ID: 906163169

View in Genome Browser
Species Human (GRCh38)
Location 1:43666193-43666215
Sequence CTATAAGAACAGAGGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906163167_906163169 -4 Left 906163167 1:43666174-43666196 CCTAAATAGTTTCAAAGCTCTAT 0: 1
1: 0
2: 1
3: 22
4: 261
Right 906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906163169 Original CRISPR CTATAAGAACAGAGGCAGCT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901105216 1:6750131-6750153 CTATAAGAAGAAAGACAGCCAGG - Intergenic
902757373 1:18557847-18557869 CTCTAAGAACAGCCACAGCTAGG - Intergenic
903397611 1:23013991-23014013 CCATAGGAGCAGTGGCAGCTTGG - Exonic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
905889827 1:41512055-41512077 CTCAAAGAACACAGGCAGATGGG + Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
907024687 1:51104825-51104847 GTATAACAACAGAGGCAGTTTGG - Intronic
908286535 1:62610142-62610164 CTATAAAAACTGAGTCGGCTGGG - Intronic
910813733 1:91265685-91265707 CAACTAGAACAGAGGCAGATAGG - Intronic
915292588 1:154896603-154896625 GTATAAGAACAGAGCTAGCATGG - Intergenic
915389274 1:155526726-155526748 CTATAGGAACAGACACAGGTAGG - Intronic
916079431 1:161223271-161223293 ATATAAGAGCACAGGCAGATAGG + Intronic
917199497 1:172500009-172500031 CATTGAGAAGAGAGGCAGCTGGG - Intergenic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
918951277 1:191142872-191142894 CTCAAAGAACAGTGGCAGGTAGG - Intergenic
919169077 1:193931095-193931117 CTAGAAGAACAGTGGCATATAGG - Intergenic
1063352950 10:5373474-5373496 TTGTTAGAACACAGGCAGCTGGG + Intronic
1064723910 10:18258037-18258059 GTATAAGAACTGAGGAGGCTGGG - Intronic
1065255707 10:23865592-23865614 CTATAAAAAAAAAGGCAGTTTGG - Intronic
1074593924 10:114842358-114842380 CTATAAGAACGCAAGAAGCTGGG - Intronic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1078403552 11:11048077-11048099 CTACCAGGACACAGGCAGCTGGG - Intergenic
1078734344 11:14006410-14006432 AGATAAGAACAGAGGCAGGAAGG + Intronic
1079729765 11:23925370-23925392 CTTTGAGAACAGAGGGAGTTTGG - Intergenic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086524188 11:87705284-87705306 CTATAATAACAAAAGCAGCTTGG - Intergenic
1088224313 11:107602988-107603010 CTCCCAGAACAGAGGCAGCCAGG - Intronic
1089027376 11:115285721-115285743 CTAAGAGCACACAGGCAGCTGGG + Intronic
1091534724 12:1395045-1395067 CTTTGAGAACAGATACAGCTGGG + Intronic
1091804449 12:3346018-3346040 TTTTGAGAACTGAGGCAGCTGGG + Intergenic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1092496174 12:8997373-8997395 CTAGAACAACAGACGCAGCAGGG - Intronic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1096181530 12:49553768-49553790 CTTGTAGAGCAGAGGCAGCTAGG + Intronic
1096817057 12:54208475-54208497 CTAGAAGAGCAGAGGAAGATGGG + Intergenic
1097392391 12:59031529-59031551 CTAGCACAACAGAGGCAGCTGGG - Intergenic
1099189382 12:79547158-79547180 CTATAGGAACAGAGGCCTCTGGG - Intergenic
1101590122 12:106118096-106118118 CCACAAGTACAGAGGCAACTTGG - Intronic
1101672825 12:106892558-106892580 CTCTAAGAACACTGGCAGCCAGG + Intergenic
1101951135 12:109176078-109176100 CTACCAGGACAGAGGCAGTTCGG - Intronic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103870888 12:124090786-124090808 CTATAAAAACAAAGGAAGCCTGG + Intronic
1104443585 12:128815388-128815410 CTTTAAAAACAGAGTCCGCTGGG + Intronic
1104889188 12:132132160-132132182 CTATGAGAACAGAGCCCGCAGGG - Intergenic
1105239477 13:18597389-18597411 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
1107657666 13:42608546-42608568 ATATAAGAAAATAAGCAGCTTGG + Intergenic
1109501793 13:63246871-63246893 CAAGAAGAAAAAAGGCAGCTAGG - Intergenic
1110513278 13:76378903-76378925 CTATAAGAAGAGAGACATCTGGG - Intergenic
1114064840 14:19052440-19052462 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
1114097421 14:19347562-19347584 TTATAAGAAAAGCGGCAGGTAGG - Intergenic
1114202872 14:20539227-20539249 CCATAAAAACACATGCAGCTAGG - Intergenic
1114358620 14:21943739-21943761 CTAAAAGATCAGAGGTAGCCAGG - Intergenic
1115129328 14:30034754-30034776 CTAAAAGAAAAGTAGCAGCTAGG - Intronic
1115785327 14:36819188-36819210 CTATGAGAACAGCGGCAGATAGG - Intronic
1116220276 14:42076466-42076488 GTATCAGAACATAGGGAGCTGGG - Intergenic
1118339839 14:64885323-64885345 ATATAAGAAAAGATGCAGCCAGG - Intergenic
1120235732 14:81888752-81888774 CTGTAAGAAGAGAACCAGCTGGG + Intergenic
1121031211 14:90660087-90660109 TAAAAAGAACAGAGGCGGCTGGG + Intronic
1123548271 15:21355794-21355816 TTATAAGAAAAGCGGCAGGTAGG - Intergenic
1124908434 15:33894473-33894495 GTAGAAGAACACAGGCAGTTGGG + Intronic
1126251466 15:46572758-46572780 ACATAATATCAGAGGCAGCTTGG - Intergenic
1126563891 15:50074966-50074988 CTATGAGAAAAGAGTCAGCAAGG + Intronic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130453042 15:84076895-84076917 AGAAAAGAACAGAGCCAGCTGGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1202956603 15_KI270727v1_random:83024-83046 TTATAAGAAAAGCGGCAGGTAGG - Intergenic
1132758843 16:1499299-1499321 CTGTAAGAACAGAAGCTTCTGGG - Exonic
1134731150 16:16463247-16463269 CCATAGGAAAACAGGCAGCTCGG + Intergenic
1134936279 16:18248622-18248644 CCATAGGAAAACAGGCAGCTCGG - Intergenic
1135229810 16:20695274-20695296 CTATAAAAACATAGGCATATTGG + Intronic
1139056320 16:63189263-63189285 CTATTTGAGCAGAGGCAACTGGG - Intergenic
1140806574 16:78537693-78537715 CTACATGAACTGTGGCAGCTGGG - Intronic
1141159081 16:81617269-81617291 CTAGAAGAACGGTGGCAGCCTGG + Intronic
1141609222 16:85171632-85171654 GTATAGGAACAGGGGCAGCCGGG - Exonic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1146106038 17:30038205-30038227 CTCTAAGAAGAGAGTCTGCTAGG - Intronic
1146493098 17:33296360-33296382 CTCTGAGAACTGAGGCAGCGTGG - Intronic
1147772428 17:42877249-42877271 CTACAAGACCTGAGGCAGCAGGG - Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152414494 17:80150500-80150522 CTCTAAGAAAAGAGGCCTCTTGG - Intergenic
1153458221 18:5302789-5302811 CTATCAGAACAGATGCCGATTGG - Intergenic
1153585251 18:6614225-6614247 CTGTAAGAACAGGGGCGTCTGGG + Intergenic
1153922591 18:9804719-9804741 CTGTCCTAACAGAGGCAGCTGGG + Intronic
1154449318 18:14461232-14461254 TTATAAGAAAAGCGGCAGGTAGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156684579 18:39629188-39629210 CTGTAAGAACAAAGGAATCTGGG - Intergenic
1157838846 18:50935445-50935467 CTATAAGAACTGAGTGAGCTGGG + Intronic
1159370514 18:67522023-67522045 TTATAAGAGCTGAGACAGCTAGG - Intergenic
1160094155 18:75855798-75855820 CTATAAGAACAAAAACAGTTTGG + Intergenic
1160551230 18:79694669-79694691 CTATGAGACCAGAGGCCGCCTGG - Intronic
1162842880 19:13369197-13369219 TACTAAGAAGAGAGGCAGCTGGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
925274131 2:2636933-2636955 CTATAACACCTGAGGCTGCTGGG - Intergenic
925465959 2:4107700-4107722 CAGTAAGAAAAGAGGCAGCCCGG + Intergenic
927156028 2:20222339-20222361 CTAAAAGAAATCAGGCAGCTGGG - Intronic
928752465 2:34486706-34486728 CAATAAAAAGAGAGGCAGCAAGG - Intergenic
931343436 2:61425103-61425125 CTAAAAAATCAGTGGCAGCTGGG - Intronic
934029800 2:88033024-88033046 CTATAATAACAGTGGTTGCTTGG + Intronic
934092354 2:88563311-88563333 CTATAAGTACAGAGGCAGGCAGG - Intronic
934148753 2:89123541-89123563 CTGCAAGAAAAGAGGCACCTAGG + Intergenic
934218545 2:90058502-90058524 CTGCAAGAAAAGAGGCACCTAGG - Intergenic
935296111 2:101651063-101651085 CTCCAAGAACACAGGCAGCCAGG + Intergenic
935563180 2:104579092-104579114 CTATAAGAAGAGAGGTACCAGGG - Intergenic
938482116 2:131671469-131671491 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
938947314 2:136224941-136224963 CTGTGAGAACTCAGGCAGCTGGG + Intergenic
939614007 2:144342308-144342330 CTATAGGAACAAAAGCAGCATGG - Intergenic
942228935 2:173841603-173841625 CTCTGGGAAGAGAGGCAGCTTGG - Intergenic
942905788 2:181179356-181179378 CTATAAGAACAAAGGCAAAGAGG - Intergenic
945491953 2:210466459-210466481 GTATAAGAACAAAGGAACCTTGG + Intronic
947989584 2:234476041-234476063 CTACTAGAACAGAGGCATCCAGG + Intergenic
1169857125 20:10115111-10115133 CTTTAAGAATAGAGGCATCGTGG - Intergenic
1175326592 20:58133464-58133486 CGATAAAAATAAAGGCAGCTTGG + Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1176446854 21:6829147-6829169 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
1176825025 21:13694173-13694195 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
1178200896 21:30404278-30404300 CTAAAAGCTCATAGGCAGCTGGG - Intronic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1180259153 21:46655906-46655928 CTATAAGAACAAATCCTGCTTGG - Intronic
1180483328 22:15775062-15775084 TTATAAGAAAAGCGGCAGGTAGG + Intergenic
1182573064 22:31253425-31253447 TTAAAAGAACAGAGACTGCTGGG + Intronic
1183576511 22:38693720-38693742 ATAAAAGAATAGAGGCTGCTGGG - Intronic
949514913 3:4798902-4798924 CTATTAGATCAGTGGTAGCTGGG + Intronic
950871576 3:16234238-16234260 CTATAAGACCAGAGGGATATGGG - Intergenic
951357719 3:21689199-21689221 TTATTAGAGCATAGGCAGCTTGG - Intronic
954142926 3:48619669-48619691 CCATAGAAACAAAGGCAGCTAGG + Intergenic
954383054 3:50229863-50229885 CTATGGTAAAAGAGGCAGCTGGG - Intronic
955322199 3:57982453-57982475 TTAAAAGAACACAGGCGGCTGGG - Intergenic
955327166 3:58017830-58017852 CTATAAGCAAAGAAGCAGTTTGG + Intronic
955408762 3:58642539-58642561 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955441994 3:58966259-58966281 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
958777442 3:98503220-98503242 CTGGAAGACCAGGGGCAGCTGGG + Intronic
961639361 3:128355261-128355283 CTCTCAGAACAGAGGGATCTTGG + Intronic
961640101 3:128359875-128359897 CTGTGAGCACGGAGGCAGCTGGG - Intronic
963736767 3:149026176-149026198 CTACAAGAACAGATGCTACTTGG + Intronic
963868987 3:150393434-150393456 TTATAATTACAGAGGCAGCAAGG + Intergenic
965564115 3:170093201-170093223 CTTTAGGAAGGGAGGCAGCTGGG - Exonic
966772442 3:183516135-183516157 TTATGAGGACAGAGGCAGGTGGG + Intronic
968596509 4:1488847-1488869 CCATGAGAACAGAGGCTCCTGGG + Intergenic
970083462 4:12317171-12317193 CTATGAAAACAGAGACAGCATGG - Intergenic
971051579 4:22868302-22868324 CTATAAGAACAAGGATAGCTGGG + Intergenic
971561442 4:28083886-28083908 CTATAAAAACAAAAGCAACTTGG + Intergenic
972254438 4:37337940-37337962 CAACCAGAACAGTGGCAGCTTGG - Intronic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
979555138 4:122037606-122037628 CCATAAGAACAAATGCACCTTGG - Intergenic
979798652 4:124877846-124877868 AAAAAAGAACACAGGCAGCTGGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982216404 4:153086159-153086181 TTACAAAAACAGAGGCAGCCAGG - Intergenic
982796870 4:159656879-159656901 CCATCAGAACAGAGGCACTTAGG - Intergenic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
985617998 5:936214-936236 CTCTAAGCCCAGAGGCAGCCTGG + Intergenic
986210461 5:5666893-5666915 ATGTAAGAAGAGAGGCAGGTAGG + Intergenic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
986528766 5:8711430-8711452 CTATAAGCAGAAGGGCAGCTGGG + Intergenic
990272803 5:54162664-54162686 CCATAAGAATAGAAGCAGATAGG - Intronic
990447199 5:55904076-55904098 TTATAAGAAAAGAGGAATCTGGG - Intronic
991072242 5:62496924-62496946 TTATAACATCAGAGGCCGCTGGG - Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
994763371 5:103884694-103884716 CTATGTGACCAGAGGCATCTCGG + Intergenic
995080499 5:108046315-108046337 CTATAACAATATAGGCAGGTTGG - Intronic
995525668 5:113048987-113049009 ATACAAGAACTGAGGCAGCAGGG + Intronic
995855784 5:116590589-116590611 TTATAAGAAGAGACACAGCTAGG + Intergenic
996062487 5:119047641-119047663 GTATAAGAATACAGGCAGCCAGG + Intronic
997440271 5:133904394-133904416 TAATAAGAACAAGGGCAGCTGGG + Intergenic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998954667 5:147426792-147426814 TTAGAAGAGCAGAGGAAGCTAGG - Intronic
1002530619 5:179842383-179842405 TTATAAGAACAGAAGTAGCCGGG + Intronic
1004492273 6:16128725-16128747 TTTGAAGAACAGTGGCAGCTTGG + Intergenic
1006466606 6:34198582-34198604 CCATATGGACAGGGGCAGCTGGG - Intergenic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1007246535 6:40467339-40467361 CTCCAAGGACACAGGCAGCTGGG - Intronic
1007844943 6:44746106-44746128 CTATAAAAACACATGCAGCCGGG - Intergenic
1011202762 6:84855382-84855404 CAATAAGAACAGAGACAGGGAGG - Intergenic
1011348827 6:86400524-86400546 CAATAAGGACAGAGATAGCTAGG - Intergenic
1014925303 6:127263889-127263911 CTATAAGCAAACAGGCAACTGGG + Intergenic
1015845359 6:137514753-137514775 TCTCAAGAACAGAGGCAGCTGGG - Intergenic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1017569655 6:155731092-155731114 CTATAAGAACAGGGGCAGGATGG + Intergenic
1021812684 7:24418503-24418525 AGATAAGAACACAGGCAGTTTGG + Intergenic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1023138155 7:37074713-37074735 ATATTAGACCAGAAGCAGCTAGG + Intronic
1023967026 7:44968044-44968066 CTATGGGAACAGAGGCAGATGGG - Intronic
1024520427 7:50301210-50301232 CTATGGAAAGAGAGGCAGCTAGG - Intergenic
1027882034 7:83852310-83852332 CTACATGAACACCGGCAGCTGGG + Intergenic
1028866143 7:95715936-95715958 CTATAGTAACAGAGGTTGCTTGG + Intergenic
1030078788 7:105759420-105759442 CAATAAGAAGACTGGCAGCTTGG + Intronic
1032638913 7:133743095-133743117 TGATAAGAACAGATGCCGCTGGG - Intronic
1033272001 7:139940332-139940354 CTTAGAGAACAAAGGCAGCTGGG - Intronic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034704880 7:153132314-153132336 CTATAAAAAAAAAGGCAGCTAGG + Intergenic
1036495777 8:9268631-9268653 GTATGAGACCAGAGGTAGCTGGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037175226 8:15939290-15939312 CTCTAGGAAAAGAGACAGCTCGG - Intergenic
1041827205 8:62109386-62109408 TTATTAGAACAGAGACTGCTGGG - Intergenic
1043397259 8:79851132-79851154 TTATAAGAAGAGATTCAGCTGGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1048879029 8:138858100-138858122 CAAACAGAACAGAGGCAGCAAGG - Intronic
1050775639 9:9256813-9256835 TTATAAGCAGAGAGGCAGCTGGG - Intronic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1052722662 9:32191137-32191159 CAATAAGGACACAGGCAGTTAGG - Intergenic
1054811994 9:69442331-69442353 CTATAAGAGCTGAGGCAGCGGGG + Intronic
1059843547 9:118245628-118245650 CTATGAAGACACAGGCAGCTTGG - Intergenic
1203522338 Un_GL000213v1:55384-55406 TTATAAGAAAAGCGGCAGGTAGG - Intergenic
1189329369 X:40133985-40134007 CAATAAGCACAAAGGCATCTGGG + Intronic
1190432768 X:50393770-50393792 CTATAAGAACTGAGGTATCCTGG - Intronic
1190483217 X:50898183-50898205 ATATAGGAAGAGAGGCAGGTAGG + Intergenic
1192698556 X:73444262-73444284 CTTGAAGAATAGAGACAGCTGGG + Intergenic
1194487634 X:94505297-94505319 CTCTAAGAGCAGAGGCAGTGAGG + Intergenic
1195644547 X:107214088-107214110 GTAGAAGAACTGAGTCAGCTTGG + Intronic
1196155100 X:112419802-112419824 CAATCAGAACAGATGCAGCCAGG + Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1199564904 X:149205654-149205676 CTAGGAGAGCAGAGGCAGTTAGG + Intergenic
1199780248 X:151051951-151051973 CATTTAGAACAGGGGCAGCTGGG - Intergenic
1200165695 X:154033636-154033658 CTGCAACAACAGGGGCAGCTTGG + Intronic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic