ID: 906161345

View in Genome Browser
Species Human (GRCh38)
Location 1:43651061-43651083
Sequence AGGCATACAAAGATGAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 670}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906161340_906161345 2 Left 906161340 1:43651036-43651058 CCTACTCTGTGCCATGCATTGTT 0: 1
1: 8
2: 81
3: 574
4: 2301
Right 906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG 0: 1
1: 0
2: 5
3: 47
4: 670
906161339_906161345 9 Left 906161339 1:43651029-43651051 CCGATTGCCTACTCTGTGCCATG 0: 1
1: 0
2: 1
3: 42
4: 324
Right 906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG 0: 1
1: 0
2: 5
3: 47
4: 670
906161342_906161345 -9 Left 906161342 1:43651047-43651069 CCATGCATTGTTCTAGGCATACA 0: 1
1: 0
2: 3
3: 36
4: 317
Right 906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG 0: 1
1: 0
2: 5
3: 47
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906161345 Original CRISPR AGGCATACAAAGATGAATAG GGG Intronic
900855715 1:5181077-5181099 AGGCAGAAAAAGAAGAAAAGGGG - Intergenic
902083923 1:13842327-13842349 AGGTATCCAAATAGGAATAGAGG - Intergenic
903752268 1:25632076-25632098 AGACATTCAAAGAAGAATTGGGG - Intronic
904113429 1:28144401-28144423 AGGGATAGATAGATGGATAGAGG + Intergenic
904304231 1:29577185-29577207 AGGGATACAGAGATGATTAAGGG - Intergenic
905390300 1:37632118-37632140 AGGAATGCAGAGATGCATAGGGG - Intronic
906032140 1:42730087-42730109 AGGCTTACAAAGATGGAAAGGGG - Intergenic
906051126 1:42873893-42873915 AGGCATACAAATAAGAAAAGAGG - Intergenic
906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG + Intronic
906173802 1:43751734-43751756 TGGGATAGAAAGATGAATATAGG + Intronic
906658021 1:47562787-47562809 AGGCATAAAGAGATGGATGGTGG - Intergenic
906993996 1:50770283-50770305 AGGCATCCAAATAGGAAGAGAGG + Intronic
907628792 1:56059059-56059081 GGGGATACAAAGATGGAAAGAGG + Intergenic
907954263 1:59213444-59213466 AAGCATGCAAAAATCAATAGAGG + Intergenic
908718412 1:67096037-67096059 AGGCATGGAAAAATGAATAGAGG - Intronic
908818907 1:68062362-68062384 AGGCATCCAAATAGGAAGAGAGG + Intergenic
908912694 1:69091171-69091193 AGGCAAATAAAGAGGAAAAGGGG + Intergenic
909890084 1:80994472-80994494 AGGCATACACAAAAGAAAAGAGG - Intergenic
910148083 1:84106286-84106308 AGGCATTCAAATAGGAAGAGGGG + Intronic
910313468 1:85855194-85855216 AGGCATCCAAATAGGAAAAGAGG - Intronic
910385502 1:86678262-86678284 AGGCATCCAAATAGGAAAAGAGG + Intergenic
911210537 1:95134102-95134124 AGGCAGAAAACGATGTATAGGGG + Intronic
911252649 1:95595339-95595361 AGGCATCCAAATAGGAAGAGAGG + Intergenic
911423036 1:97669892-97669914 AGACATACACAGAAGAAAAGAGG - Intronic
911479074 1:98413673-98413695 AGGCATCCAAATAGGAAGAGAGG - Intergenic
911838529 1:102651975-102651997 AGGCATTCAAATAGGAAGAGAGG - Intergenic
912005509 1:104894940-104894962 AAGCCAGCAAAGATGAATAGAGG + Intergenic
912614357 1:111082923-111082945 AGGCAACCAAACATGAAGAGAGG - Intergenic
912828455 1:112928121-112928143 AGGCACAAAAAGATAAACAGTGG + Intronic
913156966 1:116109131-116109153 AGGCATACAAAGTGGTATAATGG + Intergenic
914968691 1:152286493-152286515 AGGCATTCAAATAGGAAGAGAGG + Intergenic
914997363 1:152556677-152556699 AGGCATCCAAATAGGAAAAGAGG + Intronic
915927535 1:160034708-160034730 AGGGCAAAAAAGATGAATAGTGG - Intergenic
916032581 1:160891003-160891025 AGGCATCCAAATAGGAAAAGAGG + Intergenic
916151519 1:161796834-161796856 AGGCATCCAAATATGAAGAGAGG - Intronic
916151556 1:161797348-161797370 AGGCATCCAAATAGGAAGAGAGG + Intronic
916599579 1:166278911-166278933 AGGCATCCAAAAAGGAAGAGAGG - Intergenic
916611224 1:166393839-166393861 AGAAATAAAAAGATGGATAGTGG - Intergenic
917267553 1:173237434-173237456 AGGCATGCAAATAGGAAGAGAGG + Intergenic
917302629 1:173592818-173592840 AGGCATCCAAATAGGAAGAGAGG - Intronic
917697283 1:177538621-177538643 AGGCATCCAAATAGGAAGAGAGG + Intergenic
918100825 1:181372561-181372583 AGGCATCCAAATAGGAAGAGAGG - Intergenic
918273216 1:182923913-182923935 AGGCATCCAAATAGGAAGAGGGG + Intronic
918656986 1:187039377-187039399 ATGTAGACAAAGAAGAATAGAGG + Intergenic
918867649 1:189923867-189923889 AGGCATTCAAATAGGAAAAGAGG - Intergenic
919138430 1:193539659-193539681 AAGCATACAAGGAAAAATAGGGG - Intergenic
919286216 1:195563545-195563567 AGGCTTACAGAGTAGAATAGTGG + Intergenic
919307553 1:195861741-195861763 AGGCATGCAAAGTAAAATAGAGG - Intergenic
920042292 1:203108691-203108713 AGGCATACAAATAGGAAGAGAGG + Intronic
920367134 1:205454069-205454091 AGGCAGACAGAGATGAAGGGTGG + Intronic
920602451 1:207342202-207342224 AGGCATCCAAACTGGAATAGAGG - Intronic
921006797 1:211101522-211101544 ATTCACACAAAGATGACTAGTGG - Intronic
921336880 1:214096594-214096616 AGGCATCCAAATAGGAAGAGAGG + Intergenic
921390837 1:214611944-214611966 AGGCATCCAAATAGGAAGAGAGG - Intronic
921653580 1:217707389-217707411 AGGCATCCAAATAGGAAGAGAGG - Intronic
921919859 1:220655665-220655687 AGGAAGTGAAAGATGAATAGTGG - Intronic
922711002 1:227832371-227832393 AGGCATGGAAAAATGAATAGAGG - Intronic
923065665 1:230515062-230515084 AGGCATATAAAGAACAAAAGTGG + Intergenic
923248798 1:232160477-232160499 GTGCAAACAAAGCTGAATAGGGG + Intergenic
923253244 1:232196877-232196899 AGGCAGAAAAACATGAAAAGGGG - Intergenic
923368186 1:233284409-233284431 AGCCAAGCAAAGGTGAATAGAGG - Intronic
924308547 1:242716909-242716931 AGGTTTAAAAATATGAATAGAGG - Intergenic
924575887 1:245280558-245280580 AGGCAGATAAAGAGGAAAAGGGG + Intronic
924607297 1:245545683-245545705 AAGCAGATAAAGATGATTAGTGG + Intronic
1063062182 10:2567589-2567611 AGGCATACTAAAGTGAATGGTGG + Intergenic
1063946289 10:11179639-11179661 AGGAATACAAAGATGACTACTGG + Intronic
1064525555 10:16252724-16252746 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1064596406 10:16949858-16949880 AGCCAAATAAAGATGATTAGAGG - Intronic
1064607070 10:17053666-17053688 AAACAGATAAAGATGAATAGGGG + Intronic
1066137834 10:32468545-32468567 AGGCATCCAAATAGGAAGAGTGG - Intronic
1066424827 10:35297521-35297543 AGGCATCCAAATAGGAAGAGAGG + Intronic
1067138729 10:43636053-43636075 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1067493811 10:46742970-46742992 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1067600848 10:47597434-47597456 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1068071484 10:52202018-52202040 AGGCATCCAAATAGGAAGAGAGG - Intronic
1068398901 10:56503011-56503033 AGGCATCCAAATAGGAATAGAGG - Intergenic
1068575544 10:58680203-58680225 AGGCATTCAAATAGGAAGAGAGG + Intronic
1068615611 10:59112168-59112190 AGGCAGACAAAGAGGAAAGGGGG - Intergenic
1068820579 10:61373287-61373309 AGGCATTCAAATAGGAAGAGAGG - Intergenic
1068832761 10:61516606-61516628 AGGCATTCAAATAGGAAGAGAGG - Intergenic
1069068257 10:63968448-63968470 AGGCATCCAAATAGGAAGAGGGG + Intergenic
1069371517 10:67752507-67752529 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1069585595 10:69599178-69599200 AGGCATCCAAAAAGGAAGAGAGG - Intergenic
1069765945 10:70859942-70859964 AAGTATACACAGATAAATAGGGG - Intronic
1070270851 10:74952998-74953020 AAGCAAGCAAAGATGAATACTGG - Intronic
1070460004 10:76656263-76656285 AGGCATCCAAATAGGAATAAAGG + Intergenic
1070522718 10:77268526-77268548 AGGCTTACAAGGATGAAAACAGG + Intronic
1070913641 10:80138854-80138876 GGGCATCCAAAGCTCAATAGGGG - Intronic
1071248876 10:83795135-83795157 GGGCATTCAAATAGGAATAGAGG + Intergenic
1071253716 10:83847034-83847056 AGGCATTCAAAAAGGAAAAGAGG - Intergenic
1071313613 10:84368869-84368891 AGGCATACAGAGAGGAATAATGG - Intronic
1072862088 10:99016992-99017014 AGGCATGCAAATAGGAAGAGAGG - Intronic
1072953120 10:99865756-99865778 AGGTATTCAAATAGGAATAGAGG - Intergenic
1073679950 10:105692246-105692268 AGGGATAGAAAGATAAATAAAGG - Intergenic
1073944681 10:108736851-108736873 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1073999499 10:109355413-109355435 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1074196669 10:111194030-111194052 AGGCAAACAAAGATTAAAACGGG - Intergenic
1074248371 10:111717287-111717309 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1075126108 10:119700642-119700664 AGAAATACAAAGAAGAAAAGGGG - Intergenic
1076179859 10:128398736-128398758 GGGGATAAAAAGATGAATAAAGG + Intergenic
1078374321 11:10780707-10780729 AGGCTTTCAAAGATTAACAGTGG - Intergenic
1080152348 11:29067822-29067844 AGGCATCCAAATAGGAATAAAGG + Intergenic
1081379700 11:42399625-42399647 AGGCATACAAATAGGAAGAGAGG + Intergenic
1081463483 11:43294285-43294307 AGGCATCCAAATTGGAATAGAGG + Intergenic
1081548072 11:44086384-44086406 ATACATAGAAAGATGCATAGAGG - Intergenic
1082733581 11:56829957-56829979 AGGCATTCAAATAGGAAAAGAGG + Intergenic
1082893836 11:58168989-58169011 AGGCATACAGAAATTAATAAAGG - Intronic
1085813129 11:79704471-79704493 AGGCATACAAATAGGAAGAGAGG + Intergenic
1085940676 11:81202607-81202629 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1085978964 11:81698226-81698248 AGGCATCCAGATATGAAAAGAGG + Intergenic
1086076074 11:82854182-82854204 AGGCATCCAAACAGGAAGAGAGG + Intronic
1086526533 11:87733981-87734003 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1086824519 11:91479217-91479239 AGGCATTCAAACAGGAAGAGAGG + Intergenic
1086896248 11:92316190-92316212 AGGGATAAAAAGAGAAATAGGGG + Intergenic
1087413443 11:97822082-97822104 AGGCATAAAAAGATGCATTTAGG - Intergenic
1088149877 11:106731563-106731585 AGGCATCCAAATAGGAAGAGAGG + Intronic
1088176236 11:107055614-107055636 AGGCATCCAAATAGGAAGAGGGG + Intergenic
1089391808 11:118107394-118107416 AGGGAAACAAAGAGGCATAGGGG - Intronic
1090105268 11:123847962-123847984 AGGCAAACAAATATGGAAAGAGG - Intergenic
1090574143 11:128082293-128082315 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1091241399 11:134054835-134054857 AGACATAAAAAGATAAACAGGGG + Intergenic
1092516411 12:9219039-9219061 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1093275014 12:17115264-17115286 AGGCATCCAAACAGGAAAAGAGG - Intergenic
1093471144 12:19503570-19503592 AGGCATCCAAATAGGAAAAGAGG - Intronic
1093481783 12:19611885-19611907 AGGCATCCAAATAGGAAGAGAGG - Intronic
1093498246 12:19781242-19781264 AGGCATCCAAATATAAAGAGAGG + Intergenic
1093848290 12:24002399-24002421 AGAAATACAAAGATGTATAAAGG + Intergenic
1094172353 12:27506808-27506830 AGGAACACCAAGATGAACAGTGG - Intergenic
1095631539 12:44382618-44382640 AAGCATAGAAAGAAGAAAAGTGG - Intronic
1096346732 12:50854486-50854508 AGGCATCCAAATAGGAAGAGAGG + Intronic
1096907656 12:54949867-54949889 AGGAATACAGGGATGAACAGAGG + Intronic
1097320116 12:58216322-58216344 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1097448251 12:59703077-59703099 AGGTATACAAAAATGGATAAGGG - Intronic
1097910331 12:64962688-64962710 GGGCATCCAAATAGGAATAGAGG - Intergenic
1097990586 12:65827523-65827545 AGGTATACAAAGATGATTAAAGG + Intronic
1098201187 12:68057734-68057756 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1098436998 12:70478420-70478442 AGGCATGCAAAGAGGAAGAGAGG - Intergenic
1098511827 12:71324457-71324479 AGGAATAGAATGAGGAATAGAGG + Intronic
1098620980 12:72598226-72598248 AGGCAATCAAATATGAATAAAGG - Intronic
1099121974 12:78701846-78701868 AGGCATTCAAAGAATAATATGGG - Intergenic
1099633368 12:85178855-85178877 AGGGATACAAAGATGAATATAGG + Intronic
1099908341 12:88799061-88799083 AGGACTACAATGATGAATAGAGG - Intergenic
1100369588 12:93955494-93955516 ATGAATACAAAGATGAGAAGTGG + Intergenic
1100778874 12:98002598-98002620 AGGCATAGAGAGATGTAAAGGGG + Intergenic
1101058473 12:100945584-100945606 AGGTATCCAAAGATCAATAATGG - Intronic
1101113951 12:101513727-101513749 AGGCATCCAAACAGGAAAAGAGG - Intergenic
1102684815 12:114716548-114716570 CAGCACACAGAGATGAATAGGGG + Intergenic
1103169899 12:118808545-118808567 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1103821818 12:123704919-123704941 GGGAGTACAAAGATGAATAAAGG + Intronic
1105711742 13:23016511-23016533 AGGCACACAAATAGGAAGAGAGG - Intergenic
1105818623 13:24059810-24059832 AGGCATCCAAATAGGAAAAGAGG - Intronic
1106044765 13:26128669-26128691 GTGCAAACAAAGATGAATAAAGG - Intergenic
1106045835 13:26140660-26140682 AGGCATACAAATAGGAAAAGAGG + Intronic
1106334605 13:28772261-28772283 AGGTATTCAAATATGAATAGAGG - Intergenic
1106366579 13:29087066-29087088 AGGCATCCAAATAGGAAGAGAGG - Intronic
1106372659 13:29151500-29151522 AGGCATCCAAACAGGAAGAGAGG - Intronic
1106604819 13:31218660-31218682 AGGCATCCAAACAGGAAAAGAGG - Intronic
1106751152 13:32769180-32769202 AGGCATACACAAAAGCATAGAGG + Intronic
1107207853 13:37817049-37817071 AGGCATCCAAATAGGAAGAGAGG + Intronic
1107241083 13:38234909-38234931 AGGTATTCAAATATGAAGAGAGG + Intergenic
1107842048 13:44468183-44468205 AGGCATACAGAGTTGTATAACGG + Intronic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108628146 13:52252986-52253008 AGGCATAGAAAGACAAATATTGG + Intergenic
1108657914 13:52553463-52553485 AGGCATAGAAAGACAAATATTGG - Intergenic
1108852175 13:54744277-54744299 AGACACAGAAAAATGAATAGTGG + Intergenic
1108989346 13:56635030-56635052 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1109018296 13:57049659-57049681 TGGCATACAAATAAGAAGAGAGG - Intergenic
1109105484 13:58244579-58244601 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1109519347 13:63487329-63487351 AGGCAGAAAAACATGAAAAGGGG + Intergenic
1109591257 13:64486140-64486162 AGTCATACAAAGAGAAAAAGAGG + Intergenic
