ID: 906159011

View in Genome Browser
Species Human (GRCh38)
Location 1:43633834-43633856
Sequence TACATTTCTAAAAAGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906159011_906159013 -9 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159013 1:43633848-43633870 AGAAATGTAGAATCTAGGCCAGG No data
906159011_906159015 -3 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG No data
906159011_906159018 27 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159018 1:43633884-43633906 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
906159011_906159019 28 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159019 1:43633885-43633907 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
906159011_906159016 0 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159016 1:43633857-43633879 GAATCTAGGCCAGGGTGTGGTGG No data
906159011_906159014 -8 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159014 1:43633849-43633871 GAAATGTAGAATCTAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906159011 Original CRISPR TACATTTCTAAAAAGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr