ID: 906157482

View in Genome Browser
Species Human (GRCh38)
Location 1:43622224-43622246
Sequence AGGTGGGTCTGGTGGACAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906157482 Original CRISPR AGGTGGGTCTGGTGGACAGA AGG (reversed) Exonic
900076195 1:819910-819932 GGGTGGATCTGCTCGACAGAGGG - Intergenic
900177897 1:1298819-1298841 AAGTGGCTGTGGTGAACAGAGGG - Intronic
900212289 1:1462058-1462080 ATTTGGGTCAGGTGCACAGAAGG - Intronic
900224964 1:1528709-1528731 ATTTGGGTCAGGTGCACAGAAGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
902753489 1:18533903-18533925 AGGAGGGGCGGGGGGACAGATGG - Intergenic
903178626 1:21594663-21594685 AGGTGGGGCAGGAGGAGAGAGGG + Intergenic
903214107 1:21833675-21833697 AGGTGGGCCTGAGGCACAGATGG - Intronic
904262523 1:29297898-29297920 AGATGGGTATGGTTGACTGATGG + Intronic
904606448 1:31700457-31700479 AGGTGGCTCTCGAGCACAGATGG + Intronic
906087061 1:43144947-43144969 AGCTTGGCCTGGTGGACACACGG + Intergenic
906148456 1:43573707-43573729 AGATGGGTGTGGGGGACTGAAGG - Intronic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906572653 1:46857438-46857460 AGGTGGGTCTGGCGGATATGAGG + Intergenic
906599122 1:47108453-47108475 AGGTGGGTCTGGCGGATATGAGG - Intronic
907272340 1:53298358-53298380 AGGTGGGTATGGGGGAGAGGTGG + Intronic
907838773 1:58136378-58136400 ACATGGGGCTGGTGGACACAGGG - Intronic
908100664 1:60787811-60787833 AGGTGTGTCTGGTTAACAGTAGG + Intergenic
908748640 1:67399035-67399057 AGGTAGCTCAGGTGAACAGAGGG + Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
912861497 1:113217865-113217887 GGGAGTGTCTGGTGGAGAGAAGG - Intergenic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
914747418 1:150510497-150510519 AGGTGGGTCTACTGGGTAGAAGG - Intronic
916076067 1:161200630-161200652 AGGTGGGTCTGGCAGTCACAAGG - Intronic
916502013 1:165395489-165395511 AGGTGTGTGTGATGTACAGAAGG + Intergenic
917112291 1:171561024-171561046 AGGTGGCTGTGGTGGACTAATGG - Exonic
917317571 1:173741371-173741393 AGGTCATCCTGGTGGACAGAAGG - Intronic
917789588 1:178491029-178491051 GGATGGGCCTGGTGGACAGGAGG + Intergenic
917930430 1:179818894-179818916 AGGGGGAACTGGTGGAGAGAGGG - Intergenic
918703351 1:187632313-187632335 AGGTGGGTCTGGCATGCAGATGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922570950 1:226634406-226634428 AGGTGGGTCAGGTGTAGAGCTGG - Exonic
924858444 1:247897505-247897527 AGGAGCGTCTGGTACACAGAAGG - Intergenic
1063599237 10:7464970-7464992 TGGGGGGTTTGGTGGAGAGAGGG - Intergenic
1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG + Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067051729 10:43025336-43025358 AAGTTGGTCTGGTTGACAGCAGG + Intergenic
1067086457 10:43243013-43243035 AGATGGGTCGGGCGGGCAGAGGG - Intronic
1067410598 10:46060863-46060885 AAGAGGGTGTGGGGGACAGAGGG - Intergenic
1070055944 10:72934694-72934716 AGGTGATTCTGCTGCACAGAAGG - Intergenic
1070311410 10:75276311-75276333 AGGTGGGCCTGGGGGAAGGAAGG + Intergenic
1070650078 10:78228954-78228976 AGGAGGGAGAGGTGGACAGAAGG - Intergenic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1071860870 10:89671287-89671309 AGGGGGGTGGGGTGGAGAGAGGG + Intergenic
1073006755 10:100330508-100330530 AGATGTGCCTGGTGGAGAGATGG + Intergenic
1075643480 10:124082194-124082216 AGGTGGGTTGGGTGAACAGATGG - Intronic
1076188070 10:128464282-128464304 AGGAGGGTTTGGTGGAGAGAAGG + Intergenic
1076597294 10:131631941-131631963 AGGTGGCTGTGGTGGCCAGCAGG + Intergenic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1076870368 10:133189876-133189898 ATGGGGGGCTGCTGGACAGATGG - Intronic
1077199020 11:1296371-1296393 AAGTGGCAGTGGTGGACAGAGGG - Intronic
1077213242 11:1383104-1383126 AGGTGGCACGGGTGGGCAGACGG - Intergenic
1077577334 11:3394471-3394493 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
1077674685 11:4185694-4185716 CGGTGGTTATGATGGACAGATGG + Intergenic
1077907493 11:6545626-6545648 AGGCTGGTCTGGCGGACAGAAGG - Exonic
1078539369 11:12200859-12200881 GGTCGGGCCTGGTGGACAGAAGG + Intronic
1079551319 11:21702295-21702317 GGGTGGGTCTGTTGGAGGGATGG - Intergenic
1080203159 11:29697675-29697697 AGGTGAGTCTCTTGGACAGCAGG + Intergenic
1080897636 11:36459535-36459557 AGCTGGGACTGGAGCACAGATGG - Intronic
1081632988 11:44701938-44701960 AGGTAGATGTGGTGGGCAGAAGG - Intergenic
1081706907 11:45187580-45187602 AGGTGGGACTGGTGGCCTGGAGG + Intronic
1083551429 11:63593045-63593067 AGGTGTGTGTGGTAGATAGAGGG - Intronic
1083581752 11:63829445-63829467 AGACAGGTGTGGTGGACAGAAGG + Intergenic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084447574 11:69212688-69212710 AGGTGGGCCTGGTGGCAAGGTGG - Intergenic
1084749484 11:71194776-71194798 AGCAGGGACTGGTGGACAGCAGG + Intronic
1084846018 11:71900441-71900463 AGGAGAGTGTGGTGGACAGATGG + Intronic
1085745861 11:79113693-79113715 AGGTGTGTGTGGTGGACATTGGG + Intronic
1087621450 11:100547419-100547441 AGGTGAGGCTGGTGCACAAATGG + Intergenic
1088906734 11:114160836-114160858 AGGTGGTTTTGGGGGTCAGAAGG + Intronic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090804936 11:130196979-130197001 AGGTGGGCCTGAGGGACAGATGG - Intronic
1091310897 11:134574525-134574547 AGGTGGGCCTGGTTGCTAGAGGG + Intergenic
1091771214 12:3152398-3152420 AGGTGTGTCAGAAGGACAGAAGG - Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1091918639 12:4287101-4287123 AGGAGGGGCGGGTGGACAGCAGG + Intronic
1092051700 12:5475373-5475395 AGGTGGGGATGATGGACATAGGG + Intronic
1092424769 12:8366027-8366049 AGGTGGGTGTGGTTGAAAGCAGG - Intergenic
1092428447 12:8391406-8391428 AGGTGTGGTGGGTGGACAGATGG + Intergenic
1092429530 12:8397558-8397580 AGGTGTGGTGGGTGGACAGATGG + Intergenic
1092880902 12:12887179-12887201 AGCTCAGTCTGGTGGAGAGATGG - Intergenic
1093366598 12:18307591-18307613 AGGTGGGTAGTGTGGAGAGAAGG - Intronic
1095773013 12:45983227-45983249 AGGTGGCAGTGGTGGAGAGATGG + Intronic
1095808092 12:46343252-46343274 TGGTGGTGCTGGTGGACACAGGG - Intergenic
1095885894 12:47188073-47188095 AGGTATGTCTGGGGAACAGAAGG - Intronic
1096259785 12:50083310-50083332 AGGAGTGTCTGGTGGAGGGAGGG - Exonic
1097146223 12:56941174-56941196 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1097151940 12:56985651-56985673 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1098322305 12:69258614-69258636 AGGTGGGCCTGGAGGACCTAAGG - Exonic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1101471974 12:105006064-105006086 AGGTGGGGCAGGTGGAGTGAAGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103171288 12:118822382-118822404 AGGTGGGGATGCTGGACAAAGGG + Intergenic
