ID: 906167117

View in Genome Browser
Species Human (GRCh38)
Location 1:43694668-43694690
Sequence AAACCAGTGATTGCAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 877}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906167117_906167123 22 Left 906167117 1:43694668-43694690 CCAGTTCCTGCAATCACTGGTTT 0: 1
1: 0
2: 1
3: 58
4: 877
Right 906167123 1:43694713-43694735 GTATCTTCTGTAAGAAGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 69
906167117_906167122 19 Left 906167117 1:43694668-43694690 CCAGTTCCTGCAATCACTGGTTT 0: 1
1: 0
2: 1
3: 58
4: 877
Right 906167122 1:43694710-43694732 AATGTATCTTCTGTAAGAAGCGG 0: 1
1: 0
2: 1
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906167117 Original CRISPR AAACCAGTGATTGCAGGAAC TGG (reversed) Intronic
900366031 1:2312371-2312393 GAACCAGTGGCTGCAGTAACTGG - Intergenic
901788564 1:11641094-11641116 AATCTAGTGGGTGCAGGAACTGG + Intergenic
901971001 1:12908410-12908432 AAATCAATGAATCCAGGAACTGG + Intronic
902014165 1:13293349-13293371 AAATCAATGAATCCAGGAACTGG - Intergenic
902966206 1:20005421-20005443 AAACCAATGAATCCAGGAACTGG + Intergenic
903159464 1:21475209-21475231 AAATCAGTGAATCCAGGAGCTGG - Intronic
904486145 1:30825535-30825557 AGACCAGTCATTGCAGGGACTGG + Intergenic
905664800 1:39756434-39756456 AAACCAGGGATGGCAGGCCCAGG + Intronic
905740624 1:40367896-40367918 AAATCAGTGAATCCAGGAGCTGG + Intronic
906167117 1:43694668-43694690 AAACCAGTGATTGCAGGAACTGG - Intronic
906374880 1:45287744-45287766 AAATCAGTGAATCCAGGAGCTGG + Intronic
906452656 1:45964664-45964686 AAATCAGTGAATCCAGGAGCTGG - Intronic
906894065 1:49752022-49752044 AAATCAGTGAATCCAGGAGCTGG - Intronic
906904790 1:49878107-49878129 AAATCAGTGAATCCAGGAGCTGG - Intronic
907015490 1:51008433-51008455 AAATCAGTGAATCCAGGAGCTGG + Intergenic
907958411 1:59253993-59254015 AAATCAGTGAATCCAGGAGCTGG + Intergenic
907997806 1:59650698-59650720 AAATCAGTGAATCCAGGAGCTGG - Intronic
908178115 1:61576325-61576347 AAATCAGTGAATCCAGGAGCTGG - Intergenic
908289718 1:62652183-62652205 GAACCAGTGAATGCAGGCAATGG - Intronic
908976377 1:69903701-69903723 AAATCAGTGAATCCAGGAGCTGG + Intronic
909183308 1:72451124-72451146 AAACCAGTGGTAGCAGGTCCAGG - Intergenic
909261002 1:73489240-73489262 AAATCAGTGAATCCAGGAGCTGG - Intergenic
910560565 1:88585851-88585873 AAATCAGTGAATCCAGGAGCTGG + Intergenic
910822811 1:91369784-91369806 AAATCAATGAATCCAGGAACTGG + Intronic
911357353 1:96838625-96838647 ACACCTGTCATTGAAGGAACGGG + Intergenic
911491079 1:98566901-98566923 TAAACAGTGATTGGAGGAATGGG - Intergenic
911867587 1:103048546-103048568 AAATCAGTGAGTCCAGGAGCTGG - Intronic
912110274 1:106332579-106332601 AAACCAATGAATCCAGGAGCTGG + Intergenic
912150805 1:106856406-106856428 AAATCAGTGAATCCAGGAGCAGG + Intergenic
912224434 1:107717185-107717207 AAATCAGTGAGTCCAGGAGCTGG - Intronic
912235642 1:107847467-107847489 AAATCAGTGAATCCAGGAGCTGG + Intronic
913710707 1:121480277-121480299 AAATCAATGAATCCAGGAACTGG + Intergenic
915077061 1:153317201-153317223 AAATCAATGAATCCAGGAACTGG - Intergenic
916140856 1:161696351-161696373 AAATCAGTGAATCCAGGAGCTGG + Intergenic
916221851 1:162452349-162452371 AAATCAATGAATCCAGGAACTGG + Intergenic
916373311 1:164123894-164123916 AAATCAATGAATCCAGGAACTGG - Intergenic
916898001 1:169186704-169186726 AAATCAGTGAATCCAGGAGCTGG - Intronic
917023026 1:170611156-170611178 AAATCAATGATTCCAGGAGCTGG - Intergenic
918078658 1:181189738-181189760 AAGCCAGGGATTCCAGGAGCAGG + Intergenic
918317976 1:183339073-183339095 AAAACTGTGATCTCAGGAACTGG - Intronic
918692581 1:187500351-187500373 ATACCAATGATTGAATGAACTGG + Intergenic
919065235 1:192685661-192685683 AAATCAGTGAATCCAGGAACTGG - Intergenic
919141191 1:193573766-193573788 AAATCAATGAATGCAGGAGCTGG - Intergenic
919254924 1:195108837-195108859 AAATCAGTGAATCCAGGAGCTGG + Intergenic
919512013 1:198476690-198476712 AAATCAATGAATCCAGGAACTGG - Intergenic
919580267 1:199363612-199363634 AAATCAGTGAATCCAGGAGCTGG - Intergenic
919603446 1:199650508-199650530 AAATCAGTGAATCCAGGAGCTGG + Intergenic
921296543 1:213709497-213709519 AAATCAGTGAATCCAGGAAGTGG - Intergenic
921354186 1:214270172-214270194 AAATCAGTGATAGGAGGGACAGG - Intergenic
921401085 1:214724637-214724659 AAATCAGTGAATCCAGGAGCTGG - Intergenic
921631560 1:217439562-217439584 AAATCAGTGAATCCAGGAGCTGG + Intronic
922062879 1:222108421-222108443 AAAGCAGTTCTTACAGGAACTGG - Intergenic
922139823 1:222872722-222872744 AAATCAGTGAATCCAGGAGCTGG - Intronic
922393434 1:225171313-225171335 AAATCAGTGAATCCAGGAGCTGG + Intronic
922397703 1:225219361-225219383 AAATCAGTGAATCCAGGAGCTGG + Intronic
922622156 1:226997397-226997419 AAATCAGTGATTCCAGGAGCTGG - Intronic
923853734 1:237823724-237823746 AAATCAGTGAATCCAGGAGCTGG + Intronic
924764363 1:247018500-247018522 AAATCAGTGAATCCAGGAGCTGG + Intergenic
924865239 1:247972314-247972336 AAATCAGTGAATCCAGGAGCTGG + Intronic
924918626 1:248602088-248602110 AAATCAATGAATCCAGGAACTGG - Intergenic
1062948322 10:1477142-1477164 AAGCCAGCGTTTGCAGGATCGGG - Intronic
1062983411 10:1744591-1744613 AAATCTGTGAGTGCAGGTACAGG + Intergenic
1063176145 10:3552479-3552501 AAAGCAGTGAGGGCAGGAACTGG + Intergenic
1063276921 10:4579522-4579544 AAACCATTGATTGCAGAGAAAGG + Intergenic
1064906365 10:20350359-20350381 GAACCAGTGCTTGCAGAAAGAGG - Intergenic
1064933640 10:20655216-20655238 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1065553580 10:26892524-26892546 AAACAAGTGATGGCAAGATCAGG - Intergenic
1065599582 10:27355097-27355119 AAACAAGTGATGGCAAGATCAGG + Intergenic
1066232740 10:33453307-33453329 GAGCCAATCATTGCAGGAACTGG + Intergenic
1066595696 10:37047478-37047500 AAAACAATGAATCCAGGAACTGG - Intergenic
1066709626 10:38219448-38219470 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1066813322 10:39370068-39370090 AAATCAATGAATGCAGGAGCTGG - Intergenic
1066927509 10:41716211-41716233 AAATCAATGAATCCAGGAACCGG + Intergenic
1067057334 10:43059898-43059920 AAATCAGTAATTCCAGGATCTGG - Intergenic
1067172289 10:43917707-43917729 AAATCAATGAATGCAGGAGCTGG - Intergenic
1067198054 10:44139866-44139888 AAATCAATGAATGCAGGAGCTGG + Intergenic
1067673679 10:48349814-48349836 AAATCAGTGAATCCAGGAGCTGG + Intronic
1067845621 10:49718102-49718124 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1068239917 10:54291515-54291537 AAATCAGTGAATCCAGGAGCTGG + Intronic
1068542626 10:58312513-58312535 AAGCAAGTTAATGCAGGAACAGG - Intergenic
1068561753 10:58522747-58522769 AAATCAGTGAATCCAGGAGCTGG + Intronic
1068575451 10:58679229-58679251 AAATCAGTGAATCCAGGAGCTGG + Intronic
1068995516 10:63197977-63197999 AAACCAGTGATTTCAAGGAAGGG + Intronic
1069371222 10:67749858-67749880 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1070221935 10:74457024-74457046 AAATCAGTGAATCCAGGAGCTGG + Intronic
1070618710 10:77989621-77989643 AAAGCAGTGTTTGCCAGAACCGG + Intronic
1070905612 10:80070335-80070357 ATGCTAGTGAGTGCAGGAACTGG - Intergenic
1071035176 10:81236252-81236274 AAATCAGTGAATCCAGGAACTGG - Intergenic
1071076938 10:81766148-81766170 AAACCAATGAGTCCAGGAGCTGG - Intergenic
1071272702 10:84023101-84023123 AAACCAGTGAATTCAGGAGCTGG + Intergenic
1071844615 10:89508773-89508795 AAATCAATGAATGCAGGAGCTGG + Intronic
1072053973 10:91734726-91734748 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1072485855 10:95854380-95854402 AAATCAGTGAATCCAGGAGCTGG - Intronic
1072836818 10:98723912-98723934 AAATCAGTGAATCCAGGAGCTGG - Intronic
1073307994 10:102518274-102518296 CAGCCAGTGAATGCTGGAACTGG + Intronic
1073852471 10:107636844-107636866 AAGACAGTTATTGCAGGAAGAGG + Intergenic
1074477338 10:113784926-113784948 CAACCAGTGCCTGGAGGAACTGG + Intergenic
1074621896 10:115134230-115134252 AAATCAGTGAATCCAGGAGCTGG + Intronic
1074673496 10:115822474-115822496 AAATCAGTGAATCCAGGAGCTGG + Intronic
1075805079 10:125181898-125181920 AAATCAGTGATTCCAGGAGCTGG - Intergenic
1075858320 10:125650694-125650716 AAATCAATGAATCCAGGAACTGG + Intronic
1077696732 11:4400049-4400071 AAATCAGTGAGTCCAGGAGCTGG + Intergenic
1077716199 11:4583017-4583039 AAACCAGAAAGTGAAGGAACAGG + Intergenic
1077956577 11:7027068-7027090 AAACTAGTGACTACATGAACAGG - Intronic
1078178467 11:8988959-8988981 AAACCAGTGTTTTGAGGACCAGG - Intronic
1078377193 11:10806249-10806271 AAACCAGTGAAAGCAGAAACTGG - Intronic
1078698042 11:13654445-13654467 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1078726424 11:13935988-13936010 AAACCAATGAATCCAGGAGCTGG - Intergenic
1078743113 11:14087092-14087114 AAATCAGTGAATCCAGGAGCTGG - Intronic
1078809149 11:14740549-14740571 AAATCAGTGAATCCAGGAGCTGG - Intronic
1079752842 11:24220281-24220303 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1080209416 11:29768613-29768635 AAATCAATGAATGCAGGAGCTGG - Intergenic
1080346570 11:31332327-31332349 AAACCAATGAATCCAGGAGCTGG - Intronic
1081132279 11:39394874-39394896 AAATCAATGAATGCAGGATCTGG - Intergenic
1081151166 11:39634337-39634359 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1081181142 11:39987243-39987265 AAATCATTGAATGCAGGATCTGG + Intergenic
1081257381 11:40913741-40913763 AAATCAGTGATTCCAGGAGCTGG + Intronic
1081377793 11:42379994-42380016 AAATCAATGATTCCAGGAGCTGG + Intergenic
1081405329 11:42691201-42691223 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1081587108 11:44393806-44393828 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1082147344 11:48686193-48686215 AAATCAATGAATGCAGGAGCTGG + Intergenic
1082196313 11:49310693-49310715 AAATCAATGAATGCAGGAGCTGG - Intergenic
1082247981 11:49947026-49947048 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1082578101 11:54834339-54834361 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1082618831 11:55396212-55396234 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1082905778 11:58307079-58307101 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1084867095 11:72067875-72067897 AGACCACTGTTTCCAGGAACAGG + Intronic
1085014913 11:73167630-73167652 AAACCAGTGTCTCCAGGAAGGGG + Intergenic
1085133486 11:74062823-74062845 AAACCAATGAATCCAGGAGCTGG + Intronic
1085434174 11:76484444-76484466 AAATCAGTGAATCCAGGAGCTGG + Intronic
1086132528 11:83415938-83415960 AAATCAATGAGTCCAGGAACTGG - Intergenic
1086294735 11:85352357-85352379 AAATCAGTGAATCCAGGAGCTGG - Intronic
1086367027 11:86117541-86117563 AAAACAGTGAATTTAGGAACAGG + Intergenic
1086612591 11:88775386-88775408 AAATCAATGAATGCAGGAGCCGG - Intronic
1086714248 11:90046715-90046737 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1087243701 11:95809396-95809418 AAATCAGTGAATCCAGGAGCTGG + Intronic
1087248859 11:95873545-95873567 AAATCAGTGAATCCAGGAGCTGG - Intronic
1087653748 11:100898789-100898811 AAATCAGTGAATCCAGGAGCTGG - Intronic
1087696025 11:101377015-101377037 AAACCAATGAATTCAGGAGCTGG - Intergenic
1087703498 11:101463752-101463774 AAATCAGTGAATGCAGGAGCTGG - Intronic
1089765727 11:120763390-120763412 AAATCAGTGAATCCAGGAACTGG - Intronic
1090312993 11:125759139-125759161 AAACCAATGAATCCAGGAGCTGG + Intergenic
1090878459 11:130812595-130812617 AACCCAGAGATTGCAGCAGCAGG + Intergenic
1090879966 11:130824853-130824875 AACCAAGTGATTGCGGGGACAGG - Intergenic
1092309164 12:7333683-7333705 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1092327375 12:7547129-7547151 AAATCAATGATTCCAGGAGCTGG + Intergenic
1092761768 12:11817088-11817110 AGTCCAGTGAGTGCTGGAACCGG - Intronic
1093248673 12:16771977-16771999 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1093350475 12:18093790-18093812 AAATCAATGAATCCAGGAACTGG + Intronic
1093599622 12:21005873-21005895 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1093751344 12:22803914-22803936 GAGCAAGTGAGTGCAGGAACCGG + Intergenic
1093998017 12:25663391-25663413 AAATCAATGAATCCAGGAACTGG - Intergenic
1094256664 12:28437711-28437733 AAACCAGTGATAAGAGGCACAGG - Intronic
1094312090 12:29095357-29095379 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1094333881 12:29325945-29325967 AAATCAGTGAATCCAGGAGCTGG + Intronic
1094755704 12:33465915-33465937 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1095231864 12:39749113-39749135 AAATCAATGAATCCAGGAACTGG + Intronic
1095629292 12:44355791-44355813 AAAACAGTGATGGCAGCAAGAGG + Intronic
1095720494 12:45395034-45395056 AAATCAGTGAATCCAGGAGCTGG + Intronic
1096309407 12:50506603-50506625 ATACCAGTGATTCCCGGGACTGG - Intronic
1096738596 12:53675753-53675775 AAAAGAGTGTTTGCAGGGACTGG + Intronic
1097619811 12:61925894-61925916 AAATCAGTGAATCCAGGAGCTGG + Intronic
1097944213 12:65348534-65348556 AAATCAGTGAATCCAGGAGCTGG - Intronic
1098692012 12:73500981-73501003 AAATCAGTGAATCCAGGATCTGG - Intergenic
1098732648 12:74058741-74058763 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1099031124 12:77526946-77526968 AAGTCAGTGAGTGCAGGAGCTGG + Intergenic
1099087554 12:78263793-78263815 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1099822791 12:87734614-87734636 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1100470195 12:94884927-94884949 AAATCAGTGAGTACAGGAGCTGG + Intergenic
1100761028 12:97807406-97807428 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1101702524 12:107188250-107188272 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1102739081 12:115190145-115190167 AAACCGGTGATTGCAGTGCCTGG - Intergenic
1103796370 12:123506002-123506024 AAACCAGTGAGAGCAGAATCAGG - Intronic
1104726495 12:131079022-131079044 AAATCGGTGCTTGCAGGAGCCGG - Intronic
1105648691 13:22349250-22349272 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1105672397 13:22634001-22634023 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1106539521 13:30677362-30677384 AAAACAGGCATTCCAGGAACTGG + Intergenic
1107316904 13:39142382-39142404 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1107380429 13:39851217-39851239 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1107713183 13:43170751-43170773 AAACCAGAGATTTCAACAACAGG - Intergenic
1108188364 13:47911151-47911173 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1108479985 13:50859107-50859129 AAATCAATGAATTCAGGAACTGG + Intergenic
1109076958 13:57847784-57847806 TAACCACTGATTGCAGTAAGTGG + Intergenic
1110390020 13:74962625-74962647 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1110520893 13:76475157-76475179 AAGCCAGTGAATGAATGAACTGG + Intergenic
1110968571 13:81732244-81732266 AAATCAATGAATCCAGGAACTGG - Intergenic
1111341838 13:86897065-86897087 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1112152228 13:96776384-96776406 AAATCAGTGAATCCAGGAGCTGG + Intronic
1112860745 13:103827200-103827222 AAATCAGTGAATCCAGGATCTGG - Intergenic
1113021018 13:105887355-105887377 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1113300689 13:109015909-109015931 AAATCAGTGAATCCAGGAGCTGG - Intronic
1113703457 13:112407411-112407433 AAATCAGTGAATCCAGGAGCTGG + Intronic
1114133245 14:19817635-19817657 AAATCAGTGAATCCAGGAGCTGG - Intronic
1114172127 14:20283225-20283247 AAACCAATGAATCCAGGAGCTGG + Intronic
1114599901 14:23946656-23946678 AAACCAATGAATCCAGGAGCTGG + Intergenic
1114603882 14:23979995-23980017 AAACCAGTGAATCCAGGAGCTGG + Intronic
1114608892 14:24022773-24022795 AAACCAGTGAATCCAGGAGCTGG + Intergenic
1114609382 14:24027760-24027782 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1114661719 14:24350430-24350452 CAACCAATGAGTGCAGGCACTGG - Intergenic
1114749439 14:25186595-25186617 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1115162044 14:30407419-30407441 AAACCAATGAATCCAGGAGCTGG - Intergenic
1115265689 14:31497719-31497741 AAATCAATGAATCCAGGAACTGG + Intronic
1115390931 14:32854108-32854130 AAATCAATGAATGCAGGAGCTGG - Intergenic
1115511624 14:34143147-34143169 AAATCAGTGAATCCAGGAGCTGG + Intronic
1116036738 14:39636478-39636500 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1116212452 14:41965761-41965783 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1116730038 14:48609885-48609907 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1116758255 14:48976959-48976981 AAACCAGAGGTTTCAGGTACTGG - Intergenic
1116914278 14:50507299-50507321 AAATCAGTGAATCCAGGAGCTGG - Intronic
1117121422 14:52571794-52571816 AAATCAATGATTCCAGGAGCTGG + Intronic
1117238282 14:53801370-53801392 AAATCAGTGAATACAGGAGCTGG + Intergenic
1117489454 14:56231802-56231824 AAATCAGTGAATCCAGGAGCTGG + Intronic
1117626635 14:57646569-57646591 AAATCAATGAATCCAGGAACTGG - Intronic
1117711020 14:58528898-58528920 AAATCAATGAATGCAGGAGCTGG + Intronic
1117900355 14:60526199-60526221 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1118450341 14:65895228-65895250 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1118569328 14:67177024-67177046 AAATCAGTGAATCCAGGAGCTGG - Intronic
1119644044 14:76335784-76335806 AAACCAGAGCTTGCAGAATCAGG - Intronic
1120118669 14:80651364-80651386 AAATCAGTGAATCCAGGAGCTGG - Intronic
1120341671 14:83228022-83228044 ATACCAGTAACTGCAGGAAATGG - Intergenic
1120797792 14:88654229-88654251 AAATCAGTGAATCCAGGAGCTGG - Intronic
1121024541 14:90605416-90605438 AAACCTGAGATTGCAGGCATTGG - Intronic
1121079166 14:91093928-91093950 AGATCAGTGGTTGCAGGGACTGG + Intronic
1121711702 14:96043483-96043505 AAACCACTCACTGCAGGGACGGG - Intronic
1121759349 14:96431206-96431228 AAATCAGTGAATCCAGGATCTGG - Intronic
1122830867 14:104394979-104395001 CAACCACTGACTCCAGGAACTGG + Intergenic
1123176787 14:106427316-106427338 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1123428943 15:20197848-20197870 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1123949669 15:25258800-25258822 AAATCAATGAATCCAGGAACTGG + Intergenic
1124724387 15:32142866-32142888 AAATCAATGAATCCAGGAACGGG - Intronic
1125058300 15:35388789-35388811 AAATCAGTGAATCCAGGAGCTGG - Intronic
1125199273 15:37086302-37086324 AAACCAGTGTTTTCAGTTACAGG - Intronic
1125351899 15:38776538-38776560 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1126074223 15:44893475-44893497 AAAACAGTGAATCCAGGAGCTGG - Intergenic
1126365745 15:47892589-47892611 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1126656847 15:50987250-50987272 AAATCAGTGAATCCAGGAGCTGG - Intronic
1126715237 15:51509252-51509274 AAATCAGTGAATCCAGGAGCTGG + Intronic
1126720365 15:51571980-51572002 AAATCAATGAATCCAGGAACTGG + Intronic
1126956542 15:53939041-53939063 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1127182439 15:56436650-56436672 AAATCAGTGAATCCAGGAGCTGG + Intronic
1127194005 15:56564597-56564619 AAATCAGTGAATCCAGGAACTGG + Intergenic
1127355633 15:58196587-58196609 AAATCAGTGAATCCAGGAGCTGG + Intronic
1127452274 15:59128488-59128510 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1127534572 15:59878151-59878173 AAAGCAGTTGCTGCAGGAACAGG - Intergenic
1127564122 15:60169765-60169787 CAAGCAGTGATTGAAGGAAGCGG - Intergenic
1128171185 15:65514922-65514944 AAACCAGTGCTTGCAAGAATAGG + Intronic
1128857201 15:71028892-71028914 AAATCAGTGAATCCAGGAGCTGG - Intronic
1129563521 15:76596001-76596023 AAATCAGTGAATCCAGGAGCTGG + Intronic
1129967292 15:79748038-79748060 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1130110798 15:80963029-80963051 AAATCAGTGAATCCAGGAGCTGG + Intronic
1130737227 15:86563091-86563113 AAATCAGTGAATCCAGGAGCTGG - Intronic
1131106677 15:89739468-89739490 AAAACAGTGCTTGCAGGATTAGG - Intronic
1132147222 15:99436189-99436211 CAATCAGTCATTGCAGGGACAGG + Intergenic
1132287662 15:100676515-100676537 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1132512348 16:350249-350271 AACCCAGAGATTTCAGGAATTGG - Intronic
1134758262 16:16688872-16688894 AAATCAATGATTCCAGGAGCTGG - Intergenic
1134987811 16:18670305-18670327 AAATCAATGATTCCAGGAGCTGG + Intergenic
1135865293 16:26095810-26095832 AAATCAGTGAATCCAGGAGCTGG + Intronic
1135958136 16:26973521-26973543 AAACTTGTGATTGACGGAACTGG - Intergenic
1136313190 16:29429573-29429595 AAAGCAGAGGTTGAAGGAACAGG - Intergenic
1136643229 16:31585997-31586019 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1136908654 16:34127267-34127289 AAATCAATGAATCCAGGAACTGG - Intergenic
1137224789 16:46493034-46493056 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1137239585 16:46644030-46644052 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1137360548 16:47810919-47810941 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1137681150 16:50346464-50346486 AAATCAATGAATCCAGGAACTGG + Intronic
1138789281 16:59883549-59883571 AACCCAGTCATTGAAGGTACTGG - Intergenic
1138843358 16:60536240-60536262 AAATCAATGAATCCAGGAACTGG - Intergenic
1139076023 16:63449148-63449170 AAACCAGAGATAGTAGGAAATGG - Intergenic
1140715670 16:77723300-77723322 AAATCAGTGAATGCTGGCACAGG - Intronic
1140954952 16:79854485-79854507 AAATCAATGAATCCAGGAACTGG - Intergenic
1141119654 16:81342821-81342843 AAATCAATGAATCCAGGAACTGG + Intronic
1141642856 16:85351490-85351512 AAATGAGTGATTGCAGGGCCTGG + Intergenic
1142744046 17:1946281-1946303 AAACCTCTGAATGCAGGAAGGGG + Intronic
1144432230 17:15204051-15204073 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1144476786 17:15595607-15595629 AATCCAGCGGTTGCAGGCACAGG - Intronic
1144921457 17:18767742-18767764 AATCCAGCGGTTGCAGGCACAGG + Intronic
1145831854 17:27922661-27922683 ACAACAGTGAGTGCAGGAAAGGG + Intergenic
1146312870 17:31783580-31783602 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1146462982 17:33062109-33062131 AAATCAGTGAATCCAGGAGCTGG - Intronic
1146745242 17:35323263-35323285 AAGCAAGTGAGTGCAGGAACTGG + Intergenic
1147016088 17:37492446-37492468 AAACCGGTAATTTCAGGAAATGG + Intronic
1148952868 17:51329647-51329669 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1149323359 17:55504769-55504791 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1149352196 17:55801909-55801931 AAATCAGTGAATCCAGGAGCTGG + Intronic
1149404746 17:56336666-56336688 AAATCAATGAATCCAGGAACTGG - Intronic
1149901673 17:60485646-60485668 AAATCAGTGAATCCAGGAGCTGG - Intronic
1150301673 17:64052547-64052569 AAACAAGTGATTGGAAGAATAGG + Intronic
1150818078 17:68411071-68411093 AAATCAGTGAATCCAGGAGCTGG - Intronic
1151015392 17:70547763-70547785 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1153064643 18:1032255-1032277 AAACCAGTGAATCCAAGAGCTGG - Intergenic
1153114986 18:1644131-1644153 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1154363895 18:13688852-13688874 AGGCAAGTGAGTGCAGGAACCGG - Intronic
1154444707 18:14425883-14425905 AAATCAGTGAATCCAGGAAGTGG - Intergenic
1155432475 18:25774948-25774970 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1156296233 18:35793782-35793804 AAACCAATGAATCCAGGAGCTGG + Intergenic
1156913808 18:42441910-42441932 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1157057971 18:44253186-44253208 AAACCAATGAATCCAGGAGCTGG - Intergenic
1157574307 18:48733443-48733465 AAACCACTGAGTGCAGGGTCAGG + Intronic
1157659144 18:49423589-49423611 AAATCAGTGAATCCAGGAGCTGG + Intronic
1158054037 18:53258159-53258181 AAATCAATGATTCCAGGAGCTGG - Intronic
1158469441 18:57722291-57722313 AAATCAGTGAATCCAGGAGCTGG + Intronic
1158934501 18:62352087-62352109 CAACCAGTTATTGCAGGCAAGGG - Intronic
1159387550 18:67745190-67745212 AAATCAGTGAATCCAGGAGCAGG + Intergenic
1159693920 18:71529282-71529304 AGACCAGTGAATCCAGGAGCTGG + Intergenic
1159846894 18:73471715-73471737 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1160002227 18:75035964-75035986 AAACCAGAGGTGGCAGGAATGGG + Intronic
1164248338 19:23454695-23454717 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1164307384 19:24016320-24016342 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1164688384 19:30187606-30187628 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1164966317 19:32487683-32487705 GAGCAAGTGAGTGCAGGAACCGG - Intergenic
1165652379 19:37502561-37502583 AACCCTGTGCTTGCAGAAACAGG - Intergenic
1166616314 19:44250941-44250963 AAATCAGTGAATGCAGGAGCTGG + Intronic
925334584 2:3085557-3085579 AAATCAGTGAATCCAGGAGCTGG + Intergenic
926068489 2:9864141-9864163 AAATCAGTGAATCCAGGAGCTGG + Intronic
927028217 2:19092456-19092478 AAATCAGTGATTCCAGGAGCTGG + Intergenic
927117538 2:19919778-19919800 AAATCAATGAATCCAGGAACTGG + Intronic
927363970 2:22272758-22272780 AAACAAGTGATTTCAGAACCTGG + Intergenic
927754651 2:25698933-25698955 TAATCAGTGTTTGCAGGAAAGGG + Intergenic
928368345 2:30720882-30720904 AAATCAGTGAATCCAGGAGCTGG - Intergenic
928380839 2:30816866-30816888 AAATCAGTGAATCCAGGAGCTGG + Intronic
928851757 2:35756712-35756734 AAACCAGTGAATTCAGCAAGAGG - Intergenic
928852786 2:35769327-35769349 AAATCAGTGAATCCAGGATCTGG + Intergenic
929062611 2:37938844-37938866 AAATCAGTGAATCCAGGAGCTGG - Intronic
929157125 2:38798463-38798485 TAAGCAGTGCTTGGAGGAACAGG + Intronic
930175721 2:48299629-48299651 AAATCAATGAATCCAGGAACTGG - Intergenic
930477029 2:51894509-51894531 AAATCAGTGAATCCAGGAGCTGG + Intergenic
930945377 2:57067672-57067694 AAATCAGTGAATCCAGGAGCTGG - Intergenic
931043915 2:58328518-58328540 AAATCAGTGAATCCAGGAGCTGG + Intergenic
931074261 2:58691694-58691716 AAATCAGTGAATCCAGGAGCTGG + Intergenic
931204374 2:60133145-60133167 AAATCAGTGAATCCAGGAGCTGG - Intergenic
931306876 2:61037805-61037827 AAATCAGTGAATCCAGGAGCTGG + Intronic
931478842 2:62619355-62619377 AAATCAGTGAATCCAGGAGCTGG - Intergenic
931498565 2:62838534-62838556 AAATCAGTGAATCCAGGAGCTGG + Intronic
931556289 2:63509623-63509645 AAATCAGTGAATCCAGGAGCTGG + Intronic
931963508 2:67507385-67507407 AAATCAGTGAATCCAGGAGCTGG + Intergenic
931971529 2:67592090-67592112 AAACCAATGAGTCCAGGAGCTGG + Intergenic
932013828 2:68004025-68004047 AAATCAGTGAATCCAGGAGCTGG + Intergenic
932069040 2:68598155-68598177 AAATCAGTGAATCCAGGAGCTGG + Intronic
932080915 2:68714432-68714454 AAATCAGTGAATCCAGGAGCTGG - Intronic
932101033 2:68899256-68899278 AAACGGCTGATTGCAGGATCAGG + Intergenic
932540418 2:72645986-72646008 AAATCAGTGAATCCAGGAGCTGG + Intronic
933590569 2:84227931-84227953 AAATCAGTGAATCCAGGACCCGG + Intergenic
933603465 2:84357010-84357032 AAATCAATGAATCCAGGAACTGG + Intergenic
