ID: 906159008

View in Genome Browser
Species Human (GRCh38)
Location 1:43633816-43633838
Sequence CCAGGTGATGCTGACACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906159008_906159015 15 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG No data
906159008_906159016 18 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159016 1:43633857-43633879 GAATCTAGGCCAGGGTGTGGTGG No data
906159008_906159012 4 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159012 1:43633843-43633865 TTTTTAGAAATGTAGAATCTAGG No data
906159008_906159014 10 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159014 1:43633849-43633871 GAAATGTAGAATCTAGGCCAGGG No data
906159008_906159013 9 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159013 1:43633848-43633870 AGAAATGTAGAATCTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906159008 Original CRISPR CCAGGTGATGCTGACACTGA TGG (reversed) Intergenic
No off target data available for this crispr