1104117899 12:125767259-125767281 AGGTGACTCTGTTGGACTGAAGG + Intergenic
1107842329 13:44471911-44471933 ATGTGGATCTGCTGGACAAAGGG - Intronic
1108287153 13:48919793-48919815 AGGTGGGGTTGGGGGACAGTGGG + Intergenic
1108683318 13:52798030-52798052 AGGTGGGGTAGGTGGACAGTGGG - Intergenic
1108934298 13:55866919-55866941 AGGTGATTCTGGAGGTCAGAGGG - Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1110450641 13:75635672-75635694 AGGTGGGTGCGGTGGAAGGAGGG - Intronic
1113868354 13:113543399-113543421 AGGTGGGGGTCATGGACAGAGGG - Intronic
1113935113 13:113989771-113989793 GGATGGGTGTGCTGGACAGATGG - Intronic
1116990123 14:51267203-51267225 AGGTGTGTGTGGTGAACAAAAGG - Intergenic
1117247131 14:53897361-53897383 AGGTGGGCCAGGAGAACAGAGGG + Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1121414762 14:93771774-93771796 AGGGGAGGCTGGTGGACAGAAGG + Intronic
1122505147 14:102227354-102227376 AGGGAGGGCTGGGGGACAGAAGG - Intronic
1122961237 14:105094413-105094435 ACCTGGGCCTGGGGGACAGAGGG - Intergenic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1123663238 15:22585009-22585031 AGGACGGGCTCGTGGACAGAGGG + Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124034518 15:26042455-26042477 AGGTGGGTGTGGTGGGTATAGGG + Intergenic
1124259337 15:28174436-28174458 AGGACGGGCTCGTGGACAGAGGG + Exonic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124317067 15:28679447-28679469 AGGACGGGCTCGTGGACAGAGGG + Intergenic
1124566380 15:30818038-30818060 AGGACGGGCTCGTGGACAGAGGG - Intergenic
1126850944 15:52796394-52796416 AGGTGGGGCTGCGGGGCAGATGG + Intergenic
1127234905 15:57038435-57038457 AGGTGGGGGTGGTGGAGAGAAGG + Intronic
1127329737 15:57927121-57927143 AGGTGGTTCTGATATACAGATGG + Intergenic
1128763939 15:70239498-70239520 AGGGGTATCTGGTGGATAGATGG - Intergenic
1128845390 15:70890297-70890319 AGGTGGTGATGGTGGACAGATGG + Intronic
1129109235 15:73328063-73328085 AGGTGGGTTTGTTAAACAGATGG + Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130895374 15:88166352-88166374 AGGTGCATGTGGTGGACAGGTGG - Intronic
1131667629 15:94587173-94587195 AGGTGGGGCTGTTGGCCAGAGGG - Intergenic
1132866003 16:2093086-2093108 AGGAGGCTCTGGTGGACGGGGGG + Exonic
1135389103 16:22074081-22074103 AGGTGGGGCTGCTGGAAGGAGGG - Intronic
1136371179 16:29837030-29837052 ACGTGCGTCTGGAGGAGAGAAGG - Intronic
1136518916 16:30784098-30784120 GGGGGGTTCTGGGGGACAGAGGG + Exonic
1137997436 16:53233672-53233694 AGGTGGGGCTGGTCACCAGAAGG - Intronic
1138354022 16:56363396-56363418 AGGTGTGTCCTGTGGATAGAGGG - Intronic
1140453817 16:75092945-75092967 AGATGGGTCTGGTGGACAATGGG - Intronic
1140457451 16:75113509-75113531 AGCTGGGGCTGGGGTACAGATGG - Intronic
1140818773 16:78644299-78644321 AGGTAGTGCTGGTGGACAGATGG + Intronic
1140980413 16:80103791-80103813 GGGTGGGGGTGGTGGACGGATGG - Intergenic
1142122121 16:88391631-88391653 AGGTGGGGCCGGGGGACAGGAGG + Intergenic
1142164809 16:88580600-88580622 AGGTGGGCTTGGTGGAGATACGG - Intronic
1142427539 16:90008692-90008714 AGGTGTGTGTGGTGGGCTGAGGG - Intronic
1143432113 17:6894882-6894904 AGGTGGGGCTCCTGGAAAGATGG + Intronic
1143465530 17:7133949-7133971 AGGTGGATGGGGTGGCCAGAAGG + Intergenic
1143624772 17:8103513-8103535 AGTTGGGTCAGTTGGCCAGAAGG + Intronic
1143836649 17:9698409-9698431 AGGATGCTCTGGAGGACAGATGG - Intronic
1143970531 17:10792096-10792118 AGGTGGGCCTGGGGAACAGTAGG + Intergenic
1145208378 17:20996403-20996425 AGGTGGGCCTGGTGGAAATGGGG + Intergenic
1146001415 17:29132835-29132857 GGGAGGGACTGGTGGACAGAGGG + Intronic
1146651607 17:34610279-34610301 AGCAGGGTCTGGTGCAGAGAAGG + Intronic
1146890981 17:36506435-36506457 AGGTGGGTCTGATGTGCTGATGG - Exonic
1147331179 17:39700310-39700332 AGGTGGGTCTGGTGTGGGGAGGG + Exonic
1148164892 17:45476554-45476576 AGGGGGTTCTGGTGCACAGCTGG - Intronic
1148743026 17:49903515-49903537 AGGAGGGTCTGGGAGACAGATGG - Intergenic
1148876868 17:50693060-50693082 AGGAGGCTCAGGTGGAGAGAGGG + Intergenic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1152205571 17:78972764-78972786 AGGTGGCTGTGTTGGACAGTTGG - Intronic
1153485870 18:5597180-5597202 AGGAGGGTCTGGTGGCATGAGGG - Intronic
1153795885 18:8621685-8621707 ATGGGGGTTTGGTGTACAGATGG + Intronic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1160956376 19:1694036-1694058 AGATGGGCCTGGTAGACAGCAGG - Intergenic
1161091743 19:2363672-2363694 AGGTGAGCCTGGGGGACCGAGGG - Intergenic
1161398782 19:4058663-4058685 AGGAGGGTCTGGTGGCCCGGAGG - Intronic
1163580526 19:18136038-18136060 AGCTGGGTCTGGTGCCCATATGG + Intronic
1164078667 19:21843844-21843866 AGGTGAATCTGGTCCACAGATGG - Intronic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1165365130 19:35360542-35360564 GGGTGGGACTGGTGGATGGAAGG + Intergenic
1165366948 19:35373010-35373032 GGGTGGGACTGGTGGATGGAAGG + Intergenic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166781759 19:45346822-45346844 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1166781775 19:45346880-45346902 AGGAGGGTCTGGGGGACTGTGGG - Intronic
1167402984 19:49285306-49285328 AGGTGGGTATGCTGGAGTGAGGG + Intergenic
1168024200 19:53631940-53631962 AGGGGGCTCTGGAGGACCGAGGG + Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
925067771 2:941973-941995 TGGTGGTTCTGGTGGGCAGGGGG - Intergenic
925162310 2:1694511-1694533 AGGAGGGCCAGGTGGGCAGAGGG - Intronic
925302255 2:2825766-2825788 AGGTGGGTCTGCTGGTGAGTTGG - Intergenic
925714587 2:6772600-6772622 AGGTGGCTAAGGTGCACAGATGG + Intergenic
930093251 2:47547030-47547052 AGGTGGGGCTTGTGGACTGCGGG - Intronic
930704912 2:54495184-54495206 AGGTTGGTCTGGAGGACAGCAGG + Intronic
930722755 2:54653742-54653764 GGGTGCGGCTGGTGGACACAGGG + Exonic
932486143 2:72085433-72085455 AGGTGGGTCTGGGGAACAGTGGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
933798154 2:85937638-85937660 AGGTGGGTGTGGTGGAAATCTGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
935161257 2:100531453-100531475 AGATGGGCCTGGGGGACAAAAGG + Intergenic
936039589 2:109140114-109140136 AGGAGGGGACGGTGGACAGAGGG - Intronic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938094974 2:128455667-128455689 AGGTGGGTCTGCAGGGTAGATGG + Intergenic
938402307 2:131004044-131004066 AGGTGGGTCTGGTGTCCCCAGGG - Intronic
939354247 2:141080905-141080927 AGGTGGGTATGCTGGAGAAAGGG - Intronic