935822908 2:106912365-106912387 AAATCAGTGAATCCAGGAGCAGG + Intergenic
935963780 2:108452431-108452453 AAACCTGTTACTGAAGGAACTGG + Exonic
936063167 2:109310535-109310557 AAATCAGTGAATCCAGGAGCTGG + Intronic
936256257 2:110916603-110916625 AAATCAGTGAATCCAGGAGCTGG + Intronic
936529699 2:113267523-113267545 AAACCACAGGTTGCAAGAACAGG + Intronic
936701305 2:115014538-115014560 AAACCAATGAATCCAGGAGCTGG + Intronic
937573848 2:123395178-123395200 AAACCAATGAATCCAGGAGCTGG + Intergenic
937893657 2:126960568-126960590 AAATCAATGAATCCAGGAACTGG - Intergenic
937931850 2:127211886-127211908 AAATCAATGAATCCAGGAACTGG + Intronic
938799645 2:134749460-134749482 AAATCAGTGAATCCAGGAGCTGG - Intergenic
938864688 2:135406015-135406037 AAATCAGTGAATACAGGAGCTGG + Intronic
939193112 2:138939875-138939897 AAATCAGTGAATCCAGGAGCTGG - Intergenic
939477904 2:142710192-142710214 AAATCAGTGAATCCAGGAGCTGG - Intergenic
940083960 2:149837041-149837063 AAATCAGTGAATCCAGGAGCTGG - Intergenic
940094699 2:149961351-149961373 AAATCAGTGAATCCAGGAACTGG - Intergenic
940095450 2:149968902-149968924 AAATCAGTGAATCCAGGAGCTGG + Intergenic
940096370 2:149980705-149980727 AAATCAGTGAATCCAGGAGCTGG + Intergenic
940114718 2:150195365-150195387 AAATCAGTGAATCCAGGAACTGG + Intergenic
940417186 2:153436773-153436795 AAATCAGTGAATCCAGGAGCTGG - Intergenic
940506392 2:154559372-154559394 AAATCAGTGAATCCAGGAGCTGG - Intergenic
940964806 2:159825152-159825174 AAATCAGTGAATCCAGGAGCTGG + Intronic
940999321 2:160184173-160184195 AAATCAGTGAATCCAGGAGCTGG + Intronic
941337513 2:164264172-164264194 AAATCAGTGAATCCAGGAGCTGG + Intergenic
941524080 2:166584418-166584440 AAATCAATGAATCCAGGAACTGG + Intergenic
942362764 2:175189926-175189948 AAATCAGTGAATCCAGGAGCTGG + Intergenic
942632514 2:177966516-177966538 AAACTAGGCATTGAAGGAACAGG - Intronic
942744386 2:179215183-179215205 AAATCAATGAATGCAGGAGCTGG + Intronic
943185869 2:184606780-184606802 GACTCAGTGATTGCAGGAGCTGG - Intronic
943630008 2:190240438-190240460 AAATCAGTGAATCCAGGAGCTGG - Intronic
943999035 2:194809070-194809092 AAATCAATGAATCCAGGAACTGG + Intergenic
944033606 2:195266661-195266683 AAATCAATGAATCCAGGAACTGG - Intergenic
944925741 2:204462378-204462400 AAATCAGTGAATCCAGGAGCTGG - Intergenic
945359031 2:208873447-208873469 AAAGCAGTGACTGCAGGGAAAGG + Intergenic
945392786 2:209284889-209284911 AAATCAATGAATGCAGGAGCTGG + Intergenic
945597128 2:211809637-211809659 AAATCAGTGAATCCAGGACCTGG - Intronic
945667012 2:212755965-212755987 AAAGCAATGAATCCAGGAACAGG + Intergenic
945944114 2:215978076-215978098 AAATCAATGAATCCAGGAACTGG + Intronic
946448436 2:219759545-219759567 AGCCCAGTGATGGCAGGAACAGG - Intergenic
946513411 2:220385164-220385186 AAATCAGTGAATCCAGGAGCTGG - Intergenic
946532191 2:220583087-220583109 AAACCAGTGATAGCAGAAAGAGG + Intergenic
946913319 2:224488314-224488336 AAATCAATGAATCCAGGAACTGG + Intronic
947106018 2:226668565-226668587 AGACAAGTGAATGCAGGAAGAGG + Intergenic
947301629 2:228694211-228694233 AAACCAATGAATCCAGGAGCTGG - Intergenic
947322250 2:228933395-228933417 AAATCAATGAATGCAGGAACTGG - Intronic
947492415 2:230606832-230606854 AAATCAGTGAATCCAGGAGCTGG + Intergenic
947515720 2:230802453-230802475 AAATCAGTGAATCCAGGAGCTGG + Intronic
947661399 2:231871721-231871743 AAACAAGAGAATACAGGAACAGG - Intergenic
1169042051 20:2504004-2504026 AAATCAGTGAATCCAGGAGCTGG + Intronic
1169245739 20:4023072-4023094 AAAACCCTGAGTGCAGGAACTGG - Intergenic
1169306813 20:4498752-4498774 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1169396753 20:5238694-5238716 AAATCAATGATTCCAGGAGCTGG - Intergenic
1170265384 20:14461373-14461395 AAATCAGTGAATCCAGGAGCTGG - Intronic
1171076532 20:22132368-22132390 AAATCAATGAATCCAGGAACTGG + Intergenic
1171575227 20:26303965-26303987 AAATCAATGAATCCAGGAACTGG + Intergenic
1173351217 20:42247375-42247397 AAATCACTGATTGCTGGAAATGG + Intronic
1174694818 20:52546440-52546462 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1174788785 20:53458507-53458529 AAACTAGTGAATCCAGGAGCTGG - Intronic
1174937335 20:54885103-54885125 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1176350269 21:5788316-5788338 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1176357083 21:5908900-5908922 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1176544590 21:8186386-8186408 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1176563541 21:8369431-8369453 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1176892079 21:14330360-14330382 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1177142705 21:17375235-17375257 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1177426172 21:20925265-20925287 AAATCAGTGAATCCAGGAACTGG + Intergenic
1177541287 21:22496673-22496695 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1178039226 21:28621032-28621054 AAATCAATGATTCCAGGAGCTGG - Intergenic
1178965419 21:37112238-37112260 AAATCAGTGAATCCAGGAGCTGG + Intronic
1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG + Intronic
1179130828 21:38635870-38635892 GAACTAGTGATTGCAAGAGCTGG - Intronic
1180048376 21:45320219-45320241 AAACCAGTGAGTGCAGTGAGAGG + Intergenic
1180864670 22:19110300-19110322 AAGGCAGGGACTGCAGGAACAGG + Intronic
1181362437 22:22348397-22348419 AAGCCTTTGATTCCAGGAACAGG + Intergenic
1181635216 22:24171325-24171347 AACCCAGGGAATGCAGGAACAGG - Intronic
1181800168 22:25341810-25341832 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1182015706 22:27038006-27038028 AAGTCAATGATTTCAGGAACTGG + Intergenic
1182179942 22:28336787-28336809 AAATCAGTGAATCCAGGAGCTGG - Intronic
1183642495 22:39101054-39101076 AAACCAGGGAAGGCAGGAAGCGG + Intronic
1184874972 22:47268670-47268692 CAACCAGGGATTCCAGGAATAGG + Intergenic
1203249459 22_KI270733v1_random:102623-102645 AAATCAGTGAATTCAGGAGCTGG + Intergenic
949131635 3:509072-509094 AAATCAATGAATGCAGGAGCTGG - Intergenic
949298090 3:2550146-2550168 AAATCAATGACTCCAGGAACTGG - Intronic
949299119 3:2562489-2562511 AAACAAATTAATGCAGGAACAGG - Intronic
949342817 3:3047821-3047843 AAATCAGTGAATCCAGGAGCTGG + Intronic
949450298 3:4177734-4177756 AAATCAGTGAATCCAGGAGCTGG + Intronic
949631833 3:5936869-5936891 AAATCAATGAATCCAGGAACTGG + Intergenic
949687234 3:6589966-6589988 AAATCAGTGAATCCAGGAGCTGG + Intergenic
949800219 3:7895762-7895784 AAATCAATGAATCCAGGAACTGG - Intergenic
949816616 3:8065562-8065584 AAATCAGTGAATCCAGGAGCTGG - Intergenic
950761779 3:15236301-15236323 TAACCAGATATTGCAGAAACAGG - Intronic
950995505 3:17492228-17492250 AAATCAGTGAATCCAGGAGCTGG - Intronic
951238726 3:20265401-20265423 AAGCGAATGAGTGCAGGAACTGG - Intergenic
951618036 3:24569938-24569960 AAATCAGTGAATCCAGGAGCTGG + Intergenic
951725667 3:25755511-25755533 ACTGCAGTTATTGCAGGAACTGG - Intronic
952073989 3:29673441-29673463 AAATCAGTGAATCCAGGAGCTGG + Intronic
952498303 3:33935484-33935506 AAGCCCATGAGTGCAGGAACTGG - Intergenic
952501580 3:33967629-33967651 AAATCAATGAATGCAGGAGCTGG - Intergenic
952515222 3:34097255-34097277 AAATCAGTGAATGCAGGAGCTGG + Intergenic
952517361 3:34119020-34119042 AAATCAGTGAATCCAGGAGCTGG - Intergenic
952587211 3:34907303-34907325 AAATCAATGAATCCAGGAACTGG + Intergenic
952729550 3:36624446-36624468 AAATCAGTGAATCCAGGAGCTGG - Intergenic
953081020 3:39617943-39617965 AAATCAGTGAATCCAGGAGCTGG - Intergenic
953281442 3:41561808-41561830 AAATCAGTGAATCCAGGAGCTGG - Intronic
953459128 3:43067825-43067847 AAACCAATGAATCCAGGAGCTGG + Intergenic
954563266 3:51576794-51576816 AAATCAGTGAATCCAGGAGCTGG - Intronic
954978875 3:54724960-54724982 AAATTAGTGAATCCAGGAACTGG + Intronic
955211766 3:56948322-56948344 AAATCAGTGAATCCAGGAGCTGG + Intronic
955593722 3:60565708-60565730 AAATCAGTGAATCCAGGAGCTGG - Intronic
955630023 3:60963377-60963399 AAATCAGTGAATCCAGGAGCTGG - Intronic
956386201 3:68722336-68722358 AAACCAATGAATCCAGGAGCTGG - Intergenic
957353070 3:79051102-79051124 AAATCAATGAATCCAGGAACTGG + Intronic
957696145 3:83640054-83640076 AAATCAGTGAATCCAGGAGCTGG + Intergenic
958078866 3:88719511-88719533 AAAACAGTGGTTGCAGCATCTGG + Intergenic
958176215 3:89999153-89999175 AAATCAGTGAATCCAGGAGCTGG + Intergenic
958483994 3:94679911-94679933 AAATCAGTGAATCCAGGAACAGG + Intergenic
958681007 3:97331442-97331464 AAATCAATGAATCCAGGAACTGG + Intronic
958805466 3:98804494-98804516 AAATCAGTGAATCCAGGAGCTGG - Intronic
958979020 3:100698528-100698550 AAACAAGAGATTGCAGGAAAGGG + Intergenic
959013956 3:101111514-101111536 AAATCAGTGAATCCAGGAGCTGG + Intergenic
959041807 3:101430636-101430658 AAATCAGTGAATCCAGGAGCTGG - Intronic
959693469 3:109224314-109224336 AAGCGAGTGAGTGCAGGATCTGG + Intergenic
962122965 3:132583497-132583519 AAATCAGTGAATCCAGGAGCTGG - Intronic
962287387 3:134098662-134098684 AAATCAGTGAATCCAGGAGCTGG - Intronic
962439421 3:135398811-135398833 AAATCAGTGAATCCAGGAGCTGG - Intergenic
963459511 3:145591056-145591078 TAACAAGTGATGGCAGGAATGGG + Intergenic
963567099 3:146943625-146943647 AAATCAATGATTCCAGGAGCTGG - Intergenic
964332883 3:155623451-155623473 AAACCAATGAATCCAGGAGCTGG + Intronic
964694706 3:159494297-159494319 AAATCAGTGAATCCAGGAGCTGG + Intronic
965097889 3:164257608-164257630 AAATCAATGAATCCAGGAACTGG + Intergenic
965621635 3:170648088-170648110 AAATCAATGAATCCAGGAACTGG - Intronic
965654757 3:170972389-170972411 AAATCAATGATTCCAGGAGCTGG - Intergenic
966070640 3:175873282-175873304 AAATCAATGAATCCAGGAACTGG - Intergenic
966487528 3:180487877-180487899 AAATCAGTGAATCCAGGAGCTGG + Intergenic
966582876 3:181588338-181588360 AAATCAATGAATGCAGGAGCTGG - Intergenic
966637620 3:182153637-182153659 AAATCAGTGAATCCAGGAGCTGG - Intergenic
967737522 3:192968811-192968833 AAATCAGTGAATTCAGGAGCTGG - Intergenic
967777577 3:193400202-193400224 GAAGCAGTAATTGAAGGAACAGG - Intergenic
968217853 3:196908959-196908981 AAATCAGTGAATCCAGGAGCTGG + Intronic
970972422 4:21999823-21999845 AAATCAGTGAATCCAGGAGCTGG + Intergenic
971433281 4:26591531-26591553 AAATCAATGAATCCAGGAACTGG + Intronic
971706196 4:30046784-30046806 AAATCAGTGAATCCAGGAGCTGG - Intergenic
971883533 4:32412538-32412560 AAGTCAGTGAATCCAGGAACTGG + Intergenic
972376814 4:38479647-38479669 AAATCAGTGAATCCAGGAGCTGG + Intergenic
972742685 4:41903551-41903573 AAATCAGTGAATCCAGGAGCTGG - Intergenic
972755861 4:42045255-42045277 AAACCAGTGAATCCAGGAGCTGG + Intronic
972883385 4:43453844-43453866 AAACCAGATATTGGTGGAACGGG - Intergenic
972905717 4:43744657-43744679 AAATCAGTGAATCCAGGAGCTGG - Intergenic
973328584 4:48889286-48889308 AAATCAATGAATCCAGGAACTGG - Intronic
973564262 4:52168161-52168183 AAATCAGTGAATCCAGGAGCTGG - Intergenic
973625788 4:52771103-52771125 AAATCAGTGAATCCAGGAGCTGG - Intergenic
973678983 4:53296585-53296607 AAATCAGTGAATCCAGGAGCTGG - Intronic
973883831 4:55300328-55300350 AAATCAGTGAATCCAGGAGCTGG + Intergenic
974114333 4:57562237-57562259 AAATCAGTGAATCCAGGAGCTGG - Intergenic
974119547 4:57622276-57622298 AAATCAGTGAATCCAGGAGCTGG - Intergenic
974654600 4:64802647-64802669 AAATCAATGATTCCAGGATCTGG + Intergenic
974774324 4:66460271-66460293 AAATCAGTGAATCCAGGAGCAGG - Intergenic
974780641 4:66548289-66548311 AAATCAGTGAATCCAGGAGCTGG + Intergenic
974962515 4:68721402-68721424 AAATCAATGAATCCAGGAACTGG + Intergenic
975039100 4:69723065-69723087 AAATCAGTGAATTCAGGAGCTGG + Exonic
975178214 4:71311965-71311987 AAATCAATGATTGCGGGAGCTGG + Intronic
975212665 4:71719378-71719400 AAATCAGTGAATCCAGGAGCTGG - Intergenic
975503466 4:75113058-75113080 AAATCAGTGAATCTAGGAACTGG + Intergenic
975842564 4:78490848-78490870 AAATCAGTGAATCCAGGAGCTGG + Intronic
975887130 4:78979376-78979398 AAACCAATGAATCCAGGAGCTGG - Intergenic
976083709 4:81385647-81385669 AAATCAGTGAATCCAGGAGCTGG + Intergenic
976099299 4:81543568-81543590 AAATCAGTGAATCCAGGAGCTGG + Intronic
976115145 4:81718391-81718413 AAACCAATGAATCCAGGAGCTGG + Intronic
976395751 4:84553610-84553632 AAATCAATGAATCCAGGAACTGG + Intergenic
976666163 4:87594964-87594986 ATACCAGCCATTCCAGGAACTGG + Intergenic
976998500 4:91465546-91465568 AAATCAGTGAATCCAGGAGCTGG + Intronic
977029216 4:91861273-91861295 AAATCAGTGAATCCAGGAGCTGG - Intergenic
977755684 4:100668892-100668914 AAATCAATGAATCCAGGAACTGG - Intronic
977793292 4:101132297-101132319 AAATCAGTGATTCCAGGAGCTGG + Intronic
977922167 4:102657757-102657779 ATATCAGTGATTGCTGGAACTGG - Exonic
978088862 4:104689835-104689857 AAATCAATGAATCCAGGAACTGG - Intergenic
978408326 4:108402603-108402625 AAACTAGTGACTGCAAGAAGTGG - Intergenic
978476969 4:109141874-109141896 AAATCAGTTAATCCAGGAACTGG - Intronic
978590981 4:110324767-110324789 AAACCAATGAATCCAGGAGCTGG - Intergenic
978596999 4:110388672-110388694 AAATCAGTGAATCCAGGAGCTGG - Intronic
978929209 4:114290229-114290251 AAATCAGTGAATCCAGGAACTGG + Intergenic
979423347 4:120533331-120533353 AAACCAGTGAATCCAGGAGCTGG - Intergenic
979581670 4:122367972-122367994 AAATCAATGAATGCAGGAGCTGG + Intergenic
980068470 4:128216838-128216860 AAATCAGTGAATCCAGGAGCTGG + Intronic
980205832 4:129718431-129718453 AAATCAATGAATCCAGGAACTGG - Intergenic
980336164 4:131476345-131476367 AAATCAGTGAATCCAGGAGCTGG + Intergenic
981149527 4:141365348-141365370 AAATCAGTGAATCCAGGAGCTGG - Intergenic
981160406 4:141491164-141491186 AAATCAGTGAATCCAGGAGCTGG - Intergenic
981188778 4:141836813-141836835 AAATCAATGATTCCAGGAGCTGG + Intergenic
981671845 4:147295655-147295677 AAATCAGTGAATCCAGGAGCTGG + Intergenic
981684415 4:147437208-147437230 AAATCAGTGAATCCAGGAGCTGG + Intergenic
981687276 4:147468751-147468773 AAATCAGTGAATCCAGGAGCTGG - Intergenic
981809984 4:148762935-148762957 AAACCAATGAATCCAGGAGCTGG + Intergenic
982298654 4:153856672-153856694 AAATCAATGAATGCAGGAGCTGG - Intergenic
982310576 4:153981027-153981049 AAATCAATGAATGCAGGAGCTGG - Intergenic
982372592 4:154650047-154650069 AAATCAGTGATTCCAGGAGCTGG + Intronic
982383465 4:154774674-154774696 AAATCAGTGAATCCAGGAGCTGG - Intergenic
982413246 4:155103342-155103364 AAAGCAGGGATTGGAGGGACTGG - Intergenic
983044208 4:162966804-162966826 AAATCAGTGAATCCAGGAACTGG - Intergenic
983108684 4:163721977-163721999 AAATCAATGAATCCAGGAACTGG - Intronic
983156406 4:164353806-164353828 AAATCAATGAATCCAGGAACTGG + Intronic
983172468 4:164551744-164551766 GAATGAGTGAGTGCAGGAACTGG + Intergenic
983280217 4:165671362-165671384 AAGCCAGCGATTGCAAGCACTGG + Intergenic
983292301 4:165822069-165822091 AAATCAATGAATCCAGGAACTGG + Intergenic
983596007 4:169469062-169469084 AAATCAGTGAATCCAGGAGCTGG - Intronic
983958519 4:173724889-173724911 AAATCAGTGAATCCAGGAGCTGG - Intergenic
984105494 4:175540804-175540826 AAATGAGTGAGTGTAGGAACCGG + Intergenic
984340237 4:178447752-178447774 AAATCAATGAATCCAGGAACTGG - Intergenic
984618946 4:181930210-181930232 AAACCAATGAATCCAGGAGCTGG + Intergenic
985317716 4:188675900-188675922 AAATCAGTGAATCCAGGAGCTGG + Intergenic
985347378 4:189020314-189020336 AATCCAGTTATTGCTGAAACAGG + Intergenic
985654798 5:1124833-1124855 ACACCAGTGCTTGCACTAACCGG + Intergenic
986110659 5:4712973-4712995 AAATCAGTGAATCCAGGAGCTGG + Intergenic
986484646 5:8223209-8223231 AAACCAGTGAATCCAGGAGCTGG + Intergenic
986879871 5:12156690-12156712 AAATCAGTGAATCCAGGATCTGG + Intergenic
987656820 5:20817798-20817820 AAATCAATGAATCCAGGAACTGG + Intergenic
987889376 5:23856295-23856317 AAATCAGTGAATCCAGGATCTGG - Intergenic
988044952 5:25938839-25938861 AAATCAGTGAATCCAGGAGCTGG + Intergenic
988678982 5:33465154-33465176 AAACTACTGAGTGCAGTAACAGG - Intronic
989072472 5:37525674-37525696 AAATCAGTGAATCCAGGAGCTGG + Intronic
989465072 5:41745593-41745615 AAATCAGTGAATCCAGGAGCTGG + Intronic
989857403 5:46315404-46315426 AAATTAGTGAATCCAGGAACTGG + Intergenic
990142396 5:52720940-52720962 AAATCAGTGAATCCAGGAGCTGG + Intergenic
990913562 5:60878816-60878838 AAATCAGTGAATCCAGGAGCTGG - Intronic
991134352 5:63163790-63163812 AGTCCAGTGGTTTCAGGAACAGG - Intergenic
991390569 5:66139105-66139127 ATATCAGTGCTTGCAGGAGCTGG + Intergenic
991532355 5:67629709-67629731 AAATCAATGAATCCAGGAACTGG - Intergenic
992338210 5:75795568-75795590 AAATCAATGATTCCAGGAGCTGG - Intergenic
992516987 5:77504070-77504092 AAATCAGTGAATCCAGGAGCTGG + Intronic
992740320 5:79767249-79767271 AAATCAGTGAATCCAGGAACTGG - Intronic
992897723 5:81260421-81260443 AAATCAGTGAATCCAGGAGCGGG + Intronic
994142563 5:96358278-96358300 AAATCAATGAATCCAGGAACTGG - Intergenic
994160604 5:96552612-96552634 AAATCAGTGAATACAGGAGCTGG + Intronic
994161171 5:96558401-96558423 AAATCAGTGAATCCAGGAGCTGG + Intronic
994280809 5:97900101-97900123 AAATCAATGAATCCAGGAACTGG - Intergenic
994663944 5:102686054-102686076 AAATCAGTGAATCCAGGAGCTGG - Intergenic
994729613 5:103476407-103476429 AAACCAGTGATTACAGGGCCTGG - Intergenic
994860498 5:105186471-105186493 AAATCAGTGAATCCAGGAGCTGG - Intergenic
995188259 5:109293721-109293743 AAATCAGTGAATCCAGGAGCTGG + Intergenic
995585986 5:113648992-113649014 AAACCAATGAATCCAGGAGCTGG + Intergenic
996079745 5:119244202-119244224 AAACCAATGATTTCAGACACTGG - Intronic
996301727 5:121995706-121995728 AAATCAGTGAATCCAGGAGCTGG + Intronic
996359847 5:122633739-122633761 AAATCAGTGAATCCAGGAGCTGG - Intergenic
996625834 5:125569389-125569411 AAATCAGTGAATCCAGGAGCTGG + Intergenic
996910573 5:128652912-128652934 AAATCAGTGAATCCAGGAGCTGG - Intronic
996964150 5:129288174-129288196 AAATCAGTGAATCCAGGAGCTGG - Intergenic
996989698 5:129613729-129613751 AAATCAGTGAATCCAGGAGCTGG + Intronic
997004321 5:129800646-129800668 AAATCAATGAATGCAGGAGCTGG - Intergenic
997220056 5:132154370-132154392 AAATCAGTGAATCCAGGAGCTGG - Intergenic
997277326 5:132606170-132606192 AAATCAATGAATCCAGGAACTGG + Intronic
997339946 5:133136063-133136085 AAATCAATGAATCCAGGAACTGG - Intergenic
997496741 5:134334252-134334274 AAATCAATGATTCCAGGAGCTGG - Intronic
997793615 5:136785750-136785772 AAATCAGTGAATCCAGGAGCTGG - Intergenic
997799959 5:136850657-136850679 AAATCAATGAATCCAGGAACTGG - Intergenic
997833748 5:137175497-137175519 AATCCAGCAATTCCAGGAACTGG - Intronic
998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998927141 5:147138910-147138932 AAACCAATGAATCCAGGAGCTGG - Intergenic
999403908 5:151289915-151289937 AAACCATTGGTTTGAGGAACAGG - Intronic
999415534 5:151392348-151392370 AAATCAATGAATCCAGGAACTGG - Intergenic
999814299 5:155160544-155160566 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1000490337 5:161904984-161905006 AAATCAATGAATCCAGGAACTGG - Intergenic
1001008962 5:168080378-168080400 AAATCAGTGAATCCAGGAGCTGG - Intronic
1001183038 5:169538768-169538790 AAAACTGAAATTGCAGGAACAGG + Intergenic
1002108089 5:176890095-176890117 AAGCCAGTGCTGGGAGGAACAGG - Intronic
1002216299 5:177636501-177636523 AAATCAATGAATGCAGGAGCTGG - Intergenic
1002755854 6:158920-158942 AAATCAATGAATGCAGGAGCTGG + Intergenic
1002808850 6:605649-605671 AAATCAGTGAATCCAGGAGCTGG - Intronic
1003782681 6:9446911-9446933 AAATCAATGAATCCAGGAACTGG + Intergenic
1004593555 6:17076953-17076975 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1005796044 6:29362992-29363014 ACATCAGTGAATGCAGGAGCTGG + Intronic
1007347564 6:41244102-41244124 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1007513887 6:42395956-42395978 TATCCACTGATTGCAGGAATTGG - Intronic
1007890406 6:45284287-45284309 AAATCAGTGAATCCAGGAGCTGG + Intronic
1008350179 6:50480687-50480709 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1008566512 6:52774177-52774199 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1008643375 6:53487949-53487971 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1008734866 6:54530665-54530687 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1009166480 6:60347692-60347714 AAATCAGTGAATCCAGGACCTGG - Intergenic
1009410424 6:63359781-63359803 AAATCAATGAATCCAGGAACTGG - Intergenic
1009503899 6:64451050-64451072 AAAGCAGTGAATCCAGGAGCTGG + Intronic
1009597176 6:65750770-65750792 AAATCAGTGACTACAGGAGCTGG + Intergenic
1009695597 6:67098590-67098612 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1010171535 6:72981605-72981627 AAATCAGTGAATCCAGGAGCTGG - Intronic
1010352054 6:74886232-74886254 GAATCAGTGAATCCAGGAACTGG - Intergenic
1010461140 6:76115724-76115746 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1010512233 6:76735014-76735036 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1010607496 6:77909251-77909273 AAATCAGTGAATCCAGGAGCTGG + Intronic
1010861619 6:80919696-80919718 AAATCAATGAATCCAGGAACTGG + Intergenic
1010961862 6:82154433-82154455 AAATCAGTGAATCCAGGAACTGG + Intergenic
1011138853 6:84130801-84130823 AAATCAGTGAATTCAGGAGCTGG - Intronic
1011308495 6:85955852-85955874 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1011318416 6:86062740-86062762 AAATCAATGAATCCAGGAACTGG - Intergenic
1011386747 6:86806520-86806542 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1012082779 6:94782385-94782407 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1012207097 6:96475027-96475049 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1012267089 6:97158263-97158285 AAATCAGTGAATCCAGGAGCTGG - Intronic
1012336300 6:98062393-98062415 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1012484466 6:99705315-99705337 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1012514407 6:100041940-100041962 AAATCAATGAATCCAGGAACTGG + Intergenic
1012687102 6:102265783-102265805 AAATCAGTGGATCCAGGAACTGG + Intergenic
1012757480 6:103250318-103250340 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1012799330 6:103805030-103805052 AAATCAATGATTCCAGGAGCTGG + Intergenic
1012845000 6:104377788-104377810 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1012871181 6:104674262-104674284 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1013383516 6:109601024-109601046 AAATCAGTGAATCCAGGAGCTGG - Intronic
1013484128 6:110579402-110579424 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1013625363 6:111931933-111931955 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1013734991 6:113215310-113215332 AAATCAATGAATGCAGGAGCTGG - Intergenic
1014012342 6:116490770-116490792 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1014038506 6:116796726-116796748 AAACCAGTGCTTGCAGACCCAGG - Intronic
1014223241 6:118820069-118820091 AAATCAGTGAATCCAGGAGCTGG - Intronic
1014461900 6:121706124-121706146 AAACCAATGAATCCAGGAGCTGG + Intergenic
1014483011 6:121961888-121961910 AAACCTGTGGTTTCATGAACAGG + Intergenic
1014565377 6:122942351-122942373 AAATCAATGAATGCAGGAGCTGG - Intergenic
1014902567 6:126985668-126985690 AAAACAGTGAATCCAGGAGCTGG + Intergenic
1015131078 6:129809970-129809992 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1015133309 6:129838626-129838648 AAATCAGTGAATCCAGGAGCTGG + Intronic
1015260982 6:131237853-131237875 AAATCAGTGAATCCAGGAGCTGG - Intronic
1015472150 6:133617803-133617825 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1016076645 6:139804357-139804379 GAACTAGTGAGTGCAGGATCTGG + Intergenic
1016412613 6:143799333-143799355 AAATCAATGAATCCAGGAACTGG - Intronic
1016655362 6:146512602-146512624 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1017302647 6:152880340-152880362 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1017322947 6:153114125-153114147 AAATCAATGAATCCAGGAACTGG + Intronic
1018040126 6:159914700-159914722 CAAGCACTGATTGCAGCAACTGG - Exonic
1019072447 6:169359507-169359529 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1019097823 6:169599708-169599730 AAATCAGTGAATCCAGGAGCCGG - Intronic
1020055269 7:5113602-5113624 AAATCTTTGATTGCAGGAAACGG + Intergenic
1020349147 7:7198982-7199004 AAATCAGTGAATCCAGGAGCTGG - Intronic
1020366943 7:7390924-7390946 AAATCAGTGAATCCAGGAGCTGG - Intronic
1020640689 7:10750268-10750290 AAATCAATGAATCCAGGAACTGG + Intergenic
1020716333 7:11678389-11678411 AAATCAGTGAATACAGGAGCTGG + Intronic
1021129806 7:16897908-16897930 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1021208162 7:17810163-17810185 AAATCAGTGAGTCCAGGAGCTGG + Intronic
1022058538 7:26767412-26767434 AAATCAATGAATTCAGGAACTGG - Intronic
1022745099 7:33163778-33163800 AAATCAGTGAATCCAGGAGCTGG - Intronic
1022848171 7:34232476-34232498 AAATCAATGAATCCAGGAACTGG - Intergenic
1023747457 7:43334561-43334583 AAACCAGAGTTTGCAGAACCTGG + Intronic
1024018001 7:45336021-45336043 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1024552361 7:50573780-50573802 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1024590267 7:50875546-50875568 AAATCAGTGAATTCAGGAGCTGG + Intergenic
1024591552 7:50890050-50890072 AAATCAATGAATGCAGGAACTGG + Intergenic
1024679635 7:51671992-51672014 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1024718095 7:52103676-52103698 AAATCAATGAATCCAGGAACTGG + Intergenic
1024817213 7:53285273-53285295 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1024998216 7:55291870-55291892 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1025788180 7:64663080-64663102 AAATCAATGAATCCAGGAACTGG + Intergenic
1027330470 7:77087457-77087479 AAATCAATGAATGCAGGAGCTGG - Intergenic
1027400735 7:77803478-77803500 CAACCAGTGATGGCAGTATCAGG - Intronic
1027731566 7:81880893-81880915 AAATCAATGAATGCAGGAGCTGG + Intergenic
1027935160 7:84592508-84592530 AAATCAGTGAACCCAGGAACTGG - Intergenic
1028476165 7:91255667-91255689 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1029017898 7:97333244-97333266 AAATCAATGATTCCAGGAGCTGG + Intergenic
1029322224 7:99773890-99773912 AAATCAGTGAATCCAGGAGCTGG + Intronic
1029785290 7:102783877-102783899 AAATCAATGAATGCAGGAGCTGG + Intronic
1030331450 7:108275681-108275703 AAATCAGTGAATCCAGGAGCTGG - Intronic
1030467542 7:109921983-109922005 AAATCAGTGAATCCAGGAACTGG - Intergenic
1030586344 7:111423845-111423867 AAATCAATGAATCCAGGAACTGG + Intronic
1030851552 7:114492359-114492381 AAATCAGTGAATCCAGGAGCTGG - Intronic
1031157365 7:118125404-118125426 AAATCAATGAATCCAGGAACTGG + Intergenic
1031394042 7:121250515-121250537 AAATCAGTGAATCCAGGAGCTGG + Intronic
1031434009 7:121710404-121710426 AAATCAATGAATCCAGGAACTGG - Intergenic
1031527342 7:122837472-122837494 AAATCAGTGAATCCAGGAACTGG + Intronic
1032505723 7:132433249-132433271 AAACCAGTGGCTGTAGGAAAAGG - Intronic
1032659442 7:133967266-133967288 AAATCAGTGAATCCAGGAGCTGG - Intronic
1032883164 7:136111802-136111824 AAACCAATGAATCCAGGAGCTGG - Intergenic
1033054637 7:138039250-138039272 AAATCAGTGAATCCAGGAGCTGG + Intronic
1033525919 7:142213366-142213388 AAATCAGTGACTCCAGGAGCTGG + Intronic
1033787649 7:144753072-144753094 AAATCAGTGAATACAGGAGCTGG - Intronic
1033887812 7:145969743-145969765 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1033960640 7:146908846-146908868 AAATCAATGAATCCAGGAACTGG + Intronic
1035311971 7:157975159-157975181 ACAGCAGTGTTGGCAGGAACTGG - Intronic
1035311980 7:157975197-157975219 ACAGCAGTGTTGGCAGGAACTGG - Intronic
1035825561 8:2640969-2640991 AAACCAGTGTCTGCAGGTAGAGG + Intergenic
1036160625 8:6384838-6384860 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1036715434 8:11118756-11118778 AAATCAGTGAATCCAGGAGCTGG - Intronic
1036732888 8:11281855-11281877 ATAACAGTGAGAGCAGGAACGGG - Intergenic
1036778618 8:11630533-11630555 AAGCCAATTAATGCAGGAACCGG - Intergenic
1036890591 8:12593982-12594004 AAACCACAGTTTGCAGGACCAGG + Intergenic
1037208718 8:16358292-16358314 TAACCAGAGATTGCTGCAACAGG - Intronic
1037213240 8:16417959-16417981 AAATCAGTGAATCCAGGAGCTGG + Intronic
1037544833 8:19909158-19909180 AAATCAATGAATCCAGGAACTGG - Intronic
1038652326 8:29416758-29416780 ACATCAGTGAGTGTAGGAACTGG + Intergenic
1039371275 8:36986449-36986471 AAATCTGTCATTGCAGGAATGGG + Intergenic
1040429067 8:47320141-47320163 AAATCAGTGAATCCAGGAGCTGG + Intronic
1040437187 8:47402396-47402418 AAATCAGTGAATCCAGGAGCTGG + Intronic
1040544577 8:48388238-48388260 AAATCAATGAATCCAGGAACTGG - Intergenic
1040608274 8:48956847-48956869 AAATCAGTGATTCCAGGAGCTGG - Intergenic
1040863900 8:52028815-52028837 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1041027093 8:53698104-53698126 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1041221206 8:55653110-55653132 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1041294003 8:56335709-56335731 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1041443413 8:57924107-57924129 AAAACAGTGAATGGAGGTACTGG - Intergenic
1041478302 8:58289906-58289928 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1041815608 8:61967265-61967287 AAATCAATGATTCCAGGAGCTGG - Intergenic
1042115748 8:65429532-65429554 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1042205103 8:66320981-66321003 AAATCAATGAATCCAGGAACTGG + Intergenic
1042687169 8:71454951-71454973 AAATCAGTGAATCCAGGAGCTGG + Intronic
1042952761 8:74218704-74218726 AAACCAGTGATGGGTGGAAGTGG - Intergenic
1043339752 8:79223272-79223294 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1043716759 8:83496805-83496827 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1043746447 8:83878568-83878590 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1043748055 8:83900951-83900973 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1043748618 8:83907424-83907446 AAATCATTGATTCCAGGAGCTGG - Intergenic
1043929785 8:86077478-86077500 AAATCAATGAATCCAGGAACTGG + Intronic
1044135206 8:88577252-88577274 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1044211389 8:89555288-89555310 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1044272855 8:90267288-90267310 AAATCAATGATTCCAGGAGCTGG + Intergenic
1044283059 8:90378618-90378640 AAATCAATGATTCCAGGAGCTGG + Intergenic
1044808783 8:96036061-96036083 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1045187763 8:99856334-99856356 AAAGCAGTGATTGAAGGAGTAGG + Intronic
1045241377 8:100404988-100405010 AAATCAGTGAATCCAGGAGCTGG + Intronic
1045604220 8:103753876-103753898 AAATCAGTGAATCCAGGAGCTGG - Intronic
1045607396 8:103792615-103792637 AAATCAGTGAATCCAGGAGCTGG + Intronic
1045968026 8:108048616-108048638 AAATCAGTGAATCCAGGAGCGGG - Intronic
1045969342 8:108062230-108062252 AAATCAATGAATCCAGGAACTGG + Intronic
1046218626 8:111182632-111182654 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1046285217 8:112085010-112085032 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1046342178 8:112873856-112873878 AAATCAGTGAATCCAGGAGCTGG - Intronic
1046709144 8:117489854-117489876 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1046759045 8:118001724-118001746 AAACCAGTGATTCCAAGAACAGG + Intronic
1046874328 8:119236986-119237008 AAATCAGTGAATCCAGGAGCTGG + Intronic
1047911627 8:129536084-129536106 AAACCAGCCACTGTAGGAACAGG + Intergenic
1048149521 8:131880647-131880669 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1048156778 8:131963264-131963286 AAATCAGTGAATCCAGGAGCTGG + Intronic
1048223706 8:132565612-132565634 TAAGCAGTGATTCCAGAAACTGG - Intergenic
1048979434 8:139695205-139695227 AAACAAGTTAATGCAGGAAGGGG + Intronic
1049022752 8:139968990-139969012 AGTCCAGAGATAGCAGGAACAGG + Intronic
1049485122 8:142853127-142853149 AAATCAGTGAATCCAGGAGCTGG + Intronic
1050011848 9:1193068-1193090 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1050442548 9:5680796-5680818 AAATCAATGACTGCAGGAGCTGG - Intronic
1050446200 9:5725505-5725527 AAATCAATGAATGCAGGAGCTGG - Intronic
1050597571 9:7219186-7219208 AAATCAGTGAATCCAGGAACTGG + Intergenic
1050603874 9:7280633-7280655 AAATCAATGAATCCAGGAACTGG - Intergenic
1050787974 9:9429096-9429118 AAATCAATGAATCCAGGAACTGG + Intronic
1050956527 9:11668209-11668231 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1050963646 9:11769028-11769050 AAATCAGTGATTCCAGGAGCTGG + Intergenic
1051060063 9:13035425-13035447 AAACCAGTGAGGGCAGGGACTGG - Intergenic
1051447108 9:17152108-17152130 AACTCAGTGAATGCAGGAGCTGG - Intronic
1051695517 9:19764260-19764282 AAATCAGTGAATCCAGGAGCTGG - Intronic
1051913395 9:22180173-22180195 AAATCAATGAATGCAGGAGCTGG + Intergenic
1052386984 9:27834365-27834387 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1052499699 9:29273385-29273407 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1052717237 9:32131702-32131724 AAATCAGTGAATCCAGGAACTGG + Intergenic
1052724625 9:32214777-32214799 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1052753039 9:32511776-32511798 AAATCAGTGAATCCAGGAGCTGG + Intronic
1052994733 9:34545802-34545824 AAACCAGTGCCTACAGGAATGGG - Intergenic
1053272177 9:36757891-36757913 AAACCAGAGGTTGAAGGGACAGG - Intergenic
1053445454 9:38149855-38149877 GAGCCAGTGATTGCAGAGACAGG - Intergenic
1054884632 9:70182798-70182820 AAATCAGTGAATCCAGGAGCTGG - Intronic
1054886987 9:70209581-70209603 AAATCAGTGAATCCAGGAGCTGG - Intronic
1054894277 9:70290358-70290380 AAACCAGATATTGCAGAAAGGGG + Intronic
1055276274 9:74620491-74620513 AAATCAGTGAATCCAGGAGCTGG - Intronic
1055374039 9:75629694-75629716 AAATCAATGAATGCAGGAGCTGG + Intergenic
1055714317 9:79100798-79100820 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1055895124 9:81165624-81165646 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1056302339 9:85255095-85255117 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1056426074 9:86478125-86478147 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1057324417 9:94048152-94048174 AAATCAATGAATGCAGGAGCTGG - Intronic
1058034282 9:100234311-100234333 AAATCAGTGAATCCAGGAGCTGG - Intronic
1058075553 9:100646942-100646964 AAAGCAGTGAATCCAGGAGCTGG + Intergenic
1058096719 9:100869996-100870018 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1058192711 9:101938356-101938378 AAATCAATGAATGCAGGAGCTGG - Intergenic
1058207760 9:102129767-102129789 AAATCAATGAATGCAGGAGCTGG - Intergenic
1058306881 9:103454532-103454554 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1058492645 9:105518855-105518877 AAATCAGTGAATCCAGGAGCTGG + Intronic
1059620688 9:116002367-116002389 ATACCAGTGACTGCGGGAATGGG - Intergenic
1060131213 9:121101595-121101617 AAATCAGTGAATCCAGGAGCTGG + Intronic
1060230496 9:121822001-121822023 AAACCAAATATTGCAGCAACAGG + Exonic
1061423662 9:130485887-130485909 AGACCAGTGTGTGCAGAAACAGG - Intronic
1185450624 X:279231-279253 TAACCAGTTAAGGCAGGAACTGG + Intronic
1186599411 X:11020918-11020940 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1186708396 X:12167000-12167022 AAACCAATGAATCCAGGAGCTGG - Intronic
1186772964 X:12835978-12836000 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1186892935 X:13977872-13977894 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1186913076 X:14190571-14190593 AAACCAATGAGTCCAGGAGCTGG - Intergenic
1186929422 X:14372275-14372297 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1186950969 X:14624297-14624319 AAACCAGTGAATCCAGGAGCTGG - Intronic
1186982465 X:14971941-14971963 AAATCAGTGAATGCAGGAGCTGG - Intergenic
1187635315 X:21221567-21221589 AAATCAATGAATCCAGGAACTGG - Intergenic
1187705124 X:22002386-22002408 AAACCAATGAATCCAGGAGCTGG - Intergenic
1187828871 X:23360596-23360618 AAATCAGTGAATCCAGGAGCTGG - Intronic
1187848227 X:23563601-23563623 AAACCAATGAATCCAGGAGCTGG - Intergenic
1188527209 X:31099515-31099537 CAACCATTGAATGCAGGAAAGGG + Intronic
1189978128 X:46483001-46483023 AAATCAGTGAATTCAGGAGCTGG - Intronic
1190098827 X:47504594-47504616 AAACCACTGTTTGCACAAACAGG - Intergenic
1190807362 X:53851391-53851413 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1190970786 X:55345275-55345297 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1191005384 X:55705625-55705647 AAATCAATGACTCCAGGAACTGG + Intergenic
1191015809 X:55809000-55809022 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1191138076 X:57087964-57087986 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1191170450 X:57441550-57441572 AAATCAGTGAATCCAGGAGCTGG - Intronic
1191173652 X:57477147-57477169 AAATCAATGACTCCAGGAACAGG - Intronic
1191186354 X:57616910-57616932 AAATCAGTGAATCCAGGAGCCGG + Intergenic
1191196402 X:57728326-57728348 AAATCAATGAATCCAGGAACTGG - Intergenic
1191218084 X:57953847-57953869 AAATCAATGAATCCAGGAACTGG + Intergenic
1191602149 X:63020197-63020219 AAATCAATGATTCCAGGAGCTGG + Intergenic
1191789093 X:64949795-64949817 AAATCAGTGAATCCAGGAGCTGG - Intronic
1191811302 X:65191748-65191770 AAACCAATGAATCCAGGAGCTGG - Intergenic
1191835627 X:65458903-65458925 AAACCAATGAATCCAGGAGCTGG + Intronic
1191956487 X:66647776-66647798 AAACCAATGAATCCAGGAGCTGG - Intergenic
1192007939 X:67237272-67237294 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1192044929 X:67662139-67662161 AAATCAATGAATCCAGGAACTGG - Intronic
1192068237 X:67909700-67909722 AAAGCAATGATGGCAGGACCTGG - Intergenic
1192523234 X:71819834-71819856 AAATCAATGAATCCAGGAACTGG + Intergenic
1192668112 X:73109201-73109223 AAATCAGTGAATACAGGAGCTGG + Intergenic
1192691441 X:73369135-73369157 AAATCAGTGAATCCAGGAATTGG - Intergenic
1192712349 X:73604453-73604475 AAATCAATGAATCCAGGAACTGG - Intronic
1192741359 X:73896002-73896024 AAATCAATGATTCCAGGAGCTGG + Intergenic
1192835205 X:74791921-74791943 AAATCAGTGAATCCAGGAGCTGG - Intronic
1192900688 X:75492976-75492998 AAATCAGTGAATCCAGGAACTGG + Intronic
1192957793 X:76092095-76092117 AAATCAATGAATCCAGGAACTGG - Intergenic
1193067027 X:77271225-77271247 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1193516746 X:82475024-82475046 AAATCAATGAATGCAGGAGCTGG - Intergenic
1193542738 X:82791508-82791530 AAATCAATGAATGCAGGAGCTGG + Intergenic
1193589028 X:83364643-83364665 AAATCAATGAATGCAGGAGCTGG - Intergenic
1193623010 X:83779944-83779966 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1193740392 X:85209782-85209804 ACACCAGTGAATCCAGGAGCTGG - Intergenic
1194170207 X:90571668-90571690 AAACCCATGAGTTCAGGAACTGG + Intergenic
1194183377 X:90740440-90740462 AAATCAATGAATGCAGGAGCTGG + Intergenic
1194185338 X:90768221-90768243 AAATCAATGAATCCAGGAACTGG + Intergenic
1194230851 X:91321768-91321790 AAATCAATGAATGCAGGAGCTGG + Intergenic
1194314988 X:92366438-92366460 AAATCAGTGAATCCAGGAACCGG - Intronic
1194459502 X:94149177-94149199 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1194460485 X:94161215-94161237 AAGCCAATGAAAGCAGGAACGGG - Intergenic
1194648720 X:96489597-96489619 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1194657180 X:96587131-96587153 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1194772141 X:97918729-97918751 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1194789480 X:98128608-98128630 AAACCAATGAATCCAGGAGCTGG - Intergenic
1194837180 X:98696048-98696070 AAATCAATGATTCCAGGATCTGG - Intergenic
1194852257 X:98883976-98883998 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1195198539 X:102523132-102523154 AAATCAATGATTCCAGGAGCTGG + Intergenic
1195293965 X:103457496-103457518 AAATCAATGAATGCAGGAGCTGG - Intergenic
1195340303 X:103900066-103900088 AAATCAGTGAATCCAGGAACTGG - Intergenic
1195579995 X:106490762-106490784 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1195639623 X:107158823-107158845 AAATCAGTGAATCCAGGAGCTGG + Intronic
1195832006 X:109069584-109069606 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1195981147 X:110579892-110579914 AAACCAGAGATTTCAACAACAGG + Intergenic
1196069790 X:111508191-111508213 AAATCAGGGTTTGCAGGAAGAGG - Intergenic
1196229910 X:113209469-113209491 AAATCAGTGAATCCAGGAGCGGG - Intergenic
1196232815 X:113244047-113244069 AAACCAATGTATGCAGGAATAGG + Intergenic
1196312665 X:114186665-114186687 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1196561516 X:117154863-117154885 AAATCAGTGAGTCCAGGAGCTGG + Intergenic
1196570036 X:117255225-117255247 AAATCAGTGAATCCAGGAACTGG - Intergenic
1196600386 X:117595307-117595329 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1196658522 X:118244908-118244930 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1197824089 X:130570619-130570641 AAATCAATGAATCCAGGAACTGG - Intergenic
1197915272 X:131527659-131527681 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1198489588 X:137125604-137125626 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1198490243 X:137132646-137132668 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1198556155 X:137795491-137795513 AAATCAGTGACTCCAGGAGCTGG + Intergenic
1198660094 X:138958969-138958991 AAATCAGTGAATCCAGGAGCTGG - Intronic
1198856188 X:141019552-141019574 AAACCAATGAATCCAGGAGCTGG + Intergenic
1198875945 X:141226558-141226580 AAACCAATGAATCCAGGAGCTGG - Intergenic
1198906504 X:141567815-141567837 AAACCAATGAATCCAGGAGCTGG - Intergenic
1198916809 X:141681488-141681510 AAACCAATGAATCCAGGAGCTGG - Intronic
1198919106 X:141705638-141705660 AAACCAATGAATCCAGGAGCTGG - Intergenic
1198923762 X:141763248-141763270 AGACCAGTGATGTCAGGAAAAGG - Intergenic
1198967563 X:142244126-142244148 AAACCTGAGTCTGCAGGAACCGG - Intergenic
1199052031 X:143246935-143246957 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1199292629 X:146122062-146122084 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1199302627 X:146230890-146230912 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1199436904 X:147822593-147822615 AAATCAGTGAATCCAGGAGCAGG + Intergenic
1199636836 X:149821774-149821796 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1199841906 X:151657807-151657829 AAATCAGTGAATCCAGGAGCTGG - Intronic
1199937089 X:152585079-152585101 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1199968240 X:152838244-152838266 AAATCAGTGAATCCAGGAGCTGG - Intronic
1200288255 X:154845740-154845762 AAATCAATGAATCCAGGAACTGG - Intronic
1200378745 X:155811991-155812013 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1200405326 Y:2804717-2804739 AAATCAATGAATTCAGGAACTGG - Intergenic
1200516452 Y:4149434-4149456 AAACCCATGAGTCCAGGAACTGG + Intergenic
1200529990 Y:4322386-4322408 AAATCAATGAATGCAGGAGCTGG + Intergenic
1200531962 Y:4350307-4350329 AAATCAATGAATCCAGGAACTGG + Intergenic
1200623038 Y:5477966-5477988 AAATCAGTGAATCCAGGAACCGG - Intronic
1200947536 Y:8861260-8861282 AGACCAGTGATCTCAGGAAAAGG - Intergenic
1201492004 Y:14551974-14551996 AAATCAGTGAATCCAGGAGCTGG + Intronic
1201597211 Y:15683882-15683904 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1201732147 Y:17215928-17215950 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1201783596 Y:17748952-17748974 AAATCAATGAATCCAGGAACTGG + Intergenic
1201817957 Y:18157035-18157057 AAATCAATGAATCCAGGAACTGG - Intergenic
1201952733 Y:19583411-19583433 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1201969946 Y:19780998-19781020 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1202103784 Y:21339813-21339835 AAACTAGGAATTTCAGGAACTGG + Intergenic
1202174925 Y:22089217-22089239 AAATCAATGAATCCAGGAACTGG + Intronic
1202216437 Y:22497165-22497187 AAATCAATGAATCCAGGAACTGG - Intronic
1202249007 Y:22850190-22850212 AAACCAATGATTCCAGGAGCTGG - Intergenic
1202253705 Y:22898932-22898954 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1202326750 Y:23698904-23698926 AAATCAATGAATCCAGGAACTGG + Intergenic
1202401995 Y:24483938-24483960 AAACCAATGATTCCAGGAGCTGG - Intergenic
1202406695 Y:24532681-24532703 AAATCAGTGAATCCAGGAGCTGG - Intergenic
1202464086 Y:25137400-25137422 AAATCAGTGAATCCAGGAGCTGG + Intergenic
1202468786 Y:25186145-25186167 AAACCAATGATTCCAGGAGCTGG + Intergenic
1202544019 Y:25971149-25971171 AAATCAATGAATCCAGGAACTGG - Intergenic