ID: 906163852

View in Genome Browser
Species Human (GRCh38)
Location 1:43671194-43671216
Sequence TTTCCTCCAAAGTCTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906163852_906163858 19 Left 906163852 1:43671194-43671216 CCTGCAGGAGACTTTGGAGGAAA 0: 1
1: 0
2: 2
3: 23
4: 280
Right 906163858 1:43671236-43671258 AGTGTCTGCTGAGTGCCAGGCGG 0: 1
1: 0
2: 2
3: 29
4: 300
906163852_906163857 16 Left 906163852 1:43671194-43671216 CCTGCAGGAGACTTTGGAGGAAA 0: 1
1: 0
2: 2
3: 23
4: 280
Right 906163857 1:43671233-43671255 CTGAGTGTCTGCTGAGTGCCAGG 0: 1
1: 3
2: 34
3: 276
4: 1397
906163852_906163859 27 Left 906163852 1:43671194-43671216 CCTGCAGGAGACTTTGGAGGAAA 0: 1
1: 0
2: 2
3: 23
4: 280
Right 906163859 1:43671244-43671266 CTGAGTGCCAGGCGGTGCTCAGG 0: 1
1: 0
2: 3
3: 50
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906163852 Original CRISPR TTTCCTCCAAAGTCTCCTGC AGG (reversed) Intronic
900590786 1:3458665-3458687 TTTCCTCAAACATCTGCTGCTGG - Intronic
900687506 1:3958202-3958224 TTCCCTCCAGAGTCTCCTCATGG - Intergenic
902039849 1:13484594-13484616 TTTCCCCCAAATTCACCAGCAGG + Intronic
902478060 1:16698435-16698457 TTCCCTCCACAGTCTGCAGCAGG - Intergenic
903440382 1:23383739-23383761 CTTCCTGCCAAGTCTCCTGAAGG - Intronic
904462660 1:30689408-30689430 TTTCTTGCAAAGTCCCCAGCTGG - Intergenic
904976500 1:34460948-34460970 TTTCCTCCAAAGTCTGCAGCAGG - Intergenic
905205320 1:36340039-36340061 TTTCATAGAAAGTCTCCTGCGGG - Exonic
905318429 1:37098302-37098324 TCTCCTCCAAAGACACATGCAGG + Intergenic
905480079 1:38255811-38255833 TTTCCTCCAAAATCTCTGGCTGG - Intergenic
905795844 1:40816223-40816245 TTCCCTCCGGAGTCTCCTCCAGG + Intronic
905875822 1:41431547-41431569 GTTCTTCCAAAGCCTCCTTCTGG + Intergenic
906163852 1:43671194-43671216 TTTCCTCCAAAGTCTCCTGCAGG - Intronic
907173606 1:52497036-52497058 TTTCCTCCACAATTTCCTGACGG + Exonic
909324630 1:74334815-74334837 TCTCTTCCAAAGTCTCCTTCTGG - Intronic
910234727 1:85023834-85023856 TTTCCTCCTAAGTCACTGGCTGG - Intronic
912155588 1:106914983-106915005 TTGCGGCCAAAGTCTCCTACGGG - Intergenic
912449214 1:109759075-109759097 CTTCCTCCAGAGCCTTCTGCAGG + Exonic
912718816 1:112002778-112002800 TTTCCTCCAAATTCTCCACTGGG + Intergenic
913418364 1:118636683-118636705 TTTCCTCCAAGAACTACTGCAGG - Intergenic
913559251 1:120001281-120001303 TTCCCTCCAAAGTTTCCCTCGGG - Intronic
913638613 1:120789261-120789283 TTCCCTCCAAAGTTTCCCTCGGG + Intergenic
914279845 1:146160724-146160746 TTCCCTCCAAAGTTTCCCTCGGG - Intronic
914540883 1:148611642-148611664 TTCCCTCCAAAGTTTCCCTCGGG - Intronic
914625757 1:149459604-149459626 TTCCCTCCAAAGTTTCCCTCGGG + Intergenic
915880676 1:159667839-159667861 TGCCCTGCAAAGTCTCCTGTGGG - Intergenic
919396678 1:197058466-197058488 TCTCCTCCAAAGTCTCCAGCAGG - Intronic
919705055 1:200668622-200668644 TCCCCTGCAAAGTCTCTTGCAGG + Intronic
919807285 1:201387702-201387724 CATCCTCCAGAGTCTGCTGCCGG + Intronic
919837085 1:201582484-201582506 TTTCCTCCAGTGCCTCCTGTGGG + Intergenic
920584195 1:207141666-207141688 TTTCCACCAGAGTCTCGTGCAGG + Intronic
920694983 1:208175118-208175140 TCTCCCCCAAAGATTCCTGCAGG - Intronic
920974378 1:210771923-210771945 TTTCCTCCAAAGCCACATGAGGG - Intronic
923889057 1:238190900-238190922 TTTCATCCAATGGCTTCTGCAGG - Intergenic
924055255 1:240118577-240118599 TTTACTCCAAACTCTCCAGTGGG - Intronic
1062768949 10:84957-84979 TTTCCTTCACAGTCTGCTGCTGG + Intergenic
1063644979 10:7870764-7870786 TTTCCCTGACAGTCTCCTGCTGG + Intronic
1064591347 10:16894724-16894746 TTTTCTCCAAAGTCTTTTGTAGG - Intronic
1068181670 10:53527540-53527562 TGCCCTCCAAAGTCTCTTGTGGG - Intergenic
1068690493 10:59908702-59908724 TTTCCTCCAAATTCCACTGAAGG - Intergenic
1068810311 10:61248255-61248277 TTTCCTCTAAAGTTTCCCACAGG - Intergenic
1069249698 10:66253320-66253342 TCTCTTCAAAAGGCTCCTGCAGG + Intronic
1069519959 10:69111085-69111107 TAGCCACCAAAGTCTCCTTCAGG - Intergenic
1070283014 10:75063566-75063588 TGTCCTGCACAGTCTCCTGGAGG + Intergenic
1071577870 10:86742775-86742797 TTTCCTCTAAAGTCACATTCTGG - Intergenic
1075274712 10:121082969-121082991 TTTTCTCTAAAGTATCCTTCAGG + Intergenic
1075515094 10:123102281-123102303 TCTCCACCAATGTCACCTGCTGG - Intergenic
1075813963 10:125250145-125250167 CTCCCTCCAAAGCCTCCAGCGGG + Intergenic
1076838904 10:133035286-133035308 TGCCCTCCAAAGTCTCCTGTGGG + Intergenic
1078647211 11:13151728-13151750 TCTACTCCAAGATCTCCTGCTGG + Intergenic
1079142067 11:17817967-17817989 GCTCATCCAAAGTCACCTGCTGG - Intronic
1079534712 11:21499503-21499525 TTTCCTCCAAAGTTTCTTCTTGG + Intronic
1080861748 11:36155929-36155951 TTTCCTCCACAGAGCCCTGCAGG - Intronic
1081979698 11:47258499-47258521 TCTCCCCCAAAGTCCCCTCCAGG - Exonic
1082616632 11:55368857-55368879 TTTACTCCAAAGTTTCCTCATGG - Exonic
1083055164 11:59812173-59812195 TGCCCTGCAAAGTCTCTTGCGGG - Intergenic
1085327968 11:75622598-75622620 TTTTCTACAAAGAGTCCTGCTGG - Intronic
1085922235 11:80970985-80971007 TTCCATCCAAAGCCTCCTACAGG - Intergenic
1086402972 11:86475560-86475582 TTTCCTCCAAATTTTCATTCAGG - Intronic
1086743016 11:90391375-90391397 TTTCCTCCAAGAACTACTGCAGG + Intergenic
1087160203 11:94941173-94941195 TGTCCTTCAAAGTCTCCTCTTGG - Intergenic
1087169756 11:95038409-95038431 AGTCCTCCCAAGTCTCCTGAAGG + Intergenic
1087182604 11:95154647-95154669 CCTCCTCCAAATGCTCCTGCAGG + Intergenic
1088034835 11:105298738-105298760 TCTCCACCAAACTCTCCTGGGGG - Intergenic
1088433047 11:109779494-109779516 TTTCCTCCACATTCTCCAACTGG - Intergenic
1089100849 11:115961349-115961371 TTTCCTCCCAAGGCTCCCTCTGG + Intergenic
1089173145 11:116529304-116529326 ATTCCTCCTAGGTCTCTTGCAGG - Intergenic
1090703954 11:129319920-129319942 TTTCCTCCTTATTGTCCTGCAGG - Intergenic
1090802829 11:130184146-130184168 TCTCCTTCAAAATCTCCTCCTGG - Intronic
1091703679 12:2679849-2679871 TCTCCTCCACTGTCTCCTGAGGG - Intronic
1094026109 12:25960674-25960696 TTTCCTCAAGAGTCTCCAGGTGG + Intronic
1094298991 12:28939767-28939789 TGTCCTCCACACTCTTCTGCAGG + Intergenic
1095159076 12:38894430-38894452 TTTCATCCAAAGCCTCTTGTAGG - Intronic
1096053658 12:48632805-48632827 TTTCCTCTTGAGTCTCCTTCTGG - Intergenic
1096581766 12:52590317-52590339 TTTGTTCTAAAATCTCCTGCTGG + Intronic
1096794366 12:54065960-54065982 CTTCCTTCCAGGTCTCCTGCTGG + Intergenic
1097980357 12:65731875-65731897 TTTCCTCCAAGGTAAGCTGCAGG + Intergenic
1098687943 12:73449586-73449608 TTTCCTCTAAAGTCTCCACAAGG + Intergenic
1100261451 12:92936031-92936053 TGTCCTGCAAAGTCTCTTGTGGG + Intergenic
1100282007 12:93127236-93127258 TTGCCTCCAAGCTGTCCTGCAGG + Intergenic
1100764759 12:97851491-97851513 TTGTCTCCAAAGTATCCTACTGG - Intergenic
1102130780 12:110527109-110527131 TCTCCCCCAGAGTCTCCTGAAGG - Intronic
1102315735 12:111885904-111885926 TTTTCTCCACAGGCTCCTGAAGG + Exonic
1102455688 12:113069554-113069576 TTCCCTCCAAACTCTCCTCTGGG - Intronic
1106406730 13:29481075-29481097 TTGCCTGCCAACTCTCCTGCTGG + Intronic
1106509600 13:30401543-30401565 TTTCCTCCCCTGTCCCCTGCAGG - Intergenic
1108287216 13:48920433-48920455 CTTCCTCCAAAGCCTCCCACTGG + Intergenic
1109329940 13:60917170-60917192 TTTCCTCCAATCTCTACTGCTGG + Intergenic
1110268255 13:73564331-73564353 TTTCATCCAATGTATCCTCCTGG + Intergenic
1111541843 13:89678657-89678679 TTTTCTCCAAACTCTCATTCTGG + Intergenic
1113680878 13:112244259-112244281 CTCCCACCGAAGTCTCCTGCTGG + Intergenic
1114068843 14:19092236-19092258 TTGGCTCCAAAGTCTCCAGAGGG + Intergenic
1114093418 14:19307769-19307791 TTGGCTCCAAAGTCTCCAGAGGG - Intergenic
1115307835 14:31950767-31950789 TTTACTCCAACCTCTCCTGAGGG - Intergenic
1115952082 14:38732753-38732775 GTTCCTCTAGAGTCTCCTGGTGG - Intergenic
1116406822 14:44576603-44576625 TTTCCTGCAAACTCTTCTGCAGG - Intergenic
1117378528 14:55137552-55137574 TTTCTTCCCAAATCTGCTGCTGG - Intronic
1118166537 14:63341692-63341714 CTTCCCCCAAACTCCCCTGCTGG - Intergenic
1119148352 14:72335937-72335959 TGTCCTCCTAAGTCTAGTGCCGG + Intronic
1122653707 14:103242553-103242575 TGTCCTGCAAAGTCTCTTGTGGG + Intergenic
1202918020 14_KI270723v1_random:3118-3140 ATTCCTCCAGGGTCACCTGCAGG + Intergenic
1124079240 15:26475754-26475776 TTTCCTCCAGACCCACCTGCAGG - Intergenic
1124568753 15:30840106-30840128 TTTCCTCCACTCTCTCTTGCTGG - Intergenic
1126122163 15:45263220-45263242 TTTCGTCCAAAGCCTCAGGCGGG - Exonic
1127216242 15:56825489-56825511 TTTCCTCCAAGGACTTCTCCTGG - Intronic
1128258583 15:66216218-66216240 CTTCCCCCAAAGACTCCTCCAGG - Intronic
1128365264 15:66995455-66995477 TTTCCTCCCACATCTCCTGCAGG + Intergenic
1129221861 15:74135860-74135882 TTAGTTCCAAAGCCTCCTGCCGG + Exonic
1130403591 15:83579279-83579301 TTTCCTCCAAGGCTTCCTGTGGG + Intronic
1131097371 15:89665050-89665072 TTCCCTTCAAAGTAGCCTGCTGG + Exonic
1131598645 15:93825073-93825095 TCTTCTCTAAAGTCTCCTTCTGG + Intergenic
1131848570 15:96513972-96513994 TTTCCTCCAAAGACAACTGGGGG + Intergenic
1132458050 16:35223-35245 TTTCCTTCACAGTCTGCTGCTGG + Intergenic
1132590512 16:724434-724456 TGTCCTCCAGAGTCGCCTCCAGG + Exonic
1133345188 16:5065257-5065279 TTGCAGCCAAAGTCTCCTGAAGG - Intronic
1134794588 16:17023426-17023448 TTTCCTCAAATGTCCCCTGATGG + Intergenic
1134889816 16:17830375-17830397 TTACCTCCAGCGACTCCTGCAGG + Intergenic
1134904284 16:17966658-17966680 CTTCCTCCAAAGTTTCCTAATGG - Intergenic
1137000080 16:35221945-35221967 ATTCCTCCAGGGTCACCTGCAGG + Intergenic
1137445495 16:48529376-48529398 TTTCATCCAAAGAAGCCTGCTGG + Intergenic
1138834782 16:60421152-60421174 TTTCTTCCAAAGGCTCTAGCAGG + Intergenic
1140776070 16:78249877-78249899 TTTCCTCCCATTTCTCCTTCTGG - Intronic
1141208332 16:81953130-81953152 ATTCTTCCAAAGTGTCCTGAGGG + Intronic
1141698355 16:85631291-85631313 TGTCCTCCAGTGTCCCCTGCAGG + Intronic
1141880001 16:86851538-86851560 TTTCCGCCAAATCATCCTGCAGG - Intergenic
1145067388 17:19771012-19771034 GGTGCTCCAATGTCTCCTGCTGG - Intronic
1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG + Exonic
1146361673 17:32181157-32181179 TTCCCTCCAAGCTCTCTTGCAGG + Intronic
1147444106 17:40464391-40464413 TTTCCCCCAGTGTCTCCTGGTGG + Intergenic
1150464529 17:65380859-65380881 TTTCTTACAAAGTCTCCTTTTGG + Intergenic
1150572795 17:66402363-66402385 TTTCCTTCTAAGTTTCCTGAAGG - Intronic
1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG + Intronic
1153396369 18:4625840-4625862 TTTGCTCCAAAAACTACTGCAGG - Intergenic
1155189502 18:23416719-23416741 TTTTCACCACTGTCTCCTGCAGG - Intronic
1155318269 18:24593685-24593707 TTTCCTCCTTAGTCTTCTCCAGG + Intergenic
1159082770 18:63754082-63754104 TTTCATCCAAAGTCTTTGGCAGG + Intronic
1161643440 19:5437679-5437701 TGGCCCCCAAAGTCTCCTGGAGG - Intergenic
1162380494 19:10329040-10329062 TTTCCACCAGAGCCGCCTGCGGG - Exonic
1166522036 19:43486955-43486977 TTTCCTCCATCCTCTGCTGCAGG + Intronic
1167699899 19:51036662-51036684 GTCCCTACAAAGCCTCCTGCTGG + Intergenic
1168382391 19:55934956-55934978 TTTACTCCACTGTATCCTGCTGG - Intergenic
1168391223 19:56009461-56009483 TTTCCACCAAAGCCTCCTACTGG - Intronic
1168708053 19:58480793-58480815 CTGCCTCCAGAGTCTTCTGCTGG - Exonic
1202712080 1_KI270714v1_random:24262-24284 TTCCCTCCACAGTCTGCAGCAGG - Intergenic
925205744 2:2004043-2004065 TTTCCTGCATACTTTCCTGCAGG + Intronic
925878105 2:8328894-8328916 CTTCCTCCAAGGCCTTCTGCTGG + Intergenic