939588470 2:144033707-144033729 AGGAGGGGCTGGTTGACCGAGGG - Intronic
941180207 2:162250638-162250660 AGGTAGGTAAGGTAGACAGAGGG + Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
946039421 2:216771088-216771110 GGGTGGGGCGGGTGGATAGATGG - Intergenic
948228856 2:236334995-236335017 AGCTTGGTCTGGGGGAAAGAAGG + Intronic
948409047 2:237744934-237744956 AGGTGGGCATGGTGCAGAGAGGG - Intronic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
1169104635 20:2984220-2984242 ATGTGAGTGAGGTGGACAGATGG - Intronic
1172460924 20:35118046-35118068 ATGTGTATCTGGTAGACAGAAGG - Intronic
1173018156 20:39245490-39245512 TGGTGGTTCTTGTGGACTGAAGG + Intergenic
1174363006 20:50040207-50040229 AGGAGAGTCTGCTGGCCAGACGG - Intergenic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1180185468 21:46137066-46137088 TGGTGGATCTGATGGACACAGGG + Exonic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180633157 22:17243835-17243857 AGGTGGGAATGGGGCACAGATGG - Intergenic
1180865229 22:19114837-19114859 TGGTGGGTATGGTGGACTAAGGG - Intronic
1181648136 22:24244747-24244769 AGGGGCGGCTGGTGGGCAGACGG + Exonic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1183021847 22:35033664-35033686 AGGAGGGTCTGCTGGGCACAGGG + Intergenic
1183335274 22:37242755-37242777 AGCTGAGGCTGGTGGACAAATGG + Intronic
1183469771 22:37999093-37999115 AGGTGGGCCTGCTGGGCAGCTGG + Intronic
1184355755 22:43978528-43978550 AGGGGTGGCTGGAGGACAGAGGG + Intronic
1184444317 22:44538578-44538600 AGGTCGGCCTGGTGCACAGGAGG - Intergenic
1184490195 22:44803962-44803984 AGGTGGGTCTGGTGGCCTGGGGG - Intronic
1184716057 22:46282410-46282432 AGGTGGGCCCTCTGGACAGACGG + Intronic
1184802129 22:46767847-46767869 GGGTGGGTCTGGCCGAGAGAAGG + Intronic
1184875031 22:47268934-47268956 AGGTGGGCCTGTTGGAGAGTGGG + Intergenic
1185036324 22:48479071-48479093 AGGTGGAGTTGGTGGCCAGAGGG - Intergenic
949982022 3:9508086-9508108 AGATGGGCCAGGTGGACAGTGGG - Intronic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950117336 3:10459938-10459960 AAGTTGGTCTGCTGGACAGAAGG - Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951753313 3:26061181-26061203 AAGTGGGTGTGATGGACAGCTGG + Intergenic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
954068037 3:48122529-48122551 AGGGGGTGCTGGTGCACAGATGG + Intergenic
954331789 3:49895133-49895155 AGGTGGGGCTGGGGCAGAGATGG - Intronic
954430469 3:50468144-50468166 AGATGGGGCTTGGGGACAGAGGG - Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
954686328 3:52372174-52372196 CGGTGGGCCTGGTGCACAGGAGG - Intronic
955956243 3:64293040-64293062 AGGGTGGTGGGGTGGACAGAGGG - Intronic
956016851 3:64892945-64892967 AGGAGGGTCTGCTGAAAAGATGG - Intergenic
956603225 3:71045737-71045759 AGTTGGGTGTGGTGGACTCAAGG + Intronic
957043022 3:75351475-75351497 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
957068785 3:75549134-75549156 AGGTGGGTGTGGTTGAAAGCAGG - Intergenic
959594988 3:108119986-108120008 AGGTGGCTGAGGTGGGCAGATGG + Intergenic
959908137 3:111732788-111732810 AGGAGGGTCTGCTGGAGATATGG + Intronic
961012889 3:123448054-123448076 AGGTGGGTCTGGAGGAGCGGCGG - Exonic
961284631 3:125791193-125791215 AGGTGGGTGTGGTTGAAAGCAGG + Intergenic
961457181 3:127030063-127030085 AGGTGGGCCTGGCTGGCAGATGG + Exonic