1109877308 13:68422437-68422459 AAGCATCCAAATATGAAGAGAGG - Intergenic
1109986268 13:69989925-69989947 AGGCATCCAAATAGGAAGAGAGG - Intronic
1110334777 13:74315146-74315168 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1110498165 13:76193642-76193664 AGGCATTCAAACAGGAAGAGAGG - Intergenic
1110629213 13:77686971-77686993 AGGCATTCAAATAAGAAAAGAGG + Intergenic
1110662584 13:78074709-78074731 AGGTATTCAAATAGGAATAGAGG - Intergenic
1110954450 13:81536709-81536731 AGGCAAACAAATAGGAAGAGAGG + Intergenic
1111307102 13:86428843-86428865 AGGTATACAAATAGGAAGAGAGG - Intergenic
1111338416 13:86851621-86851643 AGGCATCCAGATAGGAATAGAGG + Intergenic
1111393666 13:87634011-87634033 AGGCATCCAAATAAGAAAAGAGG + Intergenic
1111439741 13:88265387-88265409 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1111604857 13:90524126-90524148 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1111794309 13:92897928-92897950 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1111986902 13:95075472-95075494 GGGCATACAAAGCAGAAGAGAGG - Exonic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112897707 13:104320867-104320889 AGGCGTCCAAAGATGAAAATGGG + Intergenic
1114541638 14:23464851-23464873 AGGGATACAAAGTTGATTAGTGG + Intergenic
1114741958 14:25106395-25106417 AGGTATTCAAAGATGAAGAGAGG + Intergenic
1115132946 14:30074841-30074863 AGGCATCCAAATAGGAAGAGAGG + Intronic
1115508997 14:34121244-34121266 ATGCATAGAAAGATGACTGGAGG - Intronic
1115682430 14:35756432-35756454 TGGCAGCCAAGGATGAATAGAGG + Intronic
1115915275 14:38305330-38305352 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1116319765 14:43446606-43446628 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1116471745 14:45293517-45293539 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1116493158 14:45529501-45529523 AGGCATCCAAATAGGAATAGAGG + Intergenic
1116708717 14:48337275-48337297 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1117207160 14:53455274-53455296 AGGCATACAAAGTGGTATAATGG + Intergenic
1117578087 14:57121350-57121372 AGGCATGCAAAGAATAATTGTGG + Intergenic
1119182993 14:72616934-72616956 AGGCCTCCAAAGATGAAGAATGG + Intergenic
1119245089 14:73097633-73097655 AGGCAAACAAAGTAAAATAGGGG - Intronic
1120064441 14:80024025-80024047 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1120448664 14:84636944-84636966 AGGCATTCAAATATTAAGAGAGG - Intergenic
1120624992 14:86813996-86814018 GGGCATCCAAATATGAAAAGAGG - Intergenic
1121371413 14:93361656-93361678 AGGCATCCAAAAAGGAAGAGAGG - Intronic
1121439671 14:93940759-93940781 AGGATTTCACAGATGAATAGAGG - Intronic
1121479232 14:94248090-94248112 AGGCATCCAAATAGGAAAAGAGG + Intronic
1122288763 14:100668271-100668293 AGGCAGACCAAGATGGACAGGGG + Intergenic
1122806138 14:104259295-104259317 AGGCAGAAAAAGATGAAAAAGGG + Intergenic
1122958572 14:105084031-105084053 AGGAATGGAAAGATGGATAGAGG - Intergenic
1123796393 15:23775340-23775362 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1123926099 15:25112798-25112820 AGGCAGTTAAAGATGAACAGAGG + Intergenic
1124863828 15:33469906-33469928 AAGAATACAGAGATGAATACGGG + Intronic
1126046368 15:44644601-44644623 AGGCATCCAAATAGGAAGAGAGG + Intronic
1126227320 15:46286107-46286129 AGGCATCCAAATAGGAAGAGGGG - Intergenic
1126233831 15:46358519-46358541 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1126502667 15:49363587-49363609 AGGCATTCAAATAAGAACAGAGG - Intronic
1126957163 15:53946197-53946219 GGGCATCCAAATATGAATATAGG - Intergenic
1127369495 15:58324735-58324757 AGGCATCCAAACAGGAAAAGAGG - Intronic
1127405275 15:58638090-58638112 AGGCAGGCACAGAAGAATAGAGG - Intronic
1128614528 15:69098923-69098945 AGGCAGACAGAGATGATTAAGGG - Intergenic
1128862768 15:71088299-71088321 AGGCATTCAGATAGGAATAGAGG + Intergenic
1129523644 15:76200872-76200894 AGGCATTTAAAGATCAAAAGAGG + Intronic
1129560050 15:76556785-76556807 AGGCATCCAAATAGGAAGAGAGG + Intronic
1129568975 15:76658091-76658113 AGGCATCCAAATAGGAAGAGAGG + Intronic
1129583320 15:76835721-76835743 AGGCATCCAAATAGGAAGAGAGG + Intronic
1129954278 15:79620238-79620260 AGGCATACAAATAGGAAGACAGG - Intergenic
1131553094 15:93374721-93374743 AGGAATTGAAAGATGAGTAGAGG + Intergenic
1131639765 15:94279577-94279599 AGGCATCCAAATAGGAAGAGAGG - Intronic
1134743007 16:16564875-16564897 AGGCATACAAAAATAAAAAAAGG - Intergenic
1134924553 16:18147585-18147607 AGGCATACAAAAATAAAAAAAGG + Intergenic
1136667995 16:31830813-31830835 AGGCATCCAAATAGGAACAGAGG + Intergenic
1136677889 16:31930163-31930185 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1138258727 16:55596821-55596843 AGGCATGCAAATAGGAAGAGAGG + Intergenic
1138300805 16:55928378-55928400 AGGCATACAAAGTGGTATAATGG + Intronic
1138860999 16:60757220-60757242 ATGCATAGAAAGAAGAAAAGTGG - Intergenic
1140283027 16:73572926-73572948 AGATATACAAAGATGAATATAGG - Intergenic
1141269088 16:82522649-82522671 AGGCATGCAAAGATGAAAATTGG + Intergenic
1142843384 17:2651982-2652004 AGGCAGGGAAGGATGAATAGGGG - Intronic
1143584802 17:7845725-7845747 AGGGATACAGAGATGGAAAGAGG - Intronic
1143586384 17:7852721-7852743 AGGCAGACAAGGATGGAGAGAGG - Intronic
1143821142 17:9564386-9564408 AGGCATCCAAATAGGAAGAGAGG + Intronic
1144393559 17:14819996-14820018 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1146113692 17:30115340-30115362 AAGCAGACAAAGAAGAATAAAGG + Intergenic
1148569208 17:48654281-48654303 AGGCAGAAAAAGAGGAAAAGGGG - Intergenic
1150095598 17:62372046-62372068 AGGAATACAAGGATGAAGAAAGG + Intronic
1150258016 17:63764523-63764545 AGTGCTACAATGATGAATAGGGG + Intronic
1153106187 18:1529909-1529931 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1153694703 18:7628209-7628231 TGGTATACAGAAATGAATAGTGG - Intronic
1153695195 18:7633364-7633386 AGCCATCCAAAGATGAATTTGGG - Intronic
1153803188 18:8689452-8689474 AGACAGACAAACAGGAATAGGGG + Intergenic
1153876625 18:9378292-9378314 AGGCATCCAAATAGGAAGAGAGG + Intronic
1154392927 18:13957445-13957467 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1154469798 18:14688679-14688701 AGGCATCCAAATAGGAAGAGTGG - Intergenic
1155088350 18:22480318-22480340 AGGCATCCAAATTTGAAAAGAGG + Intergenic
1155311241 18:24525995-24526017 AGGCATAAAAACAAGAAAAGAGG - Intergenic
1155463430 18:26109336-26109358 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1156212035 18:34955033-34955055 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1156289820 18:35737070-35737092 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1156492415 18:37504091-37504113 AGGCATCCAAAGAAGAAAAGTGG - Intronic