926758697 2:16257225-16257247 TTTCCTCCAGAGCCGCCTTCTGG + Intergenic
927204034 2:20595751-20595773 TTGTCTCCACAGTCCCCTGCTGG + Intronic
928388661 2:30891139-30891161 TTTCCTCCCATGTCTCATGCCGG - Intergenic
929138306 2:38645528-38645550 TTTAATCCAAAATATCCTGCCGG + Intergenic
932058633 2:68472305-68472327 TGTCCTGCAAAGTCTCTTGTGGG - Intronic
932121032 2:69100392-69100414 TTTCCTCCACCGTCTCCCCCTGG + Intronic
932191241 2:69742745-69742767 TTGGCACCAAAGTCTCCAGCTGG - Intronic
934767991 2:96891297-96891319 TTTAGTCCAGAGCCTCCTGCAGG + Intronic
935322169 2:101899820-101899842 TTACCTCCAAAGACTCCAGAGGG - Intergenic
936107656 2:109639265-109639287 ATTCCTCTAAAGTCTTCTGCAGG + Intergenic
936122224 2:109756921-109756943 CTTCCTCCACATTCTCCTTCAGG + Intergenic
936222469 2:110614553-110614575 CTTCCTCCACATTCTCCTTCAGG - Intergenic
942999661 2:182310344-182310366 TTTCCTCCATAGCCCCCTGAAGG - Intronic
944902521 2:204230348-204230370 TTTCCTCCAGAGGCCTCTGCTGG + Intergenic
945132453 2:206588011-206588033 TTTACTACAATGTCTCCTTCTGG - Intronic
946884922 2:224213670-224213692 TTTGCTCAAAAGTCACCTACTGG - Intergenic
948182508 2:235993597-235993619 TTTCCTTCACAGTATCTTGCTGG - Intronic
948225476 2:236306274-236306296 TGTCTTCCACAGTGTCCTGCTGG - Intergenic
948287612 2:236798648-236798670 TTTGCTCCAAAGCCCCCTCCAGG - Intergenic
1169477971 20:5949810-5949832 TTGTCTCCAGAGTCTCCTTCAGG - Intronic
1170456991 20:16542646-16542668 CTTCCCCCAAAGTCTCTGGCTGG - Intronic
1171986742 20:31666071-31666093 GTTCCACAAAAGTATCCTGCAGG + Exonic
1172821325 20:37737374-37737396 TTTCATCCAATGGCTCCTCCTGG - Exonic
1173549664 20:43923822-43923844 TTTCCTCCTGTGTCCCCTGCAGG - Intronic
1173578730 20:44131199-44131221 TTGCCACCAGAGTCTCTTGCTGG + Intronic
1174673725 20:52332982-52333004 TTTCCCCCAGAGCCTCCTGAGGG - Intergenic
1174983504 20:55423319-55423341 TGTCCTCCAAATTCTCTTGGTGG - Intergenic
1175020080 20:55836816-55836838 TTTCCTCCAAAGTTTCCCATAGG + Intergenic
1175712503 20:61232438-61232460 TTTCATCCCAAGTGCCCTGCTGG + Intergenic
1180487315 22:15814796-15814818 TTGGCTCCAAAGTCTCCAGAGGG + Intergenic
1180909039 22:19435767-19435789 GTTCCTCCAGAGCTTCCTGCTGG - Exonic
1181052880 22:20246060-20246082 TTTCCTCCAGGGTCTCCTCCTGG + Intronic
1182287613 22:29257628-29257650 CTTCCACCCAGGTCTCCTGCAGG - Intronic
1183859835 22:40661872-40661894 TTTCCTCTGAAGCTTCCTGCTGG + Intergenic
952648954 3:35699335-35699357 TTTCTTCTAAATTCTCCTGTAGG + Intronic
952667240 3:35922007-35922029 TTGCCTACAAGGTCTCCTGATGG + Intergenic
952690541 3:36200089-36200111 ATTCCTCCAAAGTCCACTGTTGG - Intergenic
953511930 3:43550421-43550443 TATGCACCAAAGTCTCCTTCAGG - Intronic
954358843 3:50106745-50106767 TTTCCTTCACATTCTCCTTCAGG + Exonic
956791092 3:72680696-72680718 TCTCCTCCAGAGTTCCCTGCTGG + Intergenic
957877264 3:86163679-86163701 CATCCTCCAAAGTCTTCTGTAGG - Intergenic
959757708 3:109918708-109918730 TTTCCTCCCAAGTCACTTTCAGG + Intergenic
960721825 3:120632006-120632028 TTACCTCTGAAGTCTCCTGGAGG - Intronic
961195768 3:125000086-125000108 TTTCCTCCCAGGTCTTCTCCAGG - Intronic
962129090 3:132653397-132653419 TTCCCTCCAAAGTCTGCAGAAGG + Intronic
966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG + Intergenic
968568515 4:1327440-1327462 TTCCCTGGAAAGTCTGCTGCAGG + Intronic
968757883 4:2426229-2426251 TGTCCTGCACTGTCTCCTGCAGG - Intronic
968933064 4:3593669-3593691 TGTCATCCACTGTCTCCTGCCGG + Intergenic
971131327 4:23814162-23814184 TTGCCTCCAAAGTCTCTCTCAGG + Exonic
971871051 4:32238790-32238812 TTTCCTCCACAATCTCATGTTGG - Intergenic
974458517 4:62159765-62159787 TTCCCCCCAAAGTATCATGCAGG - Intergenic
976410307 4:84705836-84705858 TTGTGTCCACAGTCTCCTGCTGG - Intronic
977237630 4:94527695-94527717 TTTGTTCCCAAGTTTCCTGCTGG - Intronic
978029158 4:103917057-103917079 TTTCCTCTAAAGCCTTCTGAGGG - Intergenic
980462477 4:133134177-133134199 ATTCCTCCAAGGGTTCCTGCTGG + Intergenic
980737611 4:136911667-136911689 TTTCCTCCAAAGGCTGTTCCTGG - Intergenic
981701151 4:147608728-147608750 TTTCCTCCCAAGTCTTCCACAGG - Intergenic
982317755 4:154048391-154048413 ATTCCTCCCAAGTCTGCTCCAGG - Intergenic
982836768 4:160128971-160128993 TTTCCCCCAAAGTCTCCCTTAGG - Intergenic
984049160 4:174842272-174842294 TGTCCTTCAAGGTCTCTTGCAGG - Intronic
984231914 4:177110378-177110400 TTTCCTCAATAGACACCTGCAGG - Intergenic
985079617 4:186251510-186251532 TCTCCTCCAAAGTCAACTCCCGG - Exonic
986329216 5:6705104-6705126 TTACCTCCAGAATCTCCTGCGGG + Intergenic
986340671 5:6786542-6786564 TTTAGGCCAAAGTCTCCTCCTGG - Intergenic
986645282 5:9910889-9910911 TTCCCTCCAGAGTCTCCAGAAGG - Intergenic
986736200 5:10669175-10669197 TTTCCTGAAACGTCTCCTGGGGG + Intergenic
987230408 5:15888021-15888043 TTTCCTCAAAAATCCCCTGATGG + Intronic
987305202 5:16630937-16630959 TTATCTCCAAAGTCTCCTCCTGG - Intergenic
987317773 5:16740170-16740192 TTTGCTCCAGAGTCTTCTGAGGG + Intronic
988368204 5:30330400-30330422 CTTCCTCCCAAGTCTCTTTCTGG + Intergenic
988833565 5:35009938-35009960 TTTCCTCCTATATCTCCTGCTGG + Intronic
994965613 5:106666917-106666939 TTTCCTCTTTAGTCTCCTGTTGG - Intergenic
995611651 5:113916962-113916984 TATCCTCCAAAGTCCTTTGCAGG - Intergenic
998077915 5:139251404-139251426 TTCACGCCAAAGTCTTCTGCCGG + Intronic
998648347 5:144089857-144089879 TTCCCTCCAAAGTTTCCTGTTGG + Intergenic
998994561 5:147856600-147856622 TTTCTTCCATGGTCTTCTGCTGG - Intergenic
1000074486 5:157772317-157772339 TCTCCTTCTGAGTCTCCTGCGGG - Intergenic
1000231084 5:159316070-159316092 TTTCCTCCAAATTTTCATCCTGG + Exonic
1000634160 5:163624603-163624625 TTTCCTCCAAAGAATCCTCTGGG - Intergenic
1001593412 5:172881906-172881928 TTTCCTCCACATTCTCTTGACGG + Intronic
1002462316 5:179380546-179380568 GTTCCTCGAAGGTTTCCTGCTGG - Intergenic
1002566976 5:180117628-180117650 TTTCCTCCAAATTCTACTCATGG - Intronic
1003158354 6:3615434-3615456 TCTCCTCAAATTTCTCCTGCTGG - Intergenic
1004598686 6:17126658-17126680 TTGGCTCCTAAGTTTCCTGCTGG - Intronic
1006413624 6:33890535-33890557 TGTCCTGCAAAGTCTCTTGTGGG + Intergenic
1006479275 6:34278983-34279005 TCCACTCCAAACTCTCCTGCTGG + Intergenic
1010461674 6:76120750-76120772 AGTCCTCCAAAGGGTCCTGCTGG + Intergenic
1011087639 6:83560198-83560220 CTTCCTCCTCAGCCTCCTGCTGG - Exonic
1011255283 6:85414403-85414425 TTTCCTCCAGGATCTCCAGCTGG - Intergenic
1011620552 6:89238166-89238188 TTTGCTCCAAGATCTACTGCAGG - Intergenic
1013631897 6:111993813-111993835 TTGCCTCCAAAGTGTCCTTTGGG - Intergenic
1013886881 6:114978134-114978156 TTTCCTTCAAGGACTCCTCCAGG - Intergenic
1014641541 6:123916561-123916583 TTCCCTCCAAAGTATACTGGAGG - Intronic
1015479593 6:133692988-133693010 TTCCCCCCAAAATCTTCTGCTGG - Intergenic
1015624479 6:135166279-135166301 TTTACTCCAGAGTCTCATGTGGG + Intergenic
1015719834 6:136229493-136229515 TATCTTCCAAAGATTCCTGCTGG + Intergenic
1018437529 6:163776282-163776304 TTTCTTCCAGAGTCTCCTTGTGG + Intergenic
1018927623 6:168217442-168217464 TTCCCTTCCAGGTCTCCTGCTGG + Intergenic
1019064721 6:169287732-169287754 CTCCCTCCAGAGTCTCCTGGGGG + Intergenic
1019066483 6:169303985-169304007 TTTGCTGCAAAGTCTGTTGCCGG - Intergenic
1019677199 7:2321110-2321132 TGTCCTGCAAAGCCTCCTGATGG + Intronic
1020455802 7:8372547-8372569 TTTGCTCCAAGAACTCCTGCAGG - Intergenic
1021808280 7:24378185-24378207 TTTGCTCCAAAGTCTACTTGTGG + Intergenic
1023943024 7:44782166-44782188 CTTCCTCCAAAGCCTGGTGCCGG - Intergenic
1024195410 7:47053627-47053649 AGTCCTCCCAAGTCTCCTGAAGG + Intergenic
1024981997 7:55165343-55165365 TTTTCTCCCATGACTCCTGCCGG - Exonic
1028679235 7:93506358-93506380 TCTCATCCATATTCTCCTGCAGG + Intronic
1029243052 7:99178098-99178120 TATCCCCCAAAGGCTCCTGCCGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029881851 7:103821651-103821673 TTTCTTCTAAATCCTCCTGCAGG - Intronic
1030443294 7:109616114-109616136 TTTCCTGTTATGTCTCCTGCAGG - Intergenic
1032175831 7:129625076-129625098 TCTCCCCCAGAGTCTCCTGAGGG - Intronic
1033976377 7:147106964-147106986 TTTTCTCCAATGTCTCCCTCTGG + Intronic
1036673951 8:10813618-10813640 TTTCCTTGAAATTCTTCTGCTGG - Intronic
1037649917 8:20826936-20826958 TTCCCTCCTTAGACTCCTGCTGG - Intergenic
1038416449 8:27399745-27399767 CTGCTTCCAATGTCTCCTGCAGG + Intronic
1038592142 8:28848928-28848950 TTTCAGCCTGAGTCTCCTGCTGG - Intronic
1038676038 8:29623886-29623908 TTTGGCCCAAAGCCTCCTGCAGG + Intergenic
1040838843 8:51762302-51762324 TATCCTGCAAAGTCTCTTGTGGG + Intronic
