ID: 906162388

View in Genome Browser
Species Human (GRCh38)
Location 1:43659935-43659957
Sequence CTGTGGATATGTAGGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906162381_906162388 12 Left 906162381 1:43659900-43659922 CCTTAGCTCTTCACATGCTGCTG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG 0: 1
1: 0
2: 2
3: 9
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906162388 Original CRISPR CTGTGGATATGTAGGGACCT TGG Intronic
900160192 1:1219677-1219699 CTTGGGATGTGTGGGGACCTCGG - Intronic
900200234 1:1401453-1401475 CTGTGTAAATGTAGGGGCATCGG + Intronic
901109235 1:6782371-6782393 CAGTGGTTCTCTAGGGACCTTGG - Intergenic
901380856 1:8873096-8873118 GGGTGGATATGTAGGGAGCCAGG - Intronic
902915551 1:19636958-19636980 CTGTGGATATGTGTGGGCCACGG + Intronic
903658386 1:24962634-24962656 CTGTGGAGATGTTTGGATCTGGG - Intronic
903819629 1:26092092-26092114 CTGTGCATGTGTAGGGGCCAGGG + Intergenic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
906781326 1:48575581-48575603 CTGTGGACATGTCTGGGCCTTGG - Intronic
907896853 1:58700231-58700253 TTGTTGACATGTAGAGACCTTGG + Intergenic
910153634 1:84186770-84186792 GGGTGTCTATGTAGGGACCTGGG + Intronic
912474313 1:109925832-109925854 CTGTGGCTAGGCAGGGAGCTGGG - Intronic
913929777 1:124941583-124941605 TTGTGGATATTTGGGGATCTAGG - Intergenic
919072247 1:192771116-192771138 CTGTGAAAATGTAGAGAACTGGG + Intergenic
919294036 1:195671214-195671236 CTGTGGATCTGTTTGGTCCTGGG - Intergenic
919399167 1:197087670-197087692 GTGTTGATATGTAGTGATCTAGG - Intronic
920189071 1:204180790-204180812 CTTGGGATCTGTAGGGGCCTGGG + Intergenic
922910319 1:229210353-229210375 CTGTGGCTATGTAGTGACCTCGG - Intergenic
1066025273 10:31351078-31351100 GTGTGAATATGCAGGGACTTGGG + Intronic
1066753023 10:38679122-38679144 CTGTGAATCTGTTGGGTCCTGGG - Intergenic
1067472091 10:46544864-46544886 GTGTGGATTTGGAGGGACCTGGG + Intergenic
1069621896 10:69842504-69842526 CCTTGGACATGTAGTGACCTGGG - Intronic
1072646444 10:97258911-97258933 CTGTAGATATGTAGTCTCCTTGG - Intronic
1072720934 10:97780773-97780795 CTATGGCTATGTGGGGCCCTTGG + Intergenic
1072896792 10:99374310-99374332 CAGTGGATGGGTAGGGCCCTGGG + Intronic
1073962684 10:108952058-108952080 CTGTGAATCTGTCTGGACCTGGG - Intergenic
1074209838 10:111320491-111320513 CTGAGGATATGTAGGAATCTAGG + Intergenic
1076693347 10:132234917-132234939 ATGTGGCTGTGAAGGGACCTAGG + Intronic
1078706917 11:13752862-13752884 CTGTGAATCTGTATGGTCCTGGG - Intergenic
1078722370 11:13896918-13896940 CTTTGAATATCTAGGGAGCTGGG - Intergenic
1080167059 11:29251239-29251261 CTGTGCATGTGTAGGGACAGGGG + Intergenic
1080502868 11:32887069-32887091 CTACGGATATGGAGGGACTTTGG - Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1081437504 11:43042960-43042982 CTGTGGATCTCTAGGGTTCTAGG - Intergenic
1081695881 11:45108737-45108759 CTGTAGCTATGTGGGGACCCAGG + Intronic
1083594172 11:63911145-63911167 CTGTGGGTAAGTGGGGAGCTGGG - Intergenic
1084376701 11:68782927-68782949 CTGTGGGTCTGTAGGCGCCTCGG - Intronic
1084868331 11:72078844-72078866 CTGTGAATATATGGGAACCTGGG - Intronic
1085253530 11:75159379-75159401 CTGCGGGAATGAAGGGACCTGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086129534 11:83386505-83386527 CTGTGAATCTGTTTGGACCTGGG - Intergenic
1086260527 11:84934480-84934502 CTGTGAATCTGTATGGTCCTGGG + Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091845578 12:3653792-3653814 CTGTGGTCGTGTAGAGACCTGGG - Intronic
1093689828 12:22098128-22098150 CTGTGGATCTGTCTGGTCCTGGG + Intronic
1094252834 12:28385797-28385819 CTGTGGATTTGTTGGGACAATGG + Intronic
1095739735 12:45593617-45593639 CTATGGATATGTGGGGACATGGG + Intergenic
1096119130 12:49075606-49075628 CTGTGGATACCTGGGGGCCTTGG - Intergenic
1103718321 12:122959618-122959640 CTCTGGGTAAGTAAGGACCTCGG - Exonic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1106926067 13:34614469-34614491 CTATGCATATGTAGGGACAGGGG - Intergenic
1107241035 13:38234295-38234317 CTGTGAATATGTCTGGTCCTGGG - Intergenic
1107482780 13:40798776-40798798 CAGTGAATATGTAGGAGCCTGGG - Intronic
1108439212 13:50432507-50432529 CTTTGGTTATATAGGGTCCTTGG + Intronic
1109003769 13:56841826-56841848 CTGTCATTATTTAGGGACCTGGG - Intergenic
1110954402 13:81536063-81536085 CTGTGGATCTGTCTGGTCCTGGG - Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1112917000 13:104564093-104564115 AAGTGGAAATGTAGAGACCTGGG - Intergenic
1114030511 14:18574964-18574986 CTGTGAATATGTCTGGTCCTCGG + Intergenic
1117458504 14:55921546-55921568 TTTTGTATATGTAGGGACCGAGG + Intergenic
1121664206 14:95659398-95659420 CAGTGAATATGCAGGGTCCTGGG + Intergenic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1125801331 15:42450687-42450709 GTTTGGATATGTAAGGACCATGG + Exonic
1126279672 15:46930345-46930367 CTGTGCATATGTAGGGCCAGAGG - Intergenic
1126500136 15:49336301-49336323 CTGTGGATATGTCCTAACCTTGG + Intronic
1126923731 15:53558079-53558101 CTGTGGAAAGATAGTGACCTGGG - Intronic
1132456281 16:25204-25226 CTGTAAATATGTATGGTCCTGGG + Intergenic
1132636573 16:952750-952772 GTGTGGATGTGTAGGAAGCTGGG - Intronic
1133411472 16:5572778-5572800 CTGTGGATATTTAGGGCAATCGG + Intergenic
1135517405 16:23147627-23147649 CTGGGGGTATGTATGGCCCTTGG - Intronic
1136729670 16:32397869-32397891 CTGTGAATCTGTTGGGTCCTGGG + Intergenic
1137579374 16:49623870-49623892 CTGTGGCTAGGTAGGGACCAGGG + Intronic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1141527649 16:84622236-84622258 CTATGAATGTGTAGGGAACTGGG + Intergenic
1202996726 16_KI270728v1_random:119425-119447 CTGTGAATCTGTTGGGTCCTGGG - Intergenic
1203023413 16_KI270728v1_random:431767-431789 CTGTGAATCTGTTGGGTCCTGGG - Intergenic
1146307473 17:31741633-31741655 CTTTGGATATGGAGGGCTCTGGG + Intergenic
1146841905 17:36162106-36162128 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1146854216 17:36250066-36250088 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146870119 17:36373958-36373980 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146877476 17:36425039-36425061 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147073000 17:37974582-37974604 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147084522 17:38054120-38054142 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147100469 17:38178086-38178108 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1150083410 17:62261132-62261154 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1150526755 17:65931756-65931778 CTGCAGATATGCAGGGATCTGGG - Intronic
1151264612 17:72945129-72945151 CTGGGGATATTTTGGGACTTAGG - Intronic
1151564389 17:74889485-74889507 CTGTGTATATGTTGGGGCGTTGG - Intronic
1154102315 18:11487541-11487563 CTGGGGATATGCAGGCATCTGGG - Intergenic
1158121343 18:54051651-54051673 CTGTGGAAATGTAGGTTCCCAGG - Intergenic
1161616647 19:5274539-5274561 GTGGGGATATGTGGGCACCTGGG - Intronic
1164188950 19:22897987-22898009 ATCTGGATATCTAGTGACCTTGG + Intergenic
1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG + Intergenic
925647243 2:6048456-6048478 CTGTGAATCTGTAGGGTCCTGGG - Intergenic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926987017 2:18635736-18635758 CTGTGAATCTGTATGGTCCTGGG + Intergenic
927408106 2:22795518-22795540 CCGTGGTTCTGCAGGGACCTGGG - Intergenic
928122712 2:28594759-28594781 TTGTGGAAACGCAGGGACCTTGG - Intronic
928443905 2:31316118-31316140 CTGTGGAAATGAAGAGACATGGG - Intergenic
928656155 2:33453709-33453731 ATGAGGATATGTAAGGATCTTGG + Intronic
930878299 2:56244562-56244584 CTGTGGATAAGCTGGTACCTAGG + Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
934126440 2:88897375-88897397 TTGTGGATATGCAGGGGACTTGG - Intergenic
934185974 2:89675912-89675934 CTGTGAATCTGTTGGGTCCTAGG + Intergenic
934549371 2:95245896-95245918 CTGTGAATATGTCTGGTCCTGGG - Intronic
934943690 2:98520894-98520916 CTGTGGATGGGAAGGCACCTTGG + Intronic
937884396 2:126890083-126890105 CTGGGGGTATTTACGGACCTAGG - Intergenic
938536120 2:132250526-132250548 ATGTGAATATTTGGGGACCTCGG + Intronic
942859983 2:180597980-180598002 CTGTGAAAATGCAGGGACCTGGG - Intergenic
943911202 2:193570247-193570269 CTGTGAATCTGTTGGGTCCTGGG + Intergenic
945971310 2:216234336-216234358 ATGTGGAGATGCAGGGACTTTGG + Intergenic
947100988 2:226621045-226621067 AGGTGGAGATGTAGGCACCTCGG + Intergenic
948559480 2:238842039-238842061 CTAGGGATATGTAGGGAAATGGG - Intergenic
1171046277 20:21811439-21811461 CTTTGGAACTGTAGGGAACTTGG + Intergenic
1173001153 20:39106665-39106687 CTGTGGTGATGCAGGGACCCAGG + Intergenic
1174516027 20:51093096-51093118 CTGTTGATATGTGGGGCACTTGG + Intergenic
1175378025 20:58542661-58542683 CTGTGGACATGAAGGCACCCTGG - Intergenic
1175613648 20:60373717-60373739 CTGCAGATATGTGGGGACTTGGG + Intergenic
1175965672 20:62658932-62658954 CGGAGGATCTGTAGGGGCCTTGG + Intronic
1177878610 21:26666149-26666171 CTGTGGATCTGTCTGGTCCTGGG + Intergenic
1178222182 21:30672354-30672376 CTGTGGTTAGTTAGGAACCTAGG + Intergenic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1179807938 21:43851936-43851958 CTGTGACTACGGAGGGACCTAGG - Intergenic
1180454625 22:15502020-15502042 CTGTGAATATGTCTGGTCCTCGG + Intergenic
1180542795 22:16467171-16467193 CTGTGAATCTGTTGGGTCCTGGG - Intergenic
1181116598 22:20635659-20635681 CGGTGGGTATGGAGGGGCCTTGG + Intergenic
1183299586 22:37052222-37052244 CTGTGGACAGGGAGAGACCTGGG + Intronic
1183506277 22:38210744-38210766 TTGTGGATATCTAGGGAACAAGG + Intronic
950477589 3:13223676-13223698 CTGGGGACATGCAGGGACCGCGG + Intergenic
953882857 3:46700621-46700643 CTGAGGAGATGTAGAGACCTGGG - Intergenic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
956600826 3:71020467-71020489 CTTTGGTTAAGTAGTGACCTTGG - Intronic
956848644 3:73207379-73207401 CTGTGGAGATGAAGGGATTTGGG + Intergenic
958613946 3:96466429-96466451 CTGTGGATTAGCAGTGACCTGGG + Intergenic
959331947 3:105017472-105017494 CTGTGCATGTGTAGGGACAGGGG + Intergenic
960782823 3:121338930-121338952 CTGTGAATTTGTATGGCCCTTGG - Intronic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
970101493 4:12527676-12527698 CTGTGAATCTGTATGGTCCTGGG - Intergenic
971750712 4:30644304-30644326 ATTTTGATATATAGGGACCTAGG - Intergenic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
973027403 4:45290016-45290038 CTGTGGATCTGTCTGGTCCTGGG + Intergenic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
977948291 4:102939434-102939456 CTGTGAATCTGTTGGGTCCTGGG - Intronic
