GAGAGAAGGGAGAAAGGGGTAGG + Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173905592 20:46626346-46626368 GAGAGACAGGAGAAAGAGGGAGG - Intronic
1174414272 20:50356838-50356860 CTGAGAGGGGAGCAAGCGGGAGG + Intergenic
1175087690 20:56473955-56473977 CAGGGAATGGAGAATACTGGAGG + Intronic
1175267344 20:57710417-57710439 GAGAAATTGGAGAAAGGGGGAGG + Intronic
1175496161 20:59415744-59415766 CACAGGATGGAGAGAGCAGGTGG + Intergenic
1176243307 20:64084911-64084933 CAGAGAAGGCAGCAAGCAGGGGG - Intronic
1176293859 21:5060235-5060257 CAGACGCTGGAGAAGGCGGGAGG - Intergenic
1176513724 21:7767545-7767567 GAGAGAAGGGAGAAAGGAGGGGG - Intronic
1176719115 21:10379081-10379103 CAGAGAGGGGAGAGAGAGGGGGG - Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1177609370 21:23424990-23425012 CAGAGAATGGCAAAAGCAGGTGG - Intergenic
1178115520 21:29412580-29412602 CAGAGAATGTAGACAGTGAGAGG - Intronic
1178502053 21:33133801-33133823 CAGAGAATGGAGTGAAGGGGTGG + Intergenic
1178647837 21:34398069-34398091 GAGAGAAGGGAGAAAGGAGGGGG - Intronic
1178664479 21:34534413-34534435 CAGACTATGGTGACAGCGGGAGG - Intronic
1179010205 21:37550810-37550832 CTGAGAGGGGAGAAAGCTGGGGG + Intergenic
1179863400 21:44203413-44203435 CAGACGCTGGAGAAGGCGGGAGG + Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1181335752 22:22126389-22126411 CAGAGACTGCAGAAAGGTGGGGG - Intergenic
1181438699 22:22924804-22924826 CAGGGCATGGAGAAAGGGAGAGG - Intergenic
1183680613 22:39326893-39326915 AGGAGAATGGAGGAAGCAGGAGG + Intergenic
1183731152 22:39619284-39619306 CAGAGAAAGGAGAGAGAGTGAGG - Intronic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1184014199 22:41773325-41773347 CAGAAAATGGAGAAAACATGAGG + Intronic
1184093374 22:42303911-42303933 GAGAGAATGGAGAAAGGGGAAGG + Intronic
1184533295 22:45070529-45070551 CAGAGAAAGGAGACAGCAGAGGG + Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
950193242 3:10992424-10992446 AAGAGAGGGGAGAAAGAGGGAGG + Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953639015 3:44688245-44688267 CAAATAAGGGAGAAAGGGGGTGG - Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956919697 3:73913924-73913946 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
958703194 3:97619419-97619441 CAGACAATAGAAAAAGGGGGGGG + Intronic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
959130117 3:102344535-102344557 CAGTGAATAGAGAAAGCATGAGG + Intronic
960765379 3:121123202-121123224 CAGAGAATGGAAAAAGCACTGGG + Intronic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961154862 3:124671023-124671045 CACAGAATGGTAAAAGCGAGAGG - Intronic
961453859 3:127014845-127014867 CAGAGAATAGGGAGAGAGGGAGG - Intronic
962372010 3:134828621-134828643 CAGAGAATGGAAATAGCGCTAGG - Intronic
962405240 3:135094666-135094688 CAGAGAAGAGGGAAAGCAGGAGG - Intronic
963520940 3:146359340-146359362 CAGAGAAGGGAGATAGAGGTGGG - Intergenic
965297209 3:166963688-166963710 CAGAGACTGGGGAAAGTAGGAGG - Intergenic
965575031 3:170209393-170209415 AAGAGAATGGCGAACCCGGGAGG - Intergenic
965624363 3:170672278-170672300 CAGAGAAGGGAGATAGAGGTGGG + Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
966006421 3:175018991-175019013 CACAAAATGAAGAAAGCAGGAGG - Intronic
966275086 3:178155822-178155844 CACTGAAGGGAGAAAGCGGAGGG + Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966490467 3:180522482-180522504 CAGAGAATGGGGAGGGCGGGAGG + Intergenic
966862374 3:184237491-184237513 CAGAGAATGGAAAAAGGGTTTGG - Intronic
967657634 3:192071210-192071232 CAGCGAAGGGAGATAGGGGGTGG + Intergenic
968037759 3:195562520-195562542 CGGAGAGTGGAGAGAGAGGGCGG - Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968362612 3:198157869-198157891 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
969307735 4:6335456-6335478 CAGAGAAAGGAGTGAGCAGGGGG + Intronic
970582087 4:17482786-17482808 CAGAGAATGGAGCAAACAGAGGG - Intronic
971057940 4:22934750-22934772 AGGAGAATGGAGATAACGGGTGG + Intergenic
971407090 4:26331758-26331780 CAGAGACTGGAGTAAGCCAGAGG - Intronic
971623131 4:28882878-28882900 CAAAGAATGGAGGAAAAGGGTGG + Intergenic
972053691 4:34773461-34773483 CAGCGAAGGGAGATAGCGAGGGG + Intergenic
972436058 4:39036560-39036582 CAGAGGCTGGAGACAGAGGGAGG + Intergenic
973146230 4:46830843-46830865 CAAAGTATGGAGAAAGTGAGAGG + Intronic
973196373 4:47447413-47447435 CTGAGAATGAACAAAGCTGGAGG + Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975835638 4:78419827-78419849 CAGAGCAGGAGGAAAGCGGGTGG + Intronic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
979443263 4:120778093-120778115 AAGAGATTGGAGAAAAGGGGAGG + Intronic
980491149 4:133531434-133531456 CAGAGAAGGGAGATAGAGGTGGG + Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
982612695 4:157596685-157596707 CAGCGAAGGGAGAAAGGGGTGGG + Intergenic
982989084 4:162247394-162247416 CAGATAATTAAGAAAGTGGGTGG - Intergenic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
985393120 4:189513029-189513051 CAGAGAATGCAGGAAGGAGGAGG + Intergenic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
985983021 5:3488133-3488155 CAGAGAGGGGAGGAAGGGGGAGG + Intergenic
986031152 5:3893663-3893685 CATATAATGGAGAAAGCTGAAGG - Intergenic
986225326 5:5806873-5806895 CAAAAAATGCAGAAAGCTGGAGG - Intergenic
986253326 5:6081275-6081297 CAGAGAATGGAGAGGCTGGGAGG - Intergenic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988166643 5:27598842-27598864 AAGATAATGGAGAATGCTGGTGG + Intergenic
989270474 5:39527097-39527119 CGGAGAAAGGAGAGAGAGGGTGG + Intergenic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
993805204 5:92399303-92399325 CAGAGAATGGAGGAAGGGAATGG + Intergenic
994769917 5:103967837-103967859 AAAAGAATGGAGAAAGCCTGTGG - Intergenic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
996783425 5:127213236-127213258 TAGAGAATGGAGAGAGGGAGGGG - Intergenic
997533892 5:134600651-134600673 AAGAGAAGAGAGAAAGAGGGAGG + Intergenic
998810530 5:145961965-145961987 CTGGGAATGAAGAAAGCGGTAGG - Intronic
998819246 5:146043168-146043190 CAGAGAAGAGAGAAACTGGGTGG - Intronic
998961031 5:147487221-147487243 CAAAGACAGGAGAAAGGGGGAGG - Intronic
999827309 5:155286169-155286191 GAGAGAATGGAAGAAGGGGGAGG - Intergenic
1001641873 5:173250128-173250150 CAGAGACTGGGGAAACCTGGGGG + Intergenic
1002683761 5:180990789-180990811 CAGAGAGTGAAGCCAGCGGGAGG + Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1004570268 6:16838221-16838243 GAGATAATGGAGAAAGGGTGGGG - Intergenic
1006315218 6:33287490-33287512 CTCAGAATGGAGAAACCTGGGGG + Exonic
1006592145 6:35166187-35166209 CAGAGAATGGGGGAAGAGGGAGG + Intergenic
1007032674 6:38642219-38642241 CAGGTAATGGAGAAAGCTGCAGG - Intergenic
1007496056 6:42260947-42260969 CAGAGAGTGGGGAAAGGAGGAGG + Intronic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1009464913 6:63956398-63956420 CAGAGAAGGGAGATAGAGGTGGG - Intronic
1011255223 6:85413919-85413941 AAGAGAATGGAGAAAAAGGAGGG + Intergenic
1011325158 6:86142647-86142669 CAGAGGTTGGAGAAAGAGGGAGG + Intergenic
1013308757 6:108873811-108873833 GAGAGAGTGGAGAAAGCTTGAGG - Intronic
1016204371 6:141453980-141454002 CAGAAAATTGAGAAAGGGGTCGG - Intergenic
1016454244 6:144215071-144215093 CATACAATGGAGATGGCGGGTGG + Intergenic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1019253069 7:30838-30860 CAGAGAAGGGAGAAACCCTGAGG - Intergenic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019825231 7:3279175-3279197 CTGAGAAGGGAGAAAGAGAGGGG + Intergenic
1019923079 7:4175039-4175061 CAGGGATGGCAGAAAGCGGGAGG - Intronic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1020685189 7:11285851-11285873 AAGGGAATAGAGAAAGAGGGAGG - Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022480163 7:30738312-30738334 TAGTGAATGGAGAAAGAGAGGGG + Intronic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023528314 7:41128256-41128278 CAGAGAATGATGAAGGCTGGAGG - Intergenic
1023644685 7:42297859-42297881 CAGAGTGTGGAGGAAGTGGGTGG - Intergenic
1025250157 7:57346537-57346559 CAGTGAATGGAGAGAGAGGTAGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026930194 7:74219557-74219579 CAGAGAATGGGGATAGCATGGGG + Intronic
1028114291 7:86980445-86980467 TAAAGACTGCAGAAAGCGGGTGG - Intronic
1029488950 7:100860001-100860023 CAGGGCATGGAGGATGCGGGAGG - Exonic
1029657230 7:101935311-101935333 CAGCGAAGGGAGAAAGGGGTGGG - Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1030798524 7:113819522-113819544 CAAAGAATGGAAAAAGGGGCAGG + Intergenic
1030916338 7:115318572-115318594 GAGAGAATGAAGAATGCAGGAGG - Intergenic
1031186800 7:118491978-118492000 TAGAGAATAGAGAAAACAGGAGG - Intergenic
1031577414 7:123431828-123431850 CAGAGAATGGTGAGAGTAGGGGG + Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1031973554 7:128080185-128080207 CAGAGAATGGATCACGCGTGGGG - Intronic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1036129681 8:6097565-6097587 CAGGGAAGGGAGAAAGAGAGAGG + Intergenic
1036530013 8:9576428-9576450 GAGAGACAGCAGAAAGCGGGAGG + Intronic
1037638545 8:20722163-20722185 GAGACAAAGCAGAAAGCGGGAGG + Intergenic
1037808565 8:22072327-22072349 GACAGAATGGAGGAAGCGGAAGG + Exonic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1041051746 8:53941037-53941059 CAGAGAAAGGAGGGAGCGGAAGG - Intronic
1041749470 8:61244140-61244162 CAGAGGATGGAGACAGTAGGGGG + Intronic
1042848489 8:73191975-73191997 CACAGGATGGAGGAAGCGGAAGG - Intergenic
1043332695 8:79137270-79137292 CAGAGAAAGCATAAAGCTGGTGG - Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043363283 8:79500165-79500187 CAGAGAATGAAGAAAAGCGGGGG - Intergenic
