ID: 906177844

View in Genome Browser
Species Human (GRCh38)
Location 1:43791172-43791194
Sequence TACAGAAGGGGAGTGGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906177844 Original CRISPR TACAGAAGGGGAGTGGGTAC TGG (reversed) Intronic
900584475 1:3425819-3425841 AACAGCAGGGGAGTGGGCGCCGG + Intronic
900830118 1:4959866-4959888 GACAGAAGGGGAGGGGGAAGGGG + Intergenic
902069552 1:13722689-13722711 TACAGAATGGGAATGGGTGAGGG - Intronic
903347683 1:22697804-22697826 TGCGGAAGGGGAGTGGGGAAAGG - Intergenic
904416701 1:30366258-30366280 TACAGAATGGGAATGGGGTCTGG - Intergenic
904672483 1:32176191-32176213 TAAAGAAGGAAAGTGGGTAATGG + Exonic
905247574 1:36625629-36625651 TGCAGTAGGGGAGTGGGGACAGG - Intergenic
905800541 1:40839630-40839652 TGAAGAAGGGGAGCGGGTAAAGG - Exonic
906177844 1:43791172-43791194 TACAGAAGGGGAGTGGGTACTGG - Intronic
906302335 1:44692072-44692094 TAGAGAAGGCGAGAGGGTTCAGG - Intronic
907516686 1:54997432-54997454 GACATAAGGGGAGTGGGAAAAGG - Intergenic
908320596 1:62974416-62974438 TGCATATGGGGAGTGGCTACTGG + Intergenic
910549219 1:88456835-88456857 TACTGATGGGGTGGGGGTACGGG + Intergenic
911197089 1:95005516-95005538 GACAGATTGGGAGTGGGGACAGG + Intronic
911218344 1:95219972-95219994 TACAAAAGGAGAGTGGGGAAGGG - Intronic
912484167 1:110011359-110011381 TAAAGAAAGGGAGTGGGTTAGGG + Intronic
912536040 1:110371869-110371891 TACAGAGGAGGTGTGGGGACCGG + Intronic
913170457 1:116227444-116227466 CATAGAAGGGGTGTGGGTAGGGG - Intergenic
916418314 1:164612752-164612774 TCCAGAAGGGGAGAGGGACCAGG - Intronic
916896835 1:169172159-169172181 TCCAGAAGGGGTAGGGGTACTGG - Intronic
921957770 1:221001731-221001753 AAGAGAAGGGGAGTGGGTCAGGG + Intergenic
922219732 1:223549396-223549418 TAGAAAAGGGGAGTGGGAATCGG + Intronic
922242073 1:223762085-223762107 TAGAGAAGGGGAGTGGGAGGTGG + Intronic
922610192 1:226920746-226920768 CCCAGATGGGGAGGGGGTACTGG + Intronic
924603150 1:245509221-245509243 TAAAGAAGGGCAGTGTGTATAGG + Intronic
1065884002 10:30060775-30060797 TACAGATGAGGAGTGGGCTCAGG + Intronic
1068246480 10:54377782-54377804 TACAGAGGGGCAGAGGGTAGTGG - Intronic
1068387962 10:56357929-56357951 TGCAGATGGGGAGGGGGTACTGG - Exonic
1068962208 10:62877990-62878012 TCCAGAAGGGGAGGGGCTGCTGG + Intronic
1069241415 10:66144885-66144907 TGTGGAAGGGGAGTGGATACTGG - Intronic
1070333796 10:75437069-75437091 TACTGAAGGAGAGTGGATATAGG + Intronic
1072615799 10:97048274-97048296 TACAGGTGGGGACGGGGTACAGG + Intronic
1076716474 10:132366782-132366804 TGCAGATGGGGTGTGGGGACAGG - Intronic
1076770662 10:132662396-132662418 CACAGCAGGTGAGTGGGAACAGG + Intronic
1079487623 11:20951930-20951952 TGGAGAAGGGGAGTGTGCACTGG + Intronic
1080420373 11:32104793-32104815 TTCAGAAGGTGAGTGGGTTGAGG + Exonic
1080441131 11:32295559-32295581 TAAGGCAGGGGAGTGGGGACAGG + Intergenic
1081658944 11:44876115-44876137 CACAAAAGGGGACTGGGGACAGG - Intronic
1083724566 11:64621476-64621498 TGCAGAGAGGAAGTGGGTACAGG + Intronic
1087614209 11:100469775-100469797 TACAGAAAGGTAATGGGCACAGG - Intergenic