978041183 4:104064705-104064727 CTGAGGATATGCAGTGAACTCGG - Intergenic
978431584 4:108638779-108638801 CTGTGGAGAGGAAGGGACCAAGG - Intergenic
979411775 4:120388062-120388084 CTGTGGTTATGCAGAGACCAAGG + Intergenic
981630038 4:146807769-146807791 CTGTGGATCTGTCTGGTCCTGGG - Intronic
983188160 4:164724599-164724621 CTGTGGATATGTAATTACTTGGG - Intergenic
983976664 4:173943142-173943164 ATGTGGAGATGTATGCACCTTGG - Intergenic
986135649 5:4975141-4975163 CTGTGGATATGCAAGCTCCTGGG - Intergenic
994907919 5:105864775-105864797 CTGTGAATATGTCTGGTCCTGGG - Intergenic
997701343 5:135902245-135902267 CTGTGGATACGGTGGGTCCTGGG + Intergenic
1000161270 5:158599893-158599915 CTGTGAATATGTGGGAACCAGGG + Intergenic
1000224493 5:159247219-159247241 CTATGGATCCTTAGGGACCTGGG + Intergenic
1004576662 6:16902763-16902785 CTGTGGAACTCTAGGGAACTTGG - Intergenic
1004615276 6:17282434-17282456 CTGAGGCTGAGTAGGGACCTGGG + Intronic
1006195859 6:32241927-32241949 CTGTGGAAGTGAAAGGACCTTGG + Intergenic
1007043255 6:38745204-38745226 GTGTGGATATTTAGGGTCATGGG + Intronic
1009321080 6:62289112-62289134 GAGTGTATATGTAGGGCCCTTGG - Intergenic
1010780968 6:79946416-79946438 CTGTATATATGTAGGCATCTGGG + Intronic
1015376483 6:132515899-132515921 CTGTGTATATGCAGGGGGCTTGG - Intergenic
1015386391 6:132629042-132629064 CTGTGAATCTGTCTGGACCTGGG + Intergenic
1023929476 7:44696578-44696600 CTGTGGAAATGTTGGGGCCCAGG + Intronic
1023943029 7:44782201-44782223 CAGTGGATATGTATGAGCCTGGG - Intergenic
1024697726 7:51873446-51873468 CAGTGGATATTTTGAGACCTAGG + Intergenic
1024752623 7:52486254-52486276 CTGTGTATATGTATGTACATAGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1032922178 7:136561494-136561516 CTGTGAATCTGTTGGGTCCTGGG + Intergenic
1034228425 7:149500427-149500449 CTGTGTAGATGTAGGGACTATGG + Intergenic
1034876651 7:154730298-154730320 CTGTGGAGCTGCAGGGACCCAGG + Intronic
1037377905 8:18251479-18251501 CCATGGATATGTATGGACTTGGG - Intergenic
1040401778 8:47057751-47057773 CTGTGAATCTGTATGGCCCTGGG - Intergenic
1041390951 8:57347143-57347165 CTGAGGATCTGGAGGGTCCTTGG + Intergenic
1042582334 8:70293639-70293661 CTGTGGATTTATATAGACCTTGG - Intronic
1047959076 8:129997753-129997775 CTGTGGATTTGCAGGTTCCTTGG + Intronic
1050243587 9:3663165-3663187 CTGGGGATATTCAGTGACCTCGG + Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1051243725 9:15087086-15087108 CTGTGGAGACTTAGGGAACTTGG - Intergenic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1057759254 9:97859543-97859565 CTGAGGCACTGTAGGGACCTTGG + Intergenic
1185430808 X:10674-10696 CTGTGGGGATTTAGGGACTTGGG + Intergenic
1185440074 X:223071-223093 CTGTGGGGATTTAGGGACTTGGG + Intergenic
1188134508 X:26478531-26478553 TTTTGGGTATTTAGGGACCTTGG - Intergenic
1189652028 X:43200405-43200427 CTGTGAATATGTCAGGTCCTGGG + Intergenic
1190997177 X:55621158-55621180 CTCGGGATAGGTTGGGACCTGGG + Intergenic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1193354266 X:80499066-80499088 CTGTGGATCTGTCTGGTCCTGGG + Intergenic
1194789446 X:98128271-98128293 CTGTGAATCTGTTGGGTCCTGGG + Intergenic
1195305700 X:103581270-103581292 CTGTGAATATGTCTGGTCCTGGG - Intronic
1199827830 X:151516903-151516925 CTGTGGCTAGGCAGGGACCTTGG + Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1200400082 X:156014520-156014542 CTGTAAATATGTATGGTCCTGGG - Intergenic
1201183679 Y:11376108-11376130 CTGTGAATCTGTTGGGTCCTGGG - Intergenic
1201595638 Y:15665383-15665405 CTGTTAATATGTCTGGACCTGGG + Intergenic