1156563262 18:38153668-38153690 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1156820012 18:41360854-41360876 AGGCTTACAAAGATCATTAAGGG + Intergenic
1156826873 18:41440592-41440614 AGGCATCCAAATATGAAGAGAGG - Intergenic
1156939888 18:42754440-42754462 AGGCATAAAAATATGTATTGAGG - Intronic
1157014615 18:43696891-43696913 AGTGATACAAAGATGCAAAGGGG - Intergenic
1157142903 18:45128813-45128835 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1157426187 18:47586238-47586260 AGCCATGCAGAGATGGATAGGGG - Intergenic
1158127060 18:54112217-54112239 AGGCATTCAAATAGGAAGAGAGG - Intergenic
1159484584 18:69038780-69038802 AGGAATACAAAGATGATTTGGGG - Intronic
1159571196 18:70113848-70113870 AGACATAGAAAGAAGACTAGTGG + Intronic
1160056428 18:75486246-75486268 AGGCATCCAAACAGGAAGAGAGG - Intergenic
1161179649 19:2871295-2871317 AGGCATAGAAAGATGAATACCGG + Intronic
1164095139 19:22002373-22002395 AGGCATCCAAACATAAAGAGAGG + Intronic
1164135634 19:22413265-22413287 AGGCATACAAACAGGAAGAGAGG + Intronic
1164162783 19:22639816-22639838 AGGCATACAAACAGGAAGAAAGG - Intronic
1164496643 19:28770657-28770679 AGGCATCCAAATAAGAAGAGAGG - Intergenic
1164901383 19:31928489-31928511 AGGCATACAAAGTTGTATAATGG + Intergenic
1165637805 19:37357838-37357860 AGGCATCCAAATAGGAAAAGAGG - Intronic
1166242172 19:41501895-41501917 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
1166808561 19:45501325-45501347 AGATATCCAAAGATGTATAGTGG + Intronic
1168095078 19:54109891-54109913 AGGCAAACAAGGAGGAAGAGTGG - Intronic
1168442348 19:56380758-56380780 TAGAATACAAAGTTGAATAGGGG + Intronic
1168552964 19:57314096-57314118 AGGCATCCAAATAGGAAGAGAGG - Intergenic
925096363 2:1207554-1207576 AGGGATGCAAAGATGATTTGAGG + Intronic
925750473 2:7085914-7085936 AGGCATCCAAATAGGAAGAGAGG - Intergenic
927234935 2:20863954-20863976 AGGCATCCAAATAGGAAAAGAGG + Intergenic
927661897 2:25000589-25000611 AGGAAAACAAAGATGAAGAGGGG - Intergenic
928147877 2:28796737-28796759 AGGCATCCAAATAAGAAGAGAGG - Intronic
928461787 2:31481281-31481303 TGGCATACAAATACGAAGAGAGG - Intergenic
929280095 2:40068596-40068618 AGGCATTCAAATAGGAAGAGAGG - Intergenic
929836653 2:45407540-45407562 AAGTATATAAAAATGAATAGAGG - Intronic
929896881 2:45968437-45968459 AGGCATACAAAGTGGTATAATGG + Intronic
930551893 2:52846157-52846179 AGAGATAGAAAGATGATTAGTGG - Intergenic
930556601 2:52903646-52903668 AGGCATACAATGGTGACTGGGGG - Intergenic
930594880 2:53375214-53375236 AGGCATGCAAATAGGAAGAGAGG - Intergenic
930761303 2:55040747-55040769 AGGACAAGAAAGATGAATAGAGG - Intronic
930916230 2:56692050-56692072 AGGCATCCAAATATGAAGACAGG - Intergenic
931015680 2:57977681-57977703 AGGCATTCAAATAGGAAGAGTGG - Intronic
931259186 2:60601917-60601939 AGGGCTGCAAAGTTGAATAGAGG - Intergenic
931401408 2:61934685-61934707 AGGCAAACAAAAAGGAAAAGGGG + Intronic
931624209 2:64242051-64242073 AGGCATTCAAATATGAAGACAGG - Intergenic
931966071 2:67536340-67536362 AGGCATACATAGTGGTATAGTGG - Intergenic
932037923 2:68266839-68266861 AGGCATCCAAATTTGAAAAGAGG + Intergenic
932232989 2:70097697-70097719 ATGCATACAACAAAGAATAGAGG - Intergenic
932391643 2:71396010-71396032 GGACATACAAAGATGAGTATAGG + Intronic
933118544 2:78504922-78504944 AGGCATCCAAATAAGAATTGAGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933543200 2:83674675-83674697 AGGAAAACTAAGATGTATAGCGG - Intergenic
933593220 2:84256310-84256332 AGGCATCCAAATAGGAAGAGAGG - Intergenic
934941950 2:98509144-98509166 AGGGATACAAAGATGATAAGAGG - Intronic
935225192 2:101046806-101046828 CGGTTTATAAAGATGAATAGCGG - Intronic
935433237 2:103000546-103000568 AGGCATCCAAATAGGAAAAGAGG + Intergenic
935491574 2:103727219-103727241 AAGCATCCAAATATGAAGAGAGG - Intergenic
935534415 2:104277106-104277128 ATGCATACAAAAATATATAGGGG + Intergenic
936654023 2:114463393-114463415 AGGTATACATACATGAAGAGTGG + Intronic
936832758 2:116668957-116668979 AGGCATCCAAATAGGAAGAGAGG + Intergenic
937070772 2:119061359-119061381 AGGAAAAGAAAGATGAAAAGGGG - Intergenic
937484819 2:122304369-122304391 AGGCATCCAAAGAAGAAGAGAGG + Intergenic
937553002 2:123118047-123118069 AGGCATCCAAATATAAAGAGAGG - Intergenic
937569291 2:123335760-123335782 AGACAAACAGAGAAGAATAGAGG + Intergenic
937728096 2:125191089-125191111 AGGCATCCAAATAGGAAAAGAGG - Intergenic
937755797 2:125536861-125536883 AGGCACATAAAAATGAATAAAGG - Intergenic
939031954 2:137087340-137087362 AGGCATACAAATCAGAAAAGAGG + Intronic
939263094 2:139835215-139835237 AGGCATGCAAATAGGAAAAGAGG - Intergenic
940198584 2:151124554-151124576 AGGCATCCAAATAGGAAGAGGGG + Intergenic
940464420 2:154010125-154010147 AGGCATCCAAACAAGAAAAGAGG - Intronic
940535202 2:154932418-154932440 AGGCATCCAAATAGGAAGAGAGG - Intergenic
940563537 2:155332182-155332204 AGGCATCCAAATAGGAAGAGCGG - Intergenic
940588355 2:155686334-155686356 AGCCATACAAAAATGTATACAGG - Intergenic
940607334 2:155942559-155942581 AGACATCCAAAGAGGAAGAGAGG + Intergenic
940716096 2:157225441-157225463 AGGCATCCAAATAGGAAGAGAGG + Intergenic
940757793 2:157703568-157703590 AGGCATCCAAAGTGGAAAAGTGG + Intergenic
940930351 2:159421767-159421789 AGGCATCCAAATAGGAAGAGAGG + Intronic
940997073 2:160160999-160161021 AGGCATAAGAAAATGAATACTGG + Intronic
941119402 2:161511727-161511749 AGGCATACAAATAGGAAGAGAGG + Intronic
941143149 2:161810329-161810351 AGGCATTCAAATAGGAAGAGAGG - Intronic
941487315 2:166098532-166098554 AGGCATCCAAATACGAAGAGAGG + Intronic
941561021 2:167044450-167044472 AGGCATCCAAATAGGAAGAGAGG + Intronic
941704869 2:168647478-168647500 AGGCATCCAAATAGGAAAAGAGG - Intronic
942543306 2:177037004-177037026 AGGGATACAAACATGACTAATGG + Intergenic
942982153 2:182095464-182095486 AGGGATACAATAATGAATGGTGG - Intronic
943341241 2:186684671-186684693 AGGCATTTAAAGTTTAATAGGGG + Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943867958 2:192953432-192953454 AGGCTTACAAGGAGAAATAGAGG + Intergenic
944922121 2:204426012-204426034 AGGCATTCAAACAGGAAGAGAGG + Intergenic
945318838 2:208397975-208397997 AGGCAGATAAAGAAGAAAAGGGG - Intronic
945342854 2:208678198-208678220 AGGCATCCAAATAGGAAGAGAGG - Intronic
945356925 2:208851581-208851603 AGGCATTCAAATAGGAAGAGAGG - Intronic
945526357 2:210892439-210892461 AGGCATCCAAATAGGAAGAGAGG + Intergenic
945791068 2:214306340-214306362 AGGCATGCAAATAGGAAGAGGGG - Intronic
946677670 2:222179360-222179382 AGGCACACAAATATGACTGGAGG - Intergenic
946762670 2:223010509-223010531 AGACATCAAAAGATGAATAAGGG - Intergenic
946821051 2:223629760-223629782 AGGCAAAGAAAGATGGAGAGAGG - Intergenic
946998911 2:225430104-225430126 AGGGAGACAAAGAAGAAGAGAGG - Intronic
947045408 2:225977556-225977578 AGGCAAAAAGAGGTGAATAGTGG + Intergenic