1087752959 11:102025563-102025585 TACAGAAGGGGAGACAGGACAGG - Intergenic
1088348130 11:108853758-108853780 CACAGAAGGGGAGTGGGAAATGG - Intronic
1089739602 11:120573439-120573461 CACAGGTGGGGAGTGGGTATGGG - Intronic
1090054462 11:123410553-123410575 AACAGAAGGGGACTGGTTCCAGG - Intergenic
1090406457 11:126478429-126478451 CTCAGAAGGGGAGTGGGGATGGG + Intronic
1094201490 12:27799216-27799238 TACAGAAGTGGAATGGTTTCTGG + Exonic
1096776288 12:53966312-53966334 TGCAGTAGGGGAGTGGGGAGTGG - Intergenic
1098336620 12:69411628-69411650 TACTGGAGGGGAGTGTGGACAGG + Intergenic
1107133944 13:36924072-36924094 CACCGTAGGGGAGTGGGCACAGG + Intergenic
1113715180 13:112499983-112500005 AACAGCAGGGAAGGGGGTACAGG + Intronic
1123058194 14:105582290-105582312 TACAGTACAGGAGTGGGGACAGG - Intergenic
1123082285 14:105701215-105701237 TACAGTACAGGAGTGGGGACAGG - Intergenic
1124193403 15:27599534-27599556 CACACAAGGGGAGTAGCTACGGG + Intergenic
1124376265 15:29130936-29130958 TACAGAAGGAGAGCGGGGAGAGG + Intronic
1124556379 15:30729516-30729538 TAAGGAAGGGGAATGGGTATTGG + Intronic
1124674894 15:31676254-31676276 TAAGGAAGGGGAATGGGTATTGG - Intronic
1125676123 15:41503382-41503404 TATAGAAGGGGAGGGGGCAAAGG + Exonic
1126067724 15:44838600-44838622 TAGGGTAGGGGAGTGGGCACAGG + Intergenic
1126092153 15:45062282-45062304 TAGGGTAGGGGAGTGGGCACAGG - Intronic
1126221599 15:46220644-46220666 TACAGAAGGGAAGTTAGCACTGG + Intergenic
1127774242 15:62253084-62253106 TACAGGAGGGCAGTGGGCAGAGG + Intergenic
1128776418 15:70323729-70323751 AAGAGAAGGGGAGGGGGGACTGG - Intergenic
1132146210 15:99431551-99431573 ATCAGAAGGGGAGTGGGTCTTGG - Intergenic
1132540181 16:504813-504835 TACAGGAGATGAGGGGGTACAGG - Intronic
1132742758 16:1423628-1423650 TAAAGAATGGGAGTGGGGCCGGG - Intergenic
1133693868 16:8242195-8242217 CACAGAAGGGGAGTAGCAACAGG - Intergenic
1134659657 16:15974415-15974437 TACAGAGTGGGAGTGGGGAGTGG + Intronic
1134849097 16:17466057-17466079 TAAGGAAGGGGTGTGGGAACAGG - Intronic
1135936697 16:26786559-26786581 GTCATAAGGAGAGTGGGTACTGG - Intergenic
1137253809 16:46759061-46759083 TACAGAAGTGGAGAGGGAAATGG + Intronic
1139486118 16:67257509-67257531 TCTAGAAGGGGGGTGGGTAGGGG - Exonic
1141564630 16:84893077-84893099 CTCAGAAGGGGAGTGAGCACTGG + Intronic
1142687388 17:1585563-1585585 TAGAGACGGGGAGTGGGGGCTGG + Intronic
1145942276 17:28748859-28748881 GAGAGGAGAGGAGTGGGTACAGG - Intronic
1146507816 17:33420762-33420784 CACAGAATGGGAGTTGGGACGGG + Intronic
1147055789 17:37833782-37833804 GACTGAAGGGGAGGGGGTATTGG + Intergenic
1147420175 17:40318529-40318551 TGCGGGAGGGGACTGGGTACCGG + Intronic
1147690338 17:42311014-42311036 TTCAGAAGGGGAGGGGAGACAGG + Exonic
1148398442 17:47330459-47330481 TTCAGAAGTGGAGAGGGGACAGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148866129 17:50629670-50629692 TACATAAGGGGTGGGGGTAGGGG + Intergenic
1149392372 17:56204737-56204759 TACGGATGGGGAGGAGGTACAGG - Intronic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1153843252 18:9026007-9026029 TACAGAGGGGGAGTGGGGAGTGG + Intergenic