1041609318 8:59826212-59826234 TTGCCTGCAAAGTCTCTTGTGGG + Intergenic
1041797429 8:61760256-61760278 TTTCCCGCAAAGTCACCTCCTGG + Intergenic
1041879903 8:62737121-62737143 TTTGCTCCAAGGTCTACTGCAGG - Intronic
1043376440 8:79654930-79654952 TCTCCTCCAAAGCCTTCTGAAGG - Exonic
1043829889 8:84975038-84975060 GTTTCTCCAATGTTTCCTGCTGG - Intergenic
1044900981 8:96944304-96944326 CTCCCTCCAAAGTCCCCTCCAGG + Intronic
1044944075 8:97374912-97374934 TTCCCTTCAAAGTCTCTTGCTGG - Intergenic
1045693578 8:104783690-104783712 TTGCCTCCAAAGTATCCAGATGG - Intronic
1046195971 8:110862837-110862859 CTCCCTGTAAAGTCTCCTGCCGG - Intergenic
1046339756 8:112838105-112838127 TTTCCTCTATAGTCTCCAACTGG - Intronic
1046490875 8:114951966-114951988 GTTCCTCCAGAGTCTCCTATTGG - Intergenic
1047643061 8:126841428-126841450 TTTCCTCCAAAATCTTCTGAAGG - Intergenic
1047662502 8:127052690-127052712 TTTCTGCCAAGGTCTCATGCTGG + Intergenic
1047981699 8:130190246-130190268 TTTCCCCCAAAGTTTTCTTCTGG + Intronic
1048394572 8:134001937-134001959 TTACCCCCAAAGCTTCCTGCAGG + Intergenic
1049233202 8:141494850-141494872 TTTTCTCCCAGGTCTCCTCCAGG + Intergenic
1049392148 8:142377158-142377180 TTTTGTCCCAAGTCACCTGCTGG - Intronic
1050000831 9:1075228-1075250 TTTGCTACAATGTCTCCTGGAGG - Intergenic
1050038714 9:1464839-1464861 TTTAGTCCAAAATCTTCTGCTGG + Intergenic
1052396906 9:27949657-27949679 TCTCTTCCAAAGTTTCCAGCAGG + Exonic
1053152297 9:35750767-35750789 TTGCCTTCTAAGTCTCCTGGAGG + Intronic
1054707660 9:68479485-68479507 TTTCCTCCACACTCTGCTTCCGG - Exonic
1055156269 9:73066654-73066676 TTTGCTCCAAAAACTACTGCAGG + Intronic
1055400979 9:75923775-75923797 TCTCCTCCAGAATCTCCTGAAGG - Intronic
1057144169 9:92747393-92747415 TTTCTTCCAAAGTCCCCGCCAGG + Intronic
1058102753 9:100935536-100935558 TTTCCTGCAACGTCTGCTCCTGG + Intergenic
1060082380 9:120661904-120661926 TTACATCCAACTTCTCCTGCTGG + Intronic
1060964478 9:127705101-127705123 TTCCCTCCAAAGTCTCCCAGAGG + Intronic
1062178642 9:135178772-135178794 CTTACTCCAGAGTCACCTGCTGG - Intergenic
1188803899 X:34563421-34563443 TGCCCTGCAAAGTCTCCTGTGGG - Intergenic
1191638210 X:63401147-63401169 TTCCCTGCAAAGTCTCTTGTGGG + Intergenic
1193031703 X:76906178-76906200 TTTCCTCTACATTCTCCTCCTGG - Intergenic
1193490423 X:82142719-82142741 TTTTCTTCAAAATCTTCTGCCGG + Intergenic
1193684220 X:84557508-84557530 TTTCCTTCAAGGTCTCTTGTAGG - Intergenic
1194876342 X:99193265-99193287 TTTCCAACCAAGTCTCCTGTAGG + Intergenic
1198186801 X:134260950-134260972 TTTGTTCCAGAGTTTCCTGCTGG - Intergenic
1198241416 X:134790945-134790967 TCTCTTCCACAGTCTCCTGTTGG - Intronic
1199627899 X:149757781-149757803 TTTCCACCAATGTCCCCTGTGGG + Intergenic
1200398339 X:156004168-156004190 TTTCCTTCACAGTCTGCTGCTGG - Intronic
1201651118 Y:16288181-16288203 CTCCCTCCTAAGCCTCCTGCTGG - Intergenic