947787298 2:232835028-232835050 AGGCACACAAAGTGGAATAATGG - Intronic
948416049 2:237805023-237805045 AGGCATCCAAATAGGAAGAGAGG + Intronic
1170858390 20:20078929-20078951 AGGCATTGAAAGATTAATATGGG + Intronic
1171083452 20:22212601-22212623 AAGCATAAAAAGACAAATAGTGG - Intergenic
1171098488 20:22357315-22357337 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1171564100 20:26162591-26162613 TGGCATACAAAGATGATGTGGGG - Intergenic
1172470442 20:35189804-35189826 AAGGATACAAAGATGAACAAGGG - Intergenic
1172864054 20:38081515-38081537 AGGCATCCAAATAGGAAGAGAGG - Intronic
1173239605 20:41282657-41282679 AGGCATCGAAAGATGAATCGTGG - Intronic
1175462541 20:59163258-59163280 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1177391059 21:20472618-20472640 AGACATACAAAGAAGAAAACAGG - Intergenic
1177914890 21:27077050-27077072 AGGCAGAAAAAGGTGAAAAGGGG + Intergenic
1179300795 21:40108189-40108211 AGGCATTCAAACAGGAAGAGAGG + Intronic
1182027767 22:27134029-27134051 AGGCAGACAAAGAGGAAAAGAGG + Intergenic
1182232638 22:28850132-28850154 AGGCACAAAAAGACGAATATTGG - Intergenic
1183282732 22:36941101-36941123 AGGCAGATAAAGAGGAAAAGTGG - Intergenic
1185026287 22:48415079-48415101 AGGCCCACAAAGAGGAAAAGAGG - Intergenic
1185026291 22:48415099-48415121 AGGCCCACAAAGAGGAAAAGAGG - Intergenic
1185026295 22:48415119-48415141 AGGCCCACAAAGAGGAAAAGAGG - Intergenic
1185026299 22:48415139-48415161 AGGCCCACAAAGAGGAAAAGAGG - Intergenic
1185026303 22:48415159-48415181 AGGCCCACAAAGAGGAAAAGAGG - Intergenic
949766060 3:7527489-7527511 AGGCATCCAAACAGGAAAAGAGG - Intronic
949806607 3:7962275-7962297 AGGCAGGGAAAGATGAAAAGAGG + Intergenic
950683108 3:14598764-14598786 AGGAAGAGAAAGAAGAATAGAGG - Intergenic
951070466 3:18322435-18322457 AGGCATCCAAATAGGAAAAGAGG - Intronic
951422370 3:22502588-22502610 AGGAATAGAAAAATGAACAGTGG + Intergenic
951740638 3:25918829-25918851 AGGCATTCAAATAAGAAGAGAGG - Intergenic
951777927 3:26330477-26330499 AGGCATCCAAATAGGAAAAGAGG + Intergenic
952127795 3:30322290-30322312 AGGCATTCAAATAGGAAGAGAGG + Intergenic
952155935 3:30643660-30643682 AGGCATACAAAAATGTTTATTGG - Intronic
953155633 3:40369881-40369903 AGGCATCCAAATAGGAAAAGAGG + Intergenic
953816978 3:46166337-46166359 AGGCATCCAAATAGGAAGAGAGG - Intronic
955417011 3:58701832-58701854 TGGCATTCAAAGATGATTATTGG - Intergenic
955886378 3:63603307-63603329 AGGCATCCAAATAGGAAGAGAGG - Intronic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
956150964 3:66241825-66241847 AGGGAAACAAAGATGGAAAGAGG + Intronic
956561069 3:70575220-70575242 AGGCAAAGAAAGAGAAATAGGGG + Intergenic
956904496 3:73751775-73751797 AGGCATAGAAGAATGAAGAGAGG - Intergenic
956989064 3:74742454-74742476 AGGCATACAAAGTGGTATAATGG - Intergenic
957426329 3:80044584-80044606 AGGGATAAAAAGATAAAAAGTGG - Intergenic
957482628 3:80817957-80817979 AGGAATACAACTATCAATAGAGG + Intergenic
957486512 3:80869673-80869695 AGGCATCCAAATAGGAAGAGAGG + Intergenic
957737289 3:84218471-84218493 AGGCATCCAAATAGGAAGAGAGG + Intergenic
958875496 3:99611750-99611772 AGACATACAAATAGGAAGAGAGG - Intergenic
958998275 3:100931383-100931405 AGACATACAAATAGGAAGAGAGG + Intronic
959257671 3:104035486-104035508 AGGCATTCAAATAGGAAAAGTGG + Intergenic
959680215 3:109087253-109087275 AGGCATCCAAATAGGAAGAGAGG + Intronic
959881784 3:111451835-111451857 AGGCATCCAAATAGGAAGAGAGG + Intronic
960241880 3:115352639-115352661 AGGCAGAAAATGAAGAATAGAGG - Intergenic
960571052 3:119185661-119185683 AGGCATACAAAGATATGTAAGGG - Intronic
960711411 3:120533676-120533698 AGGCATCCAAATAGGAAAAGAGG - Intergenic
961938699 3:130613979-130614001 AGGCATCCAAATATGAAGAAAGG - Intronic
962470175 3:135700210-135700232 AGGCATCCAAATAGGAAGAGAGG + Intergenic
962619814 3:137166910-137166932 AGCCAACCAAAAATGAATAGAGG - Intergenic
963144970 3:141984198-141984220 AGACATAAAAAGATAAATATTGG + Intronic
963614920 3:147524653-147524675 AGGCATTCAAATAGGAAGAGAGG - Intergenic
963864324 3:150344073-150344095 TGGGATTCAAAGATGAATACAGG - Intergenic
964000347 3:151763710-151763732 GGGCATACAAATAGGAAGAGAGG - Intergenic
964593481 3:158394331-158394353 AGGCATTCAAATAGGAAAAGAGG + Intronic
964597680 3:158455170-158455192 AAGCATAGAAAAATGATTAGAGG - Intronic
965297207 3:166963668-166963690 AGGGAGACGAAGATGAAAAGAGG - Intergenic
966093151 3:176164583-176164605 AGGCATACAAAAACGTAAAGTGG + Intergenic
966270088 3:178094455-178094477 AGGCATTCAAATAGGAAAAGAGG + Intergenic
966361980 3:179139729-179139751 AGGCATCCAAACAGGAAGAGAGG + Intergenic
967946245 3:194806405-194806427 AGACATAGAAAGATGAGAAGGGG - Intergenic
968241021 3:197085376-197085398 AGTCATACAGAGAAGAATGGTGG - Intronic
969424945 4:7118660-7118682 AGGAATGGAAAGATGAATGGTGG + Intergenic
970169302 4:13273867-13273889 AGGCATCCAAAGAGGAAAAGAGG + Intergenic
970285081 4:14503544-14503566 AGGCATCCAAATAAGAAGAGAGG - Intergenic
970865786 4:20757159-20757181 TGGCATAAAGAGATGAAGAGAGG - Intronic
971057850 4:22933615-22933637 AGTTATACAAAGAGGAATGGAGG + Intergenic
971383960 4:26126213-26126235 TGGGATACAAAGATGAAAATTGG + Intergenic
971513034 4:27450963-27450985 AAACATACAAAAATGAATAGTGG - Intergenic
971658309 4:29378948-29378970 AGGCAGACAAAGATAATTTGAGG + Intergenic
971818639 4:31523102-31523124 AGGCATAGAAAGACAAATATTGG - Intergenic
971960904 4:33486077-33486099 TGGAATACAGAGATGTATAGTGG + Intergenic
972032850 4:34483980-34484002 AGGCACAAAAAGATGTATACTGG + Intergenic
972147054 4:36040801-36040823 AGGCATCCAAATAAGAAGAGAGG - Intronic
972177920 4:36430130-36430152 AGGCATCCAAATAGGAAGAGAGG + Intergenic
972236507 4:37140034-37140056 AGGCAAAAGAAAATGAATAGAGG - Intergenic
972933129 4:44099936-44099958 AGGCATCCAAATAGGAAGAGAGG - Intergenic
973195536 4:47435491-47435513 AGGCAAACAATGATAAACAGGGG - Intergenic
973286829 4:48427694-48427716 AAGCATACCAAGATGCCTAGTGG - Intergenic
974269971 4:59637790-59637812 AGGCATCCAAATAGGAAGAGAGG + Intergenic
974370304 4:61008206-61008228 AGGCATAAAAAGAAGCATATAGG - Intergenic
974460878 4:62186274-62186296 AGGCATTCAAATAGGAAGAGAGG - Intergenic
974808220 4:66909984-66910006 AGCCACACAAAGATGAGGAGAGG - Intergenic
974816069 4:67004815-67004837 ACGAAGACAAAGATGACTAGAGG - Intergenic
975479703 4:74863996-74864018 AGGCATTCAAATAGGAAGAGAGG + Intergenic
976267166 4:83195300-83195322 AGGCAGATAGAGATGAAAAGGGG + Intergenic
977345712 4:95813665-95813687 AGGCATCCTAATTTGAATAGAGG - Intergenic
977385273 4:96331379-96331401 AGGCATTCAAATAGGAAGAGAGG + Intergenic
977484272 4:97622304-97622326 AGGCATCCAAATAGGAAGAGAGG + Intronic
977508377 4:97931147-97931169 AGGCATCCAAATAGGAAGAGAGG - Intronic