1155331985 18:24727963-24727985 TACAGATGGGGAGAAGGAACAGG - Intergenic
1157698907 18:49747025-49747047 TACAGGAGGGGAGAGGAGACTGG + Intergenic
1157878623 18:51297168-51297190 TACATAAAGGGAGTGGGTTTAGG - Intergenic
1158908425 18:62036444-62036466 TAAAAAAGGAGAGTGGATACTGG + Intergenic
1159220028 18:65448698-65448720 TACAGAAAGGTATTGGTTACTGG - Intergenic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160586528 18:79916319-79916341 TACAGAAGCACTGTGGGTACGGG - Intronic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1162054171 19:8052943-8052965 AAGAGGAGGGGAGTGGGTACTGG - Intronic
1165104411 19:33460583-33460605 TAGAGCAGGGGGGTGGGTACGGG - Intronic
1165403032 19:35613804-35613826 TAGAGCAGGGGAGGGGGCACAGG + Intronic
1165471548 19:36007327-36007349 TACAGAAGAGGGGTGGGGATGGG - Intronic
1165832134 19:38735553-38735575 TACAGATGGGAAGTGGGGAGGGG + Intronic
1166934113 19:46320787-46320809 CACAGAAGGGGAGGGAGGACAGG - Intronic
1167052320 19:47086761-47086783 TGAGGAAGGGGAGTGAGTACTGG - Intronic
1167105635 19:47428743-47428765 GAGAGAAGGGTAGTGGGTAACGG + Exonic
1167321943 19:48802414-48802436 TAAAGAAGGGACGTGTGTACTGG + Intronic
1168268231 19:55234941-55234963 AACAGAGGGGATGTGGGTACTGG + Intronic
929557452 2:42934462-42934484 GACAGAAGGGGAGGTGGTGCCGG - Intergenic
931807055 2:65817660-65817682 GGCAGAAAGGGAGTGGGTATGGG + Intergenic
932040532 2:68294530-68294552 TACAGAAGGGGAATGGCGAAGGG + Intronic
933274442 2:80268238-80268260 AATAGAAAGGGGGTGGGTACCGG + Intronic
933402153 2:81811997-81812019 GGCAGAAGGTGAGTGGGTGCAGG - Intergenic
934994788 2:98947917-98947939 TTCAGAATGGGAGGGGGTAATGG - Intergenic
935404791 2:102697667-102697689 TAGAGCAGGGAAGTGGGTGCGGG + Intronic
936291993 2:111233295-111233317 CAGAGAAGGTGAGTGTGTACAGG - Intergenic
942202229 2:173582864-173582886 GAAAGATGGGGAGTGGGGACAGG - Intergenic
942383083 2:175413124-175413146 TACAGAAGGAGCCTGGGTTCTGG - Intergenic
942789377 2:179741421-179741443 TACAGAAGCTGAGTGGGCAAAGG + Intronic
943294695 2:186122041-186122063 TAAAGAAGGGGGGTGGCTAATGG + Intergenic
946376720 2:219314321-219314343 TACACAAGAGGCGTGTGTACAGG - Intergenic
946661795 2:222008684-222008706 TGAATAAGGGGAGTGGGTATGGG + Intergenic
947285318 2:228507553-228507575 TGTGGAAGGGGAGTGGGTAAGGG + Intergenic
948751944 2:240138031-240138053 TAGAGAAGGGGAGTGGGGGGCGG + Intergenic
948799802 2:240427384-240427406 TTCAGAGGCGAAGTGGGTACAGG + Intergenic
1172808622 20:37631598-37631620 TACTCAAGGGGAGTGGGTGTAGG - Intergenic
1174919194 20:54683567-54683589 ATTAGAATGGGAGTGGGTACAGG + Intergenic
1175384641 20:58586473-58586495 ACCAGAAGGGGAGTGGGAAATGG - Intergenic
1175418599 20:58817361-58817383 TCCGGAAGGGGAGCGGGCACCGG + Intergenic
1177234624 21:18372159-18372181 AACAGAAGGGGAGAGAGTAGGGG + Intronic
1179873754 21:44257032-44257054 TACAGAAGGGGTGTGGCCCCCGG - Intronic
1180137260 21:45869702-45869724 GACAGAAGGGCAGTGGGGCCTGG + Intronic
1181986933 22:26806458-26806480 TAAAGCAGGGGAGTGGGTTGGGG + Intergenic
1182267148 22:29125949-29125971 TTCAGAATGGGAGTGGATCCAGG + Intronic