1046366090 8:113234985-113235007 CAGAGAATGTATAAATGGGGTGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1049502523 8:142974948-142974970 CAGAGAATGGAAAAAGCATGGGG + Intergenic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050099191 9:2100113-2100135 CAGAAAAGGGAGACAGCCGGTGG + Intronic
1050758353 9:9035562-9035584 CAGAGGAGAGAGGAAGCGGGTGG - Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051338618 9:16090959-16090981 AAGAAAATGAAGAAAGAGGGTGG - Intergenic
1051409848 9:16778100-16778122 CAGAAAATAGAGAAAAGGGGAGG - Intronic
1052282882 9:26753141-26753163 CAGAGAATGGTGAAGGGGAGTGG - Intergenic
1053144430 9:35702926-35702948 TAGTGACTGGAGAAAGTGGGAGG + Intronic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1055659215 9:78485357-78485379 CAGAGCAGGGAGAAAACAGGAGG - Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1059255101 9:112922997-112923019 CAGAGACTGGTGATAGAGGGAGG - Intergenic
1059806191 9:117803070-117803092 GAGAGGATGGAGAAAGATGGAGG + Intergenic
1060931623 9:127492696-127492718 CAGAGAACCGAGTGAGCGGGAGG + Intronic
1061033183 9:128099135-128099157 CTGAGAGTCGAGAAGGCGGGAGG - Intronic
1062378740 9:136276654-136276676 CAGAGAATCCAGAAAGCTGGAGG + Intergenic
1062589682 9:137267938-137267960 CAGAGAATGGAGCAAAGGGGAGG + Intronic
1062747300 9:138221528-138221550 CAGAGAAGGGAGAAACCCTGAGG + Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186122959 X:6383157-6383179 CAGACACTGGAGAAAGGGAGAGG - Intergenic
1186168248 X:6849735-6849757 CATAGAAAGGAGGAAGCGGATGG + Intergenic
1186897337 X:14017156-14017178 CAAAGAATGGTGAAGGCAGGGGG + Intronic
1187097726 X:16165112-16165134 GAGAGAAAGGAGAGAGGGGGTGG - Intergenic
1187809481 X:23159295-23159317 CGGAGAATGGTGAACCCGGGAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188987766 X:36783136-36783158 CAGTGAGTGGAGGAAGCAGGCGG + Intergenic
1189316974 X:40063387-40063409 CAGAGACTGGAGACAGCCTGAGG + Intronic
1189322730 X:40096385-40096407 GAGAGGAGGGGGAAAGCGGGAGG + Intronic
1189449893 X:41119201-41119223 GAGAGAATGGACAAAGTGGAAGG + Intronic
1190440100 X:50468737-50468759 TATAGAATGTAGAATGCGGGAGG - Intronic
1190713586 X:53086558-53086580 CAGAGATAGGAGACAGTGGGTGG + Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1193018605 X:76764570-76764592 CAGAGAATGGAAAAGGTGAGTGG + Intergenic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1195327154 X:103767032-103767054 CAGAGAAGGGAGACAGGGGTGGG + Intergenic
1196499193 X:116359155-116359177 CAGAGACTGGAGAAAGGTAGTGG - Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1197846941 X:130813432-130813454 AAGAAAATGAAGAAAGGGGGTGG + Intronic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1199288360 X:146078536-146078558 TAGAGAAAGGAGAAAGAAGGTGG + Intergenic
1199541799 X:148966031-148966053 GAGAGGATGGAGAAAGGAGGTGG - Intronic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1199876367 X:151932114-151932136 CAGAGAATGGAGAGTTTGGGAGG - Intergenic
1200180971 X:154150513-154150535 CTGAGGATGGACAAAGCTGGAGG + Intronic
1200186614 X:154187627-154187649 CTGAGGATGGACAAAGCTGGAGG + Intergenic
1200192266 X:154224765-154224787 CTGAGGATGGACAAAGCTGGAGG + Intronic
1200198021 X:154262569-154262591 CTGAGGATGGACAAAGCTGGAGG + Intronic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic