ID: 906178946

View in Genome Browser
Species Human (GRCh38)
Location 1:43801451-43801473
Sequence TCTTGAAGGTTCCTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906178946_906178951 22 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178951 1:43801496-43801518 CAGGATGTGACTGCACAGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 266
906178946_906178948 -3 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178948 1:43801471-43801493 AGAAGCTCTCTCTTTTGTCCTGG 0: 1
1: 0
2: 4
3: 224
4: 3685
906178946_906178949 3 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178949 1:43801477-43801499 TCTCTCTTTTGTCCTGGAACAGG 0: 1
1: 0
2: 0
3: 21
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906178946 Original CRISPR TCTTGAAGGTTCCTGAAGCC AGG (reversed) Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
900159720 1:1217804-1217826 TCTGGAAGGTTCCCGAAGGGAGG + Intronic
901914139 1:12485220-12485242 TCCTCAATGTTGCTGAAGCCGGG - Intronic
902373541 1:16019472-16019494 GATTGAAGGTTCTTGAAGACGGG + Intronic
903316510 1:22512124-22512146 TCTTGAACGTACCTGAGGCATGG - Exonic
905582805 1:39095006-39095028 TCGTGAAGATTCCTGAAGGGTGG - Intronic
905598340 1:39228588-39228610 TCTTGAAAGTATCTAAAGCCAGG - Intronic
906178946 1:43801451-43801473 TCTTGAAGGTTCCTGAAGCCAGG - Intronic
909023065 1:70453231-70453253 GCATGGAGGTTCCTGAAGGCTGG - Intergenic
909023151 1:70454339-70454361 ACGTGGAGGTTCCTGAAGGCTGG - Intergenic
910592103 1:88937086-88937108 TCATGCAGGGTCCTGGAGCCTGG + Intronic
911189420 1:94933001-94933023 CCATGAAGGTTCCTGAAGTGGGG - Intergenic
912491056 1:110063088-110063110 TCTAGAAGCTTCCTGAAGGATGG - Intronic
919928256 1:202204137-202204159 TCTGGGAGCTTCCTGAAGGCAGG + Intronic
920199375 1:204250111-204250133 CCCTGAAGCTCCCTGAAGCCAGG + Intronic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
920948719 1:210553371-210553393 TCTGGAAGGCTCCTGAATCTAGG - Intronic
921032667 1:211347339-211347361 TTCTGAAGCTTCCTCAAGCCTGG - Intronic
921783756 1:219200822-219200844 TCTGGAAGGGTCCTGAGGACAGG + Intronic
924572270 1:245247657-245247679 ACTTGCAGGGTCCTGAAGGCTGG + Intronic
924756683 1:246947400-246947422 TTTTGAAGGTTTGGGAAGCCTGG + Intronic
1067337297 10:45375760-45375782 TCTTGAAGGGAGCTCAAGCCAGG - Intronic
1070645623 10:78200225-78200247 TTTTGAAGGTTACTGAAGGTAGG + Intergenic
1071335546 10:84597458-84597480 TATGGAAGATTCCAGAAGCCAGG + Intergenic
1072845695 10:98827733-98827755 GCTTTAAGGTTGCTGAAGCCAGG + Intronic
1074258237 10:111825714-111825736 TTGTGAGGGTTCCTGAAGTCTGG + Intergenic
1076558330 10:131344803-131344825 TