ID: 906159015

View in Genome Browser
Species Human (GRCh38)
Location 1:43633854-43633876
Sequence GTAGAATCTAGGCCAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906159008_906159015 15 Left 906159008 1:43633816-43633838 CCATCAGTGTCAGCATCACCTGG No data
Right 906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG No data
906159011_906159015 -3 Left 906159011 1:43633834-43633856 CCTGGGAGCTTTTTAGAAATGTA No data
Right 906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG No data
906159007_906159015 22 Left 906159007 1:43633809-43633831 CCAAAGACCATCAGTGTCAGCAT No data
Right 906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906159015 Original CRISPR GTAGAATCTAGGCCAGGGTG TGG Intergenic
No off target data available for this crispr