962079086 3:132117822-132117844 GGGAGGGGCTGGTGGACAGTGGG + Intronic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
963042783 3:141081610-141081632 AGGAGGGCCTGGGGGACAGCAGG + Intronic
963973643 3:151457005-151457027 AGGTGAGACTGATGGAGAGAGGG - Exonic
965573729 3:170197020-170197042 AGGTGGATATGCTGGACAAAGGG - Intergenic
966331263 3:178817437-178817459 AAGAGGCTGTGGTGGACAGAAGG + Intronic
967560565 3:190913370-190913392 AGGTGGTTCTGGGAGATAGAAGG - Intergenic
969013111 4:4083671-4083693 AGGTGGGTGTGGTTGAAGGAAGG - Intergenic
969026549 4:4177757-4177779 AGGAGAGTGTGGTGGGCAGATGG - Intergenic
969326022 4:6444303-6444325 AGGTAGGCCTGGTGGAGACAGGG + Intronic
969800074 4:9556951-9556973 AGGTGGGTGTGGTTGAAGGAAGG + Intergenic
970941658 4:21641294-21641316 ACTTGGGTCTGGTTTACAGATGG + Intronic
971373765 4:26039588-26039610 AGGTGTGTCCTGTGAACAGATGG - Intergenic
983935994 4:173502955-173502977 AGGGGGGTCTGGTGCACAGTGGG + Intergenic
984839144 4:184051991-184052013 AGGTGGGGCAGGGAGACAGATGG + Intergenic
985710316 5:1424144-1424166 AGGTTGGCCGGGTGGGCAGATGG + Intronic
989986996 5:50712760-50712782 ATATGGATCTGGTGGTCAGAAGG + Intronic
990264816 5:54063382-54063404 GTGTGGCTCTGGTGGACACAGGG - Intronic
992564000 5:77980185-77980207 AGTGGCATCTGGTGGACAGAGGG + Intergenic
992619006 5:78574267-78574289 GGCTGGGCCTGGTGTACAGAGGG - Intronic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
997400304 5:133596973-133596995 AGGCGAGGCTGGTGGACAGATGG + Intronic
997590826 5:135071186-135071208 AGCTGGGCCTGGTGGTCAGGTGG - Intronic
998484064 5:142486486-142486508 AGGTGGGTTTGGGGAAGAGATGG - Intergenic
998625932 5:143845655-143845677 AGATGGCAATGGTGGACAGATGG - Intergenic
998678736 5:144440138-144440160 AAGTCGGTGTGGTGGACAAAGGG - Intronic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
999943471 5:156569743-156569765 AGGTGGATATGGAGGACAGAGGG + Intronic
1001494029 5:172175373-172175395 AGGTGAGTATGGTGGAGAGAGGG + Intronic
1001949370 5:175805620-175805642 GGGTGGGTCTAGTGGTCAGGGGG + Intronic
1002105958 5:176879549-176879571 GGGTGGGTGAGGTGGACAGGAGG + Intronic
1002538927 5:179893529-179893551 GGATGGGTCTGGGGTACAGATGG - Intronic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1003504956 6:6733430-6733452 AGGTGGGACTGGTTGGCAGTGGG - Intergenic
1004311434 6:14549380-14549402 TGGTGGCTCTGGAGGACAGCAGG - Intergenic
1004585938 6:17000272-17000294 TGGTTGGACTGATGGACAGATGG - Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1005966538 6:30730719-30730741 AGTTGGGACCTGTGGACAGAAGG + Exonic
1006175056 6:32116557-32116579 AGGTGGTCCTGGGGAACAGATGG + Exonic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1007091379 6:39186921-39186943 AGGTGGTGCTGGTGGAGAGCAGG + Intergenic
1007248161 6:40477189-40477211 AGGTGAGTCTGATGATCAGAGGG + Intronic
1007749386 6:44062836-44062858 AGATGGGTCACCTGGACAGAGGG - Intergenic
1007825694 6:44599018-44599040 AGATGAGACTGGTGGGCAGAAGG + Intergenic
1007942832 6:45798385-45798407 AGGTGAGTGTGATGGAAAGAGGG - Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008674373 6:53803857-53803879 AGGTGACTATGGTGGCCAGATGG - Intronic
1011361980 6:86537009-86537031 AGGGAGGTCGGGAGGACAGAAGG - Intergenic
1012187202 6:96233599-96233621 AGCTGGCTTTGGTGGACAGATGG - Intergenic
1013527172 6:110985361-110985383 AGGTGGGTCTGGTAGAGTGAAGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1017155596 6:151320206-151320228 AGGCGGGACCAGTGGACAGATGG - Intronic
1018061613 6:160094055-160094077 AGGTAGGGCTGGTGGACAGGAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1019056007 6:169224010-169224032 AGGTGGGCCTGGTGCAAACAGGG + Intronic
1019430640 7:997426-997448 AGGAGGGTCTGGAGGAGGGAAGG + Exonic
1023247802 7:38224603-38224625 GTGTGGATCTGCTGGACAGAGGG - Intronic
1023350183 7:39312812-39312834 ATGTGGATCTGCTGGACAAAGGG + Intronic
1023359414 7:39400194-39400216 AGTTGGGTGTGGTTGAAAGAGGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863077 7:44227025-44227047 AGGGGGGTGTGGAAGACAGAGGG + Intronic
1023863106 7:44227099-44227121 AGGTGGATGTGGGGGACAGAGGG + Intronic
1023863142 7:44227212-44227234 AGGGGGATGTGGGGGACAGAGGG + Intronic
1023863173 7:44227305-44227327 AGGAGAGTATGGGGGACAGAGGG + Intronic
1023863203 7:44227396-44227418 GGGAGAGTCTGGGGGACAGAGGG + Intronic
1023863244 7:44227503-44227525 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863252 7:44227522-44227544 AGGGGGATATGGGGGACAGAGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863328 7:44227747-44227769 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863341 7:44227786-44227808 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1028391358 7:90321093-90321115 AAGTGGGTCCGCTGGGCAGAGGG - Intergenic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029576996 7:101410077-101410099 AGGTTGGTTTGGTGGGCAGGGGG + Intronic
1029868793 7:103665421-103665443 AGGTGTGGCTGAGGGACAGAGGG - Intronic
1032086437 7:128886391-128886413 AGGGAGGTGGGGTGGACAGAGGG + Intronic
1032227887 7:130048060-130048082 ACTTGTGTCTGTTGGACAGAGGG - Intronic
1033436173 7:141335422-141335444 AGTTGGGTCTTGAGAACAGATGG + Intronic
1033580790 7:142733333-142733355 AGGTGGGTCGGGGAGACAGATGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034296134 7:149973893-149973915 AGGCGGGCCTGATGGTCAGAGGG + Intergenic
1034449353 7:151129124-151129146 AGGAGGGTCTGGTGGCCACGTGG + Intronic
1034809898 7:154122916-154122938 AGGCGGGCCTGATGGTCAGAGGG - Intronic
1035067945 7:156121721-156121743 AGGTGAGGCTGCAGGACAGAGGG - Intergenic
1035270784 7:157718859-157718881 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035271079 7:157720357-157720379 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035300977 7:157896971-157896993 AGGTGGGTCCTGTGGACATGAGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035533811 8:375836-375858 GGGTGGACCTGCTGGACAGAGGG + Intergenic
1035555128 8:562298-562320 AGGTCTGGCAGGTGGACAGAGGG + Intergenic
1036241005 8:7081006-7081028 AGGAGAGTGCGGTGGACAGATGG + Intergenic
1036888334 8:12577341-12577363 AGGTGGGTGTGGTTGAAGGAAGG - Intergenic
1040900234 8:52410714-52410736 AGGTGGGGTTGGAGGACGGAGGG + Intronic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045508545 8:102795441-102795463 AGGGGGGTCAGGTGGAGGGAGGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1049340619 8:142110550-142110572 TGCTGGGTCTGCTGGTCAGAGGG - Intergenic
1049749912 8:144278183-144278205 AGGCGGGTCTGAAGGACCGACGG + Intronic
1050898850 9:10918959-10918981 TGGTTGGTCTGGTGAACAGATGG - Intergenic
1051732255 9:20156910-20156932 ACTTGAGTCTGGTGAACAGAAGG - Intergenic
1053302043 9:36959170-36959192 AGAAGGGTCTGGTGGGAAGAGGG - Intronic
1053429971 9:38035619-38035641 GGGTAGGTCTTGGGGACAGAAGG + Intronic
1054791400 9:69260132-69260154 AGGTGGGTCTCCTGGACACTGGG - Intergenic
1057020775 9:91696043-91696065 AGGCTGGGCTGGTGGGCAGAGGG - Intronic
1058997762 9:110316421-110316443 AGATGGCTCTGGGGAACAGATGG - Intronic
1059361191 9:113743124-113743146 AGGTGAGTCATGTGGACACATGG - Intergenic
1060658302 9:125387944-125387966 AGGTGTGTCTGGCTGCCAGAAGG + Intergenic
1060696682 9:125714914-125714936 AGGTGAGTTTGGTGAATAGAAGG + Intergenic
1060749636 9:126160616-126160638 ATGTGGGCCTGGGGGACCGAGGG - Intergenic
1061115945 9:128612094-128612116 AGGCGGGCCTGGGGAACAGAAGG - Exonic
1061306439 9:129735775-129735797 AGGTGGGGGTGGGAGACAGATGG - Intergenic
1061950099 9:133931370-133931392 AGGTGCTTCTGGTTGTCAGAGGG - Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062510439 9:136902378-136902400 AGGAGTGTCTGGGGGACAGGTGG + Intronic
1062590458 9:137272325-137272347 AGGTGGGTCTGTTGGGCACCAGG + Intronic
1186746104 X:12570811-12570833 GGGTGGATCTGCTGGACAAAAGG + Intronic
1187047884 X:15665928-15665950 AGTTGGGTGTGGTGGAGACAGGG - Intergenic
1187263103 X:17705243-17705265 AGGTGGGGCTGTTGGACAGGAGG + Intronic
1187275939 X:17816754-17816776 AGATGGGTTTGGTGAACAGCTGG - Intronic
1187471948 X:19577531-19577553 AGATGGGGCTCGTGCACAGACGG + Intronic
1188743795 X:33817254-33817276 TGGTGGTCCTGGGGGACAGAGGG + Intergenic
1190172380 X:48121858-48121880 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190180131 X:48184921-48184943 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190193143 X:48294140-48294162 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190197142 X:48329293-48329315 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190199116 X:48345120-48345142 AGGTGTGTGTGGTGGAGGGAAGG - Intergenic
1190204840 X:48394538-48394560 AGGTGTGTGTGGTGGAGGGAGGG + Intergenic
1190205696 X:48400865-48400887 AGGTGTGTGTGGTGGAGGGAGGG - Intergenic
1190663881 X:52679671-52679693 AGGTGTGTGTGGTGGAGGGAGGG + Intronic
1190665877 X:52695588-52695610 AGGTGTGTGTGGTGGAGGGAGGG - Intronic
1190673541 X:52762822-52762844 AGGTGTGTGTGGTGGAGGGAGGG + Intronic
1190675541 X:52778751-52778773 AGGTGTGTGTGGTGGAGGGAGGG - Intronic
1191971079 X:66817000-66817022 AGTTGAGTCTTGTGAACAGAAGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1193107466 X:77693225-77693247 AGGTGCCTCTGGAAGACAGAGGG + Intronic
1194100199 X:89694135-89694157 AGGATGGGCTGGTGGACAGGAGG + Intergenic
1194208589 X:91040488-91040510 CAGTGGGTGTAGTGGACAGAGGG - Intergenic
1196818674 X:119685791-119685813 AGGTGGTTCTGGCCCACAGAAGG + Intronic
1196871691 X:120118399-120118421 GGGAGTGTCTGGTGGAGAGAAGG + Intergenic
1198528324 X:137524493-137524515 AGTTGTGTCTGGTGGACATGGGG - Intergenic
1200162891 X:154018426-154018448 AGGTGGCACTGGTGGCCCGAAGG - Intronic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic
1200453197 Y:3355494-3355516 AGGATGGGCTGGTGGACAGGAGG + Intergenic