1185242086 22:49752056-49752078 GACAGAGGGGGAGTGGGTGTGGG + Intergenic
949632544 3:5944173-5944195 CACAGAAGTGGAGTCTGTACAGG + Intergenic
950936741 3:16846863-16846885 GCCAGAAGGGAAGTGGGTATTGG - Intronic
953249230 3:41228657-41228679 TACAGAATGGGAGAAAGTACTGG - Intronic
953319956 3:41962623-41962645 AACAGAAGGACAGTGGGAACGGG - Intergenic
954747240 3:52794187-52794209 TGCAGAAGGGGAGGGTGTGCTGG + Intergenic
955192474 3:56774126-56774148 TACAGAAGGGGTGGGGAGACTGG - Intronic
959586502 3:108030090-108030112 GGCAGAGAGGGAGTGGGTACGGG + Intergenic
962711203 3:138087763-138087785 CAAAGAAGGGTAGTTGGTACAGG - Intronic
962844610 3:139263508-139263530 AACAAAAGGGGAGAAGGTACTGG - Intronic
962930374 3:140030429-140030451 GACAGAAGGAGAGTGGGTAGGGG + Intronic
967016601 3:185487985-185488007 TCCAAAAGGGCAGTGGGTAGAGG - Exonic
968915941 4:3497120-3497142 GACAGCAGGGCAGTGGGTAGAGG + Intronic
969239906 4:5891098-5891120 TACAGAAGGGGTGGGGGAAGAGG + Intronic
972831582 4:42820089-42820111 TAGAGAACGGGAGAGGGTACAGG + Intergenic
974336123 4:60547022-60547044 AAAAAAAGGGGAGTGGGTAGAGG - Intergenic
976300228 4:83509451-83509473 TAGAGGAGGAGAATGGGTACAGG + Intronic
976489659 4:85654705-85654727 TACAGAACGGGAGTGGGATTGGG + Intronic
978164821 4:105594305-105594327 TCCAGAAGGGAAGTGAGAACAGG - Intronic
979059490 4:116039167-116039189 TACAGAAAGGGAGAGGCTAGGGG + Intergenic
984236608 4:177166444-177166466 TACAGCAGGGTAGTGGGGAAAGG + Intergenic
984600523 4:181721383-181721405 TATAGAAGTGGAGTGGGTCCTGG + Intergenic
984747405 4:183235485-183235507 TACAGAAGGAGAGTTGCTACAGG - Intronic
985564958 5:611108-611130 TACAGAAGGGGTGTGTGCAGAGG - Intergenic
987849159 5:23326340-23326362 GACAGAAGAGGAGTGGGGAGGGG + Intergenic
988298338 5:29392855-29392877 GACAGGCAGGGAGTGGGTACTGG - Intergenic
991361327 5:65823878-65823900 TCCAGAAGAGGAGTGGGTTTTGG + Exonic
992945279 5:81803488-81803510 TGGAGAAGGGCAGTGGCTACTGG - Intergenic
996397372 5:123026828-123026850 TACAGAAGGGGAGGTGGGCCTGG - Intronic
996646710 5:125826388-125826410 TCCAGAAGGAGAATGGGGACAGG - Intergenic
997013024 5:129902465-129902487 TACTGCAGGGGAGAGGGTACTGG + Intergenic
998532919 5:142902032-142902054 TACAGAACGTGAGTGGGCATAGG + Exonic
1001076037 5:168628801-168628823 TATAGAAGGGGAGAGGGGACAGG + Intergenic
1001794108 5:174487573-174487595 TACAGAAGGGGAGGAAGGACGGG + Intergenic
1002012636 5:176296047-176296069 TCCAAAAGGGGACTGGATACTGG + Intronic
1002215199 5:177626687-177626709 TCCAAAAGGGGAGTGGATACTGG - Intergenic
1004493008 6:16135064-16135086 TACAGAAGAGGGCTGGGAACAGG - Intronic
1006236517 6:32638034-32638056 CACAGGTGGGGAGTGGGTAAAGG + Intronic
1006911506 6:37566385-37566407 GAGAGAAGGGGAGTGGGGAGGGG + Intergenic
1007060434 6:38935243-38935265 TACAGAAGCAGTGTGGGAACAGG + Intronic
1008875676 6:56323896-56323918 CACAGATGGGGAGAGGGTTCAGG + Intronic
1010784901 6:79989796-79989818 AACAGAAGGGCAGTGTGTAAAGG - Intergenic
1018393777 6:163361342-163361364 TGCAGAAGGGGAGAGGCTGCTGG - Intergenic
1019097117 6:169591234-169591256 TACAGATGGCCAATGGGTACAGG - Intronic
1022711668 7:32856540-32856562 CACAGAAGGGCAGTGGGCAGGGG - Intergenic
1022912990 7:34918419-34918441 CACAGAAGGGCAGTGGGCAGGGG + Intergenic
1024420848 7:49164497-49164519 TAGACAAGGTCAGTGGGTACCGG - Intergenic
1029363567 7:100103339-100103361 TAAAGAGGGGGAGTGGGGCCAGG - Intronic
1029609087 7:101617107-101617129 GACAGAAGGGGAAAGGGCACCGG - Intronic
1034452228 7:151143147-151143169 CACAGAGGGGCAGTGGGTAATGG - Intronic
1035389823 7:158496925-158496947 CAGAGAAGGGGAGGGGGTGCAGG - Intronic
1037595800 8:20353208-20353230 TACAGAAGGGGAGTGGGAGGGGG - Intergenic
1037987653 8:23299750-23299772 CACAGCAGGGGGGCGGGTACAGG + Intronic
1040468767 8:47719022-47719044 AGCAGGAAGGGAGTGGGTACTGG + Intronic
1040716915 8:50266878-50266900 TACCCAAGGGGAGTGGCTTCAGG - Intronic
1041104189 8:54425423-54425445 GATAGAATGGGAGTGGGTGCTGG - Intergenic
1042266810 8:66916761-66916783 TAGAGTAGGGGAGTGGGTTGTGG + Intronic
1042401504 8:68353946-68353968 TGCAGAAGGGGATTGGTTCCAGG - Intronic
1043703636 8:83322212-83322234 TAGAGAAGCGGTCTGGGTACAGG - Intergenic
1045514297 8:102843395-102843417 TACTCAAGGGGAGTGGGTGTGGG + Intronic
1045550307 8:103165396-103165418 AACAGAAGGGGAGTTTGTAAAGG - Intronic
1047753293 8:127898865-127898887 TCCACAAGGGGTGGGGGTACTGG + Intergenic
1047871217 8:129084219-129084241 TTCAGAATGGGAGTGAGTCCGGG + Intergenic
1049498487 8:142947950-142947972 TAGAGAAGGGGAGAGGGGAATGG + Intergenic
1050980267 9:12002540-12002562 TACAGAAGAATAGTGGTTACTGG + Intergenic
1052332266 9:27281954-27281976 GATGGAAGGGGAGTGGGCACAGG - Intergenic
1054856811 9:69909230-69909252 TAGAGATGGGGAGTGGGTCAAGG + Intergenic
1056339582 9:85612450-85612472 TCCAGAAGGGTCCTGGGTACAGG - Intronic
1057498499 9:95578593-95578615 AACAGCAGGGGAGTGGGGAAGGG - Intergenic
1059075734 9:111192000-111192022 TAAGGAAGGGGAGTGGATGCTGG + Intergenic
1060161551 9:121369741-121369763 GAAAGAAGGGGAGTGGGCAAAGG + Intronic
1060733183 9:126050603-126050625 TACGGGAGGGGAGAGGGTGCAGG - Intergenic
1061064403 9:128268381-128268403 TACAGGAGGGCAGTGGGCAGAGG + Intronic
1203692352 Un_GL000214v1:56161-56183 TAGATAAGAGGAGTGGGTTCTGG + Intergenic
1203556536 Un_KI270744v1:3053-3075 TAGATAAGAGGAGTGGGTTCTGG + Intergenic
1203643943 Un_KI270751v1:48030-48052 TAGATAAGAGGAGTGGGTTCTGG - Intergenic
1186640279 X:11448510-11448532 AAAAGAAGTGGAGTGAGTACAGG - Intronic
1186720946 X:12303048-12303070 TAGGGAAGGGGAGAGGTTACAGG + Intronic
1187134064 X:16529749-16529771 TAGTGAAGTGGAGTGGGCACTGG + Intergenic
1187421102 X:19134417-19134439 GACAGAAGTGGAGTGGATTCTGG + Intergenic
1187572454 X:20518847-20518869 TAAAGAAGGGCCCTGGGTACTGG - Intergenic
1189902772 X:45724490-45724512 TACAGAATGGGAAAGGATACTGG - Intergenic
1192220238 X:69192878-69192900 TTGAGATGGGGTGTGGGTACAGG - Intergenic
1194188953 X:90810594-90810616 CACAGATGTGGAGTGGGTAAGGG + Intergenic
1199284621 X:146042200-146042222 AAAAGAAGGGGAGAGGATACAGG + Intergenic
1199474543 X:148231110-148231132 GAGAGAAGGGGAGTGGGGAGAGG - Intergenic
1201977557 Y:19869369-19869391 TGCATAAGGGCAGTGGGTTCCGG + Intergenic