977649195 4:99450213-99450235 AGGCATCCAAATAGGAAGAGAGG - Intergenic
977876953 4:102161500-102161522 AGACATACAAAAATGCATAATGG + Intergenic
977896054 4:102366360-102366382 AGGCATCCAAATAGGAAGAGAGG + Intronic
978046934 4:104141467-104141489 AGACATTCAAAGATCATTAGTGG - Intergenic
978156402 4:105494060-105494082 AGGTATACAAATATGAAGAGAGG - Intergenic
978165981 4:105607320-105607342 AAGCATGCAAAGATCAAAAGTGG - Intronic
978391648 4:108232915-108232937 AAGCATCCAAACAGGAATAGAGG - Intergenic
978923877 4:114218836-114218858 AGGCATCCAAATAGGAAGAGAGG + Intergenic
978940073 4:114425706-114425728 AGGCATCCAAATAGGAAGAGAGG - Intergenic
978948340 4:114525928-114525950 AGGTATTCAAAGAGGAAGAGAGG - Intergenic
980090539 4:128438455-128438477 AGGCATCCAAGTAGGAATAGAGG - Intergenic
980397434 4:132232690-132232712 AGGGATATAAAGTTGAAAAGGGG - Intergenic
980398088 4:132241928-132241950 AGGCATCCAAATAGGAAGAGAGG + Intergenic
980549528 4:134316455-134316477 AGGCAGACAAGGAGGAAGAGAGG + Intergenic
980688903 4:136265463-136265485 AGGCATTCAAACAGGAAAAGAGG + Intergenic
980697434 4:136377839-136377861 ATGCGTATAAAGATGGATAGTGG - Intergenic
981466477 4:145078049-145078071 AGGCATTCAAATAGGAAGAGAGG + Intronic
981854186 4:149267917-149267939 ATGCATACATAAATGAATAAGGG + Intergenic
982586105 4:157241744-157241766 AGCCATACAATGAGGAAGAGGGG - Intronic
982810242 4:159816645-159816667 AGGCATTCAAATAGGAAGAGAGG + Intergenic
983629122 4:169831709-169831731 AGGCATCCAAATAGGAAGAGAGG + Intergenic
983679601 4:170338078-170338100 AGGCATAGAAAGACAAATACTGG + Intergenic
984088519 4:175341761-175341783 AGGTAGACAAAGATTAATTGTGG - Intergenic
984136263 4:175943342-175943364 AGGTATTCAAATAGGAATAGAGG - Intronic
984230067 4:177085189-177085211 ATGCAGACAAAAATGAAAAGGGG + Intergenic
985186433 4:187321533-187321555 AGGCATCCAAATAGGAAGAGAGG + Intergenic
985395653 4:189540808-189540830 AGGCATCCAAATAGGAAGAGAGG + Intergenic
986328179 5:6696123-6696145 AGGCATACAGAGTGGTATAGTGG - Intergenic
986419139 5:7559639-7559661 AGGCATCCAAATAGGAAGAGGGG - Intronic
986651416 5:9966836-9966858 AGGCATAATAGGTTGAATAGTGG + Intergenic
986845905 5:11753142-11753164 AGGCATCCAAATAGGAAGAGAGG - Intronic
986904070 5:12472002-12472024 AGGCATCCAAATAAGAAGAGAGG + Intergenic
987451914 5:18095590-18095612 ATGAATAAAAAGATGAATACAGG + Intergenic
987553188 5:19410372-19410394 AGGCATCCAAATAGGAACAGAGG - Intergenic
987596384 5:20004802-20004824 ATGAATATAAAGAGGAATAGTGG + Intronic
987873732 5:23652574-23652596 AGGGATACATTGATGAAGAGGGG + Intergenic
989019092 5:36979549-36979571 AGGCATCCAAATAGGAAAAGAGG - Intronic
989281981 5:39655006-39655028 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
989484376 5:41972116-41972138 AGGCATCCAAATAGGAAGAGAGG + Intergenic
989824978 5:45842541-45842563 AGGCATCCAAATAGGAAGAGAGG - Intergenic
990272932 5:54164935-54164957 AGGCAGAAAAAGAAGAAAAGGGG - Intronic
990483894 5:56238548-56238570 AGGCATCCAAACAGGAAAAGAGG + Intergenic
990704206 5:58509586-58509608 AGGCATACAGAGTGGTATAGTGG + Intergenic
990859772 5:60314117-60314139 AGGCATCCAAATAAGAACAGAGG + Intronic
991121414 5:63019284-63019306 AGGCATCCAAATACGAAGAGAGG - Intergenic
991158219 5:63463379-63463401 AGGCATCCAAATAGGAAGAGAGG + Intergenic
991511356 5:67380107-67380129 AGCAAGACAAAGATGAATAAAGG - Intergenic
991526836 5:67568324-67568346 AGGCATACAAATAGGAAGAAAGG + Intergenic
991651216 5:68856175-68856197 GGGCATACAAATAGGAAGAGAGG - Intergenic
992073108 5:73166747-73166769 GGGCATAAAAATATGAAGAGAGG + Intergenic
993568572 5:89506943-89506965 AGGCATCCAAACAGGAAGAGAGG + Intergenic
993821642 5:92624984-92625006 AGGTATACAAAGATTTATATAGG - Intergenic
993916730 5:93752882-93752904 TAGCATACAACAATGAATAGAGG + Intronic
994129357 5:96207265-96207287 AGGCATCCAAATAGGAAGAGAGG - Intergenic
994228542 5:97284576-97284598 AGGCATCCAAATAGGAAAAGAGG - Intergenic
994348451 5:98716439-98716461 AGGCATCCAAATAGGAATAGAGG - Intergenic
994899278 5:105749237-105749259 AGGCACGCAAATAGGAATAGAGG - Intergenic
995293471 5:110487937-110487959 AGACATTCAAAGAAGAATGGTGG - Intronic
995302578 5:110601329-110601351 GGGCATTCAAATAGGAATAGAGG + Intronic
995715150 5:115075174-115075196 AGGCATTCAAATAGGAAGAGAGG + Intergenic
996599297 5:125243354-125243376 AGGCATCCAAACAGGAAGAGAGG - Intergenic
996599634 5:125246688-125246710 AGGCTTACAAAGTTGAGTTGAGG - Intergenic
996679813 5:126219893-126219915 AGGCATCCAAATAGGAAGAGAGG + Intergenic
996890805 5:128417315-128417337 AGGCATACAAATTAGAAAAGAGG - Intronic
996920148 5:128758643-128758665 AGGCATACAAATAAGAAGAGAGG + Intronic
997019789 5:129985994-129986016 AGGCATCCAAATAGGAAGAGGGG - Intronic
997115900 5:131125325-131125347 AGGCATCCAAATAAGAAGAGAGG + Intergenic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
1000273900 5:159715459-159715481 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1002717669 5:181238377-181238399 AGGTATACAGAGATAAATATTGG - Intronic
1002970919 6:2018524-2018546 AGGCATAGAAGGCTGACTAGTGG - Intronic
1003998194 6:11565118-11565140 AGGAACACTAAGATGACTAGAGG + Intronic
1004026074 6:11819831-11819853 AGGCACAAAAAGATGAAAAAGGG - Intergenic
1004797608 6:19105258-19105280 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1005097038 6:22128284-22128306 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1005825852 6:29631618-29631640 AGGCATACAGAGAGGAATGGTGG + Intronic
1005909863 6:30299569-30299591 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1006216759 6:32450340-32450362 AGGCATCCAAACAGGAAGAGAGG - Intergenic
1006217386 6:32456038-32456060 GGGCATTCAAAGAGGAAGAGTGG + Intergenic
1007199100 6:40090288-40090310 AGAAATGCAAAGATGAATATGGG + Intergenic
1007315052 6:40980763-40980785 AGGCATCCAAATAGGAAAAGAGG - Intergenic
1008168659 6:48173883-48173905 AGGCGTACAAAACTGAAAAGTGG + Intergenic
1009033169 6:58084846-58084868 AGGCATCCAAATAGGAATAAAGG + Intergenic
1009208777 6:60836617-60836639 AGGCATCCAAATAGGAATAAAGG + Intergenic
1009332573 6:62442001-62442023 GGGCATACAAATAGGAAAAGAGG - Intergenic
1009479201 6:64135168-64135190 AGGCACAGAAAGATGCAGAGAGG + Intronic
1009547256 6:65035377-65035399 AGGCATCCAAATAGGAAGAGAGG + Intronic
1009831300 6:68939407-68939429 ATGCATATAAAGGTGAAGAGGGG - Intronic
1009997443 6:70912093-70912115 AGGCATCCAAATAGGAAGAGAGG - Intronic
1010095058 6:72033143-72033165 AAGAATACAAAGATGAATTCTGG - Intronic
1010307269 6:74339748-74339770 AGGCATTCAATTATGAAAAGAGG - Intergenic
1010648685 6:78424910-78424932 AGGCAGATAGAGATGAAAAGGGG - Intergenic
1010654750 6:78499112-78499134 AGCCATCCAAATAGGAATAGAGG - Intergenic
1011584906 6:88913885-88913907 AGGCATCCAAATAGGAAGAGAGG + Intronic
1011614275 6:89183823-89183845 AGGCATACAGAGTGGTATAGTGG + Intronic
1012656500 6:101829422-101829444 AGGCATCCAAATAGGAAAAGAGG + Intronic
1013506004 6:110800977-110800999 AGGCATCCAAACAGGAAAAGAGG + Intronic
1013954879 6:115830403-115830425 AGGCAGACATAGAAAAATAGAGG - Intergenic
1014183778 6:118412390-118412412 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1015098533 6:129447138-129447160 AGGTACACAAAGACGAATAAAGG + Intronic
1015413768 6:132924885-132924907 AAAGATACAAAGATAAATAGTGG + Intergenic
1015586812 6:134784757-134784779 AGGAATAGCAAGATGAAAAGAGG + Intergenic
1015640525 6:135326928-135326950 AGGCATACAGAGAGGTATAATGG - Intronic
1016663404 6:146607357-146607379 AGGCATACAAATAGGAATAGAGG - Intronic
1016733137 6:147448179-147448201 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
1017762371 6:157579854-157579876 AGGCATTCAGATAAGAATAGAGG - Intronic
1018129940 6:160719591-160719613 AGGCAGAAAAAGATGAAAAAAGG - Intronic
1018147247 6:160903261-160903283 AGGCAGAAAAAGATGAAAAAAGG - Intergenic
1018649078 6:165976322-165976344 AGGTATACAAAGATGGTGAGAGG - Intronic
1019231788 6:170572038-170572060 AGGCATGAAAACATTAATAGTGG - Intronic
1019876081 7:3812027-3812049 AGGCATAAAAAGATAAATGATGG - Intronic
1020970362 7:14930669-14930691 AGGCATACAAACTGGAAAAGAGG - Intronic
1021259286 7:18433420-18433442 AGGCATCCAAATAGGAAGAGAGG + Intronic
1021824387 7:24533595-24533617 AGGCATCCAAATATGAGGAGAGG - Intergenic
1022075895 7:26970131-26970153 GGGCATACAAATAGGAAAAGAGG - Intronic
1022153704 7:27637619-27637641 AGGCATTCAAATATGAAGAGAGG + Intronic
1022468615 7:30667892-30667914 AAGGATACAAAGATGACAAGAGG + Intronic
1023721270 7:43097649-43097671 AAGCATGCAAAGATGAATTTTGG - Intergenic
1023734051 7:43219356-43219378 AGGCAGACAGAGAGGAAAAGGGG - Intronic
1024202924 7:47124909-47124931 AGGAATACAAAGCTGAATAGTGG - Intergenic
1024624696 7:51195961-51195983 GGGCATACAAATAGGAAGAGAGG - Intronic
1025821837 7:64969441-64969463 AGGCATCCAAATAAGAAAAGAGG - Intergenic
1026429654 7:70331989-70332011 AGGCATTCAAATAGGAAGAGAGG + Intronic
1026544066 7:71306415-71306437 AGACAGAGAAAGAAGAATAGTGG - Intronic
1026877209 7:73886624-73886646 AGGAAAACAGAGATGAACAGGGG - Intergenic
1027554327 7:79644420-79644442 AGGCATCCAAAAAGGAAGAGAGG - Intergenic
1027626669 7:80553382-80553404 AGGCATACAAAGTGGTATAATGG - Intronic
1029509439 7:100984555-100984577 ACACATAAAAAGATGAAAAGTGG - Intronic
1029955800 7:104638351-104638373 AGGCATTCAAATAGGAAGAGGGG - Intronic
1030721195 7:112872655-112872677 AGGCATCCAAATAGGAAGAGAGG + Intronic
1030816280 7:114041386-114041408 AGGCATCCAAAAAGGAAGAGAGG - Intronic
1031547125 7:123064455-123064477 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1031641184 7:124166047-124166069 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1031792192 7:126119850-126119872 AGGCAGAAACAGATGAAAAGTGG + Intergenic
1031888712 7:127268855-127268877 AGGCATCCAAATATGAAGAGAGG - Intergenic
1032361492 7:131259879-131259901 AGGCATCCAAATAGGAAAAGAGG + Intronic
1032599936 7:133283026-133283048 AGACACAGAAAGATGAATATTGG - Intronic
1032630418 7:133644966-133644988 ACACATACAAAGATGCAAAGGGG - Intronic
1032647678 7:133843629-133843651 AGGCATCCAAATAGGAAGAGAGG - Intronic
1033865816 7:145689174-145689196 AGGCATAAAAATGTGAATACTGG + Intergenic
1033938347 7:146617913-146617935 AGGCATATACATATGAATTGAGG - Intronic
1034029488 7:147744418-147744440 TGGCATATAAAGTTGAATAATGG - Intronic
1034281552 7:149858485-149858507 AGCGATCCAAAGATGAGTAGTGG + Intronic
1035983948 8:4404487-4404509 AGTGATACAAAGATGAGCAGTGG + Intronic
1036492034 8:9236648-9236670 TGGAAAACAAAGATGAAAAGTGG - Intergenic
1036540093 8:9698643-9698665 TGGCATGCAAAAATGAATAAAGG - Intronic
1036986956 8:13543802-13543824 AGGCATACAAAGTGGTATAATGG + Intergenic
1037371095 8:18179919-18179941 AGATATACAAAGAATAATAGAGG + Intronic
1038093750 8:24284412-24284434 AGGCATTCAAATAGGAAAAGAGG + Intergenic
1038368791 8:26966687-26966709 AGGAATGCAAAGATGACTACTGG - Intergenic
1039264814 8:35813202-35813224 AGGCATCCAAATAAGAAGAGAGG + Intergenic
1039289642 8:36080037-36080059 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1039302550 8:36224906-36224928 AGGCATACAGACAAGATTAGAGG + Intergenic
1039367245 8:36942658-36942680 AGGCATGCAAATAGGAAGAGGGG + Intergenic
1040435827 8:47390549-47390571 AGGCATAGAAAGAGAAATATAGG + Intronic
1040443361 8:47467884-47467906 AGGCATCTAAATAGGAATAGAGG + Intronic
1041220308 8:55644378-55644400 AGGCATTCAACTAGGAATAGAGG - Intergenic
1041333810 8:56757477-56757499 AGACCTCCAAAGATGAATACAGG - Intergenic
1043104757 8:76093796-76093818 AGGCATACAAAGTGGTATACAGG - Intergenic
1043283309 8:78496929-78496951 AGGAAGACAAAGAAGAATAGGGG - Intergenic
1043396963 8:79847242-79847264 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1043423859 8:80129180-80129202 AGGCAAGCAGATATGAATAGTGG - Intronic
1043923511 8:86010850-86010872 AGGCATTCAAATAGGAAGAGAGG - Intronic
1044193668 8:89349598-89349620 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1044199963 8:89422929-89422951 AGGCATCCAAATAGGAAAAGAGG + Intergenic
1044201159 8:89439695-89439717 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1044312138 8:90706155-90706177 GGGCATCCAAATATGAAGAGAGG - Intronic
1044551910 8:93521936-93521958 AGGGTTACAAAGATAAATAAAGG - Intergenic
1044968502 8:97596755-97596777 AAGCATAAAAAGATAAATAAAGG - Intergenic
1045936167 8:107681806-107681828 AGGCAGAAAAATATGAAAAGGGG - Intergenic
1046058671 8:109109782-109109804 AGGCACACATACATGAAGAGTGG - Intronic
1046282792 8:112055681-112055703 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1046453125 8:114419961-114419983 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1046668091 8:117027186-117027208 AGGGATAGAAAGTTGAATACAGG + Intronic
1046855666 8:119028948-119028970 AGTAATTCAAAGATGAATAAAGG + Intronic
1047068431 8:121314396-121314418 AGGCATCCACAGATTTATAGTGG + Intergenic
1047159230 8:122358334-122358356 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1047670925 8:127146069-127146091 AGGCCTGCAAAAATGGATAGGGG - Intergenic
1048656066 8:136537386-136537408 AGGCATACATATATGGAGAGAGG - Intergenic
1048816763 8:138341372-138341394 AGAGATACAAAGTTGAATGGTGG + Intronic
1049506561 8:143003927-143003949 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1050693737 9:8257184-8257206 AGGCATACGAAAATGATAAGTGG - Intergenic
1051311102 9:15773768-15773790 AGAAAAACAAAGATAAATAGAGG + Intronic
1051861600 9:21631271-21631293 AGGCATCCAAATAAGAAGAGAGG + Intergenic
1051891901 9:21950867-21950889 AGGCATCCAAATAGGAAGAGAGG + Intronic
1051899297 9:22021755-22021777 AGGCATCCAAATAAGAAGAGAGG - Intronic
1052173722 9:25432047-25432069 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1052402427 9:28017366-28017388 AGGCATGCAAATAGGAAGAGAGG + Intronic
1052482234 9:29046099-29046121 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1052520067 9:29535362-29535384 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1054865106 9:69992039-69992061 AGGCATACAAAGTGGTATAATGG + Intergenic
1054968198 9:71054063-71054085 AGGCATACATATATCAATGGTGG - Intronic
1054975432 9:71138282-71138304 AGGCATAGACAGAGGCATAGAGG - Intronic
1055023812 9:71697964-71697986 AGGTAAACAAGGATGAAAAGTGG - Exonic
1055349821 9:75375017-75375039 AGTCATATAAAGAAGAGTAGTGG - Intergenic
1055816783 9:80215706-80215728 AGGCATACAAATTGGAAAAGAGG + Intergenic
1055817751 9:80227411-80227433 AGGCATCCAAACAGGAAAAGGGG - Intergenic
1055829805 9:80364845-80364867 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1056877788 9:90351406-90351428 AGGCATCCAAACAGGAAGAGAGG + Intergenic
1057175048 9:92990383-92990405 AGGCATCCAAATGGGAATAGAGG - Intronic
1057697233 9:97332833-97332855 AGGCATCCAAATAGGAAGAGAGG - Intronic
1058238567 9:102525344-102525366 AGGCATCCAAACAAGAAGAGAGG - Intergenic
1058720939 9:107763018-107763040 AGTCACACAAAGATAAATATAGG - Intergenic
1058831171 9:108818116-108818138 AGGCATCCAAATAGGAATAGAGG + Intergenic
1058916571 9:109572341-109572363 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1059036417 9:110758597-110758619 AGGCATCCAAATAGGAAGAGGGG + Intronic
1059622718 9:116025834-116025856 AGGCATACAAATATGAAGAGAGG - Intergenic
1059883998 9:118724539-118724561 AGGCATCCAAACAGGAAGAGAGG - Intergenic
1060227761 9:121805781-121805803 AGAGATAGAAAGTTGAATAGTGG + Intergenic
1186679519 X:11856734-11856756 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1187251490 X:17602439-17602461 AGGCTTTCAAGGATGAAAAGGGG + Intronic
1187644613 X:21333566-21333588 AGGCATCCAAATAGGAACAGAGG + Intergenic
1188206404 X:27364313-27364335 ATGCATAGAGACATGAATAGAGG - Intergenic
1188297989 X:28473221-28473243 AGGCATCCAAATAGGAACAGAGG + Intergenic
1189237585 X:39499584-39499606 AGGCATACAGAGTGGTATAGTGG - Intergenic
1189659499 X:43281797-43281819 AGGCATCCAACTATGAAGAGAGG - Intergenic
1190606341 X:52147292-52147314 AGGCATTCAATGAGGAAAAGAGG - Intergenic
1191126461 X:56960256-56960278 AGGCATATAAAGACAAATATTGG + Intergenic
1191605154 X:63053470-63053492 AGGCATGCAAATTGGAATAGAGG - Intergenic
1191651712 X:63545503-63545525 GGGCATCCAAATAGGAATAGAGG + Intergenic
1191747456 X:64505023-64505045 AGGCATCCAAATAAGAAGAGAGG + Intergenic
1191959300 X:66682426-66682448 AGGCATCCAAATATGAAGAGAGG - Intergenic
1192766988 X:74150443-74150465 AGGCATGCAAATAGGAAGAGAGG + Intergenic
1192866280 X:75136006-75136028 AGGCATCCAAATAGGAAGAGAGG + Intronic
1192870814 X:75181809-75181831 AGGCATTCAAATAGGAAGAGAGG - Intergenic
1193236992 X:79119383-79119405 AGGCATCCAAATTTGAAAAGAGG - Intergenic
1193359747 X:80567316-80567338 AGGCATCCCAATATGAAAAGAGG - Intergenic
1193746794 X:85291885-85291907 AGGCATCCAAATAGGAAGAGAGG - Intronic
1193863766 X:86703448-86703470 AGACATACAAATAGGAAAAGAGG + Intronic
1193970857 X:88050359-88050381 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1193985525 X:88236947-88236969 GGGCATCCAAATAGGAATAGAGG - Intergenic
1194013312 X:88588149-88588171 AGGCATCCAAACAGGAAGAGAGG + Intergenic
1194014655 X:88604491-88604513 AGGCATCCAAAAAGGAATAGAGG - Intergenic
1194070770 X:89323140-89323162 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1194203921 X:90987677-90987699 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1194226521 X:91266478-91266500 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1194356564 X:92892280-92892302 AGGCATCCAAATAAGAAGAGAGG - Intergenic
1194504206 X:94712695-94712717 AGGCATCCAAATAAGAAGAGAGG + Intergenic
1195448514 X:104981540-104981562 AGGCATCCAAACAAGAAGAGAGG - Intronic
1195544083 X:106095745-106095767 AGGCATCCAAATAGGAACAGAGG - Intergenic
1195610352 X:106859659-106859681 AGGCATCCAAATAGGAAGAGAGG - Intronic
1195651066 X:107285588-107285610 AGACATAGAAAGTAGAATAGTGG + Intergenic
1196052129 X:111316604-111316626 AGGCATCCAAATAGGAAGAGAGG + Intronic
1196185255 X:112738625-112738647 AAGTGTACACAGATGAATAGTGG - Intergenic
1196250535 X:113454883-113454905 AAGCATACAAAAATGTAAAGTGG - Intergenic
1196475677 X:116082077-116082099 AGGCATACAAATTAGAAAAGAGG + Intergenic
1197094623 X:122578579-122578601 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1197285379 X:124588862-124588884 AGGCATCCAAATAGGAAGAGAGG - Intronic
1197987608 X:132283637-132283659 AGGCATACAAAGTGGTATACTGG - Intergenic
1198269690 X:135044323-135044345 AGGCATCCAAAAAGGAAGAGAGG - Intergenic
1198326184 X:135575975-135575997 AAGCATAGAAAGATAAATTGAGG - Intronic
1198526918 X:137510470-137510492 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1198579040 X:138043125-138043147 AGGTATTCAAATATGAAGAGAGG + Intergenic
1198743677 X:139867657-139867679 AGCCTTTCAAAGATGAGTAGGGG + Intronic
1198842099 X:140868256-140868278 AGGCATCCAAATAGGAATAGAGG + Intergenic
1199213527 X:145241998-145242020 AGAGATACAAAGTAGAATAGTGG + Intergenic
1199272076 X:145895957-145895979 AGGCATGCAAATATGAAGAAAGG - Intergenic
1199365674 X:146979408-146979430 AGGCATCCAAACAGGAAGAGAGG - Intergenic
1199379871 X:147157852-147157874 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1199407691 X:147481867-147481889 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1199561272 X:149165398-149165420 ATGCATCCAAATATGAAGAGAGG + Intergenic
1199636231 X:149814661-149814683 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1199644236 X:149890218-149890240 AGGCATCCAAATAGGAAGAGAGG + Intergenic
1199667425 X:150110077-150110099 AGGCAGAAAAAGAGGAATATGGG - Intergenic
1199786222 X:151107898-151107920 AGGCATCCAAATAGGAAGAGAGG - Intergenic
1200358353 X:155576025-155576047 AGGCATCCAAATAGGAAGAGAGG + Intronic
1200549758 Y:4563126-4563148 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1200553231 Y:4603831-4603853 AGGCAGATAAAGAGGAAAAGAGG - Intergenic
1200664899 Y:6009280-6009302 AGGCATCCAAATAAGAAGAGAGG - Intergenic
1200725007 Y:6658886-6658908 AGGCATTCAAATAGGAAGAGAGG + Intergenic
1201579626 Y:15497003-15497025 AGGCATACAATGAAGAGTAGAGG - Intergenic
1201589549 Y:15599935-15599957 AGGCACACAATGAAGAATGGAGG + Intergenic
1201617411 Y:15916393-15916415 TGACATACAAATATGAAAAGAGG + Intergenic
1201761289 Y:17541640-17541662 TAGCATACAAATATGATTAGAGG - Intergenic
1201840263 Y:18364350-18364372 TAGCATACAAATATGATTAGAGG + Intergenic