ID: 906177067

View in Genome Browser
Species Human (GRCh38)
Location 1:43783743-43783765
Sequence CTGCCCTCTAAGACTGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906177067 Original CRISPR CTGCCCTCTAAGACTGCGGG GGG (reversed) Intronic
900568387 1:3346562-3346584 CTGCCCCCAAAGACTGGGGACGG - Intronic
902533145 1:17103261-17103283 CTGCCCTCTCAGCCAGCAGGAGG - Intronic
906177067 1:43783743-43783765 CTGCCCTCTAAGACTGCGGGGGG - Intronic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
912795065 1:112688390-112688412 CTGCACCCTATGACTTCGGGTGG + Intronic
915443297 1:155960109-155960131 CAGCACTCCAAGACTGAGGGAGG + Intronic
918815401 1:189174062-189174084 CTGCCCACCTAGACTGAGGGTGG - Intergenic
919396667 1:197058389-197058411 CTGGCCTCTAGGACTGTAGGAGG - Intronic
919433214 1:197523210-197523232 CTGCCTCCCAAGACTGCTGGGGG + Intronic
920238961 1:204529589-204529611 CTGCCCTCCACTACTGGGGGGGG + Intronic
920415583 1:205797248-205797270 CTGCCCTCTAAGTTGGCCGGAGG + Intronic
922800958 1:228364584-228364606 CAGCCCTCGATCACTGCGGGGGG - Intronic
922894284 1:229088418-229088440 CTTCCCTCTGATACTGTGGGAGG + Intergenic
924243520 1:242061171-242061193 CAGCCCTCCAAGACTGGGGCAGG - Intergenic
924775333 1:247111853-247111875 CTGCTCCCGAAGACTGCGGTCGG + Exonic
1065173778 10:23057330-23057352 GTGCCCTCTAAGATTGAGAGTGG + Intergenic
1067808131 10:49407338-49407360 CAGCCCTCTGAGACCGTGGGAGG - Intergenic
1069168868 10:65200021-65200043 GTGCCCACTAAGATTGAGGGTGG - Intergenic
1075141842 10:119844699-119844721 CTGCCCACCCAGACTGAGGGTGG - Intronic
1076424123 10:130355282-130355304 CAGCCCTCTAGGCCTGCGGGTGG + Intergenic
1076789920 10:132771508-132771530 CTCCCCTCTCAGACTGCCGCAGG + Intronic
1077529944 11:3090379-3090401 CTGCCCTCTCAGAGTCTGGGAGG - Intronic
1080386524 11:31814046-31814068 CTGCCCTCCAAGACGCGGGGGGG + Intronic
1083831077 11:65233979-65234001 CTGCCTGCTCAGACTTCGGGGGG - Intergenic
1089613532 11:119682649-119682671 CTGCCCTATAAAACTGCGTAAGG + Intronic
1092369790 12:7907302-7907324 CTGCCCTCTATCGGTGCGGGGGG + Intergenic
1103885807 12:124199214-124199236 CTTGCCTCTCAGACTCCGGGAGG + Intronic
1104539749 12:129652923-129652945 CTGCCTTCTGAGACAGTGGGTGG - Intronic
1109045628 13:57407451-57407473 GTGCCCACCCAGACTGCGGGTGG - Intergenic
1112563525 13:100533668-100533690 CTGCCCTCTAAGACCTTGGAAGG - Exonic
1112894440 13:104281895-104281917 CTGCCCACTTACACTGAGGGTGG - Intergenic
1113901544 13:113800891-113800913 GTGACCTCTATGCCTGCGGGAGG + Exonic
1114639973 14:24213173-24213195 CTTCCCTCTGAGAGTGGGGGAGG + Intronic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1120865648 14:89293377-89293399 CTGCCCTCCAGGACTGTGAGAGG - Intronic
1121450503 14:94004241-94004263 CTGGCCTCCGGGACTGCGGGAGG + Intergenic
1122377744 14:101277576-101277598 TTGCCCTTTAAAACTGCAGGGGG + Intergenic
1124383535 15:29187601-29187623 CTGCCCTCCAAGTCTACTGGGGG - Intronic
1130733759 15:86527064-86527086 GTGCCTTCTAAGATTGCAGGAGG - Intronic
1130801449 15:87267681-87267703 CTGCCCTTTAAAACTCCTGGGGG - Intergenic
1132485586 16:188978-189000 CTGCCTCCTGAGGCTGCGGGGGG - Exonic
1133052409 16:3124614-3124636 ATGCTCTCTAGGACTGCAGGAGG - Intergenic
1135214500 16:20553425-20553447 CTGCCCTCTTGGAGTGTGGGCGG + Intronic
1137023284 16:35451289-35451311 CTGCCCAGTAAGAGTGCAGGGGG - Intergenic
1144823534 17:18092006-18092028 CTGCCCTCTGAGACTGGGCAGGG + Intronic
1145112306 17:20174610-20174632 CTCCCCTCCAAGACTGATGGGGG - Intronic
1147144444 17:38477159-38477181 CAACCCTCTAAGAGTGCGGACGG + Intronic
1147311653 17:39599271-39599293 CTGCCCTCCAAGACTGAGGCTGG + Intergenic
1151540832 17:74763838-74763860 CTGCCCTGAAAGTCTGCTGGTGG - Intronic
1152749908 17:82057834-82057856 CTGCCCTCTCAGACCCAGGGAGG - Intronic
1153382650 18:4455545-4455567 CTGCCCGCTCAGTCTCCGGGTGG + Intergenic
1155064177 18:22254556-22254578 CTGCCCCATAAGACTCCAGGGGG - Intergenic
1155105034 18:22655607-22655629 ATACCCTCTAAGAGTGGGGGAGG + Intergenic
1155231625 18:23780006-23780028 CTGCCCGCTAAGACTCAGAGAGG + Intronic
1159722686 18:71912788-71912810 CTGCCCTCTAAGAATGTGTAAGG + Intergenic
1161075313 19:2282408-2282430 CTGGCCTCTGAGGCTGTGGGGGG - Intronic
1165110566 19:33499806-33499828 CAGCCCTCTTTGACTGCAGGTGG - Intronic
1168250376 19:55138105-55138127 CTCCCCTGTAGGACTGAGGGAGG + Intronic
925005638 2:441111-441133 CTGCCATCTGAAACTGCCGGTGG - Intergenic
925263682 2:2549400-2549422 GTGCCCACCAAGACTGAGGGTGG + Intergenic
926791640 2:16577879-16577901 TGGCCATCTATGACTGCGGGAGG + Intronic
927197541 2:20558779-20558801 CAGCCCTCCAAGCCTGTGGGAGG + Intergenic
927507457 2:23623646-23623668 CAGCCTTCTTGGACTGCGGGGGG - Intronic
930232779 2:48859551-48859573 CTGCCCTCTATGAATTGGGGTGG - Intergenic
935192742 2:100792046-100792068 CTGCCCTGACAGCCTGCGGGAGG + Intergenic
935882927 2:107584437-107584459 CTGCCCACCCAGACTGAGGGTGG + Intergenic
943636250 2:190309977-190309999 GTGCCCACTCAGACTGAGGGTGG - Intronic
1173020012 20:39259292-39259314 CTGCTCTCTCAGACAGCGGAGGG - Intergenic
1174703743 20:52635131-52635153 CTGCCTGCTAGGACTCCGGGTGG - Intergenic
1177325845 21:19587689-19587711 GTGCCCACTCAGACTGAGGGTGG - Intergenic
1183442699 22:37832189-37832211 CTGCCCTCTAGGACAGCGCTAGG - Intronic
1184533227 22:45070238-45070260 CTGCCCTCTAAGGTTCCGGGTGG + Intergenic
955978380 3:64499519-64499541 GTGCCCACTCAGACTGAGGGAGG + Intergenic
956568700 3:70669907-70669929 GTGCCCGCTTAGACTGAGGGTGG + Intergenic
961045341 3:123704119-123704141 CTGACCCCTTAGACTGCTGGGGG - Intronic
968599323 4:1501696-1501718 CTCCCCTCTAAGAATGTGGCAGG - Intergenic
968975812 4:3821571-3821593 CTGCCCTCAGAGGCTGCGGACGG + Intergenic
969264949 4:6058144-6058166 CTGCCCTCCATGCCTGCTGGAGG - Intronic
969520138 4:7673200-7673222 GTGCCCTCTACTACTGCTGGTGG + Intronic
974478751 4:62418348-62418370 GTGCCCACTCAGACTGAGGGTGG + Intergenic
979898987 4:126193717-126193739 ATGCCCACCAAGACTGAGGGTGG + Intergenic
986728673 5:10618755-10618777 CTGCTCCCGAAGACTGGGGGTGG + Intronic
1001038723 5:168316576-168316598 CTGCCCTCTACGTCTGCAGTAGG + Intronic
1001673262 5:173491783-173491805 CTGACCTCTAAAACTGTGAGAGG + Intergenic
1003217260 6:4125651-4125673 CTAATCTCTAAGACTGCGGCTGG - Intronic
1005422185 6:25663302-25663324 CTGCCCTTTGAGACTAAGGGTGG - Intronic
1007276276 6:40676456-40676478 CTCCCCTCTCAGACTGGGTGGGG + Intergenic
1007322115 6:41034951-41034973 CTGCCCTAGAAGGCTGCTGGGGG - Exonic
1007376054 6:41457303-41457325 CTTCCCTAGAAGACAGCGGGCGG - Intergenic
1007431979 6:41781664-41781686 CTGGCCTCTAAGACTGGGCCAGG - Intronic
1012948438 6:105492445-105492467 CTGCCCTCTGAGACTGCCAAAGG + Intergenic
1021958530 7:25851181-25851203 CTGCCCTCGGAGACAGCGGCAGG + Intergenic
1026447626 7:70499393-70499415 CTGCACTCTTAGACTGGGTGGGG - Intronic
1028171336 7:87600486-87600508 CTGCTCTCTGAGCCCGCGGGCGG - Intronic
1030579333 7:111333643-111333665 GTGCCCACTAAGATTGAGGGTGG - Intronic
1037356366 8:18023956-18023978 CTGCCCTCTCAGCTTGAGGGTGG - Intronic
1045443831 8:102239721-102239743 CTGTCCTGAGAGACTGCGGGAGG + Intergenic
1047163569 8:122410206-122410228 CTGCAATCTCAGACTGCAGGAGG - Intergenic
1048154872 8:131936964-131936986 CTAACCTCTAAGGATGCGGGAGG - Intronic
1048380025 8:133857305-133857327 CAGGCCTCTGAGACTGCGTGGGG - Intergenic
1049088639 8:140496839-140496861 CTGCCCTCACACACTGCTGGTGG - Intergenic
1053404204 9:37857100-37857122 CTGGCCTATAAGACTGAGGAAGG - Intronic
1055405441 9:75969019-75969041 CTGCCCTCTATGGCGGGGGGTGG + Intronic
1055865496 9:80808629-80808651 GTGCCCACTCAGATTGCGGGTGG - Intergenic
1185652407 X:1657887-1657909 CTCCCCTCCCAGACTGCTGGAGG - Intergenic
1185826612 X:3257232-3257254 GTGCCCACTTAGACTGAGGGTGG + Intergenic
1186314241 X:8351400-8351422 CTCCCCTCTAAGGCTGTAGGGGG + Intergenic
1188012596 X:25073630-25073652 GTGCCCACTCAGACTGAGGGTGG + Intergenic
1195869142 X:109468021-109468043 CTCCCCTCTAAGACTGGCTGAGG + Intronic
1200041672 X:153375364-153375386 CTGGCCTCTAGGACTGGGAGAGG + Intergenic