ID: 906176625

View in Genome Browser
Species Human (GRCh38)
Location 1:43779331-43779353
Sequence ACAGCCTATAAGGATAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906176625 Original CRISPR ACAGCCTATAAGGATAGGAC TGG (reversed) Intronic
902070582 1:13731984-13732006 ACATCCTAGCAGGATAGGACTGG + Intronic
906176625 1:43779331-43779353 ACAGCCTATAAGGATAGGACTGG - Intronic
906288776 1:44605787-44605809 ACAACCAAAAAGGATAGGACAGG - Intronic
908100836 1:60789336-60789358 ATAGCCAATAAGTATAGGCCAGG - Intergenic
911295604 1:96111124-96111146 ACATCCTAAAATGTTAGGACTGG - Intergenic
912471608 1:109910809-109910831 ACAGCCTTTTAAGAGAGGACTGG - Exonic
916166713 1:161971954-161971976 ACAGTCCAGAAGGAGAGGACAGG - Intergenic
916606789 1:166350898-166350920 CCAGCCTAAAAGGAAAGAACAGG - Intergenic
921932665 1:220767863-220767885 ACAGCTGGAAAGGATAGGACTGG - Intronic
1065769525 10:29064604-29064626 ACAGCCTAACAGGATAAGAAAGG + Intergenic
1084583432 11:70039045-70039067 AAAGCCATTAAGGATAGGACAGG + Intergenic
1089177715 11:116560465-116560487 AAAGCCTAAAAGGATGGGGCTGG + Intergenic
1089863721 11:121613441-121613463 ACAGCCTAGAAGGAGGAGACAGG - Intronic
1095154513 12:38835562-38835584 ACAGGCAATAAATATAGGACAGG - Intronic
1096192534 12:49629810-49629832 ACAGCCATTAGGGGTAGGACAGG + Intronic
1096728568 12:53586143-53586165 AAAGCCTAGAAGGAAAGAACAGG + Intronic
1097335990 12:58383908-58383930 ACAGCCACAAAGGATAGGAAAGG - Intergenic
1099605817 12:84800082-84800104 ACAGCCTAAACTGCTAGGACTGG - Intergenic
1099893399 12:88616315-88616337 ACAGTCTAGAATGATAGGAAGGG + Intergenic
1102947629 12:117003742-117003764 TCAGCCTTTGAGGATATGACTGG + Intronic
1108635187 13:52326926-52326948 ACAGACTGAAAGGAAAGGACTGG + Intergenic
1108652621 13:52496303-52496325 ACAGACTGAAAGGAAAGGACTGG - Intergenic
1117746329 14:58873248-58873270 ACAGCCAATAAGGTTTGTACAGG - Intergenic
1118082333 14:62374968-62374990 ACAGCCTAAAAGGAAAAGAGTGG - Intergenic
1118520197 14:66574893-66574915 ACAGCCTGAAAACATAGGACAGG - Intronic
1124261857 15:28199916-28199938 ACAGCATGAAAGGAGAGGACGGG + Intronic
1124659976 15:31539282-31539304 ACAGTCTGTAGGGATAGGAAGGG - Intronic
1125956333 15:43793253-43793275 ACAGCCTTACAGGAAAGGACGGG + Intronic
1127062579 15:55202182-55202204 ACAGTCTTAAAGGATAGGAGAGG + Intergenic
1129887217 15:79047047-79047069 ACAGCCTGGAAGGACAGGAGTGG - Intronic
1132090489 15:98944473-98944495 ACAGGCTTTGAGGATAGCACAGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1144214084 17:13039337-13039359 TCAGTCTATAAGGTTAGGATGGG - Intergenic
1151666082 17:75545796-75545818 ACAGCCCAGAAGGAAGGGACTGG + Intronic
1153572020 18:6483082-6483104 ACAGCCAGTAAGTCTAGGACGGG - Intergenic
925350577 2:3198303-3198325 ACAGCCCATTTGCATAGGACTGG - Intronic
926371126 2:12179801-12179823 AAAGCCTCTGAGGTTAGGACTGG - Intergenic
927151063 2:20196493-20196515 ACAGCCTTGAAGGTAAGGACGGG + Intergenic
927275120 2:21255998-21256020 ACAGCCTGTAAGGATAGTGGAGG + Intergenic
927349961 2:22098748-22098770 ACACCTTATAAGGAAAGGATAGG + Intergenic
930879425 2:56254726-56254748 ACAGCATATAAGTAGGGGACTGG + Intronic
939588657 2:144035844-144035866 AAAGCCTAAAAGGATAGGAAAGG - Intronic
940497305 2:154448474-154448496 ACAGCCAGTAAGTAAAGGACAGG + Intronic
942727050 2:179021351-179021373 GCAGCCTATACAAATAGGACAGG - Intronic
944915498 2:204356804-204356826 AGAGCCTATAAGTATAGGAGTGG - Intergenic
945040954 2:205743494-205743516 ACAGCCTAAACGGCAAGGACTGG + Exonic
946201274 2:218072225-218072247 ACAGCCAGTAAGGACAGGGCTGG + Intronic
1169812465 20:9622065-9622087 CCAGCCTGAAAGGAAAGGACTGG + Intronic
1175034439 20:55986871-55986893 ACAGCCAACAAGATTAGGACAGG + Intergenic
1181148739 22:20867410-20867432 ACAGTCTGTAAGGACAGGCCAGG - Intronic
1181592087 22:23891778-23891800 ATAGCCTCGAAGGACAGGACAGG + Intronic
949912041 3:8919203-8919225 ACAGCCTACAAAAATAGGCCAGG + Intronic
955785964 3:62539259-62539281 ACAGCCTATAACGGCAGGAAGGG - Intronic
961889958 3:130122457-130122479 CCAGCTAATAAGGATAGGTCTGG + Intergenic
962726773 3:138236194-138236216 AGAGCTCATAAGGATAGGAATGG + Intronic
966070071 3:175865137-175865159 ACAGCCAATAAGGAAAGGCTTGG + Intergenic
969813480 4:9668415-9668437 CCAGCTAATAAGGATAGGTCTGG - Intergenic
970276393 4:14405557-14405579 ACAGCCTCTTAGGAAGGGACTGG + Intergenic
975703913 4:77092957-77092979 ACACCCTATTAGGAGAGAACAGG + Intergenic
982476664 4:155860644-155860666 AGAGGCTATAATGATAGAACAGG - Intronic
986632192 5:9784496-9784518 ACAGCCTGGGAGGATAGCACAGG + Intergenic
990053937 5:51546105-51546127 ACAGCCTGTAGGGATAGCATAGG - Intergenic
993543321 5:89179864-89179886 AAATCCCATAAGGATAGTACTGG - Intergenic
996665870 5:126059420-126059442 ACATCTTATAAGCACAGGACAGG + Intergenic
997194988 5:131973396-131973418 ACAGACTAGAAAGACAGGACAGG + Exonic
1001007715 5:168068627-168068649 ACAGTCAAGAAGAATAGGACTGG + Intronic
1001888162 5:175314816-175314838 AGAGCCTATAGGGATATGTCAGG - Intergenic
1004577937 6:16916737-16916759 AAATGCTATAAGGATAGGAATGG - Intergenic
1004735726 6:18404509-18404531 AAAGCCTATAATGATTTGACTGG + Intronic
1007969936 6:46041459-46041481 ACAGACTCTAAGGAAAGGAGTGG - Intronic
1016933204 6:149428988-149429010 ACAGCCTACAAGCATGGGATGGG - Intergenic
1020028054 7:4913203-4913225 ACTGGGTAGAAGGATAGGACGGG + Intronic
1027368867 7:77486862-77486884 ACAGTTTATAAGCATATGACAGG + Intergenic
1030145720 7:106352611-106352633 ATAGGTTATAAGCATAGGACTGG + Intergenic
1035254395 7:157617033-157617055 ACAGCCTATGAGGATGGCACTGG + Exonic
1037990429 8:23317925-23317947 ACAGACCATCAGGATAGGAAGGG + Intronic
1041237454 8:55818815-55818837 ACAGGCTATCAGCACAGGACTGG - Intronic
1044979888 8:97706162-97706184 AAAGCTCATAAGGATAGGAGAGG + Intronic
1045443059 8:102234276-102234298 ACAGGTTATCAGGATAGAACAGG - Intronic
1046532613 8:115467600-115467622 ATAGGCTAGAAGGATAGCACTGG + Intronic
1051552943 9:18350421-18350443 ACAGGCTAGAAGGGAAGGACCGG - Intergenic
1056918857 9:90768478-90768500 GCAGCCAATAAGGAAAGGAGGGG + Intergenic
1061321545 9:129833851-129833873 AAAGCCTATAAGCATAAGACAGG + Intronic
1187869032 X:23749217-23749239 ACAGCCTCTAAGCAAAGGCCAGG - Intronic
1193848367 X:86503358-86503380 CAGGCCTATAAGGATAGGATGGG - Intronic
1194556047 X:95361481-95361503 ACAGCATATGAGGATACAACAGG + Intergenic
1196611714 X:117722479-117722501 ACAGCCAACAAGGATTAGACAGG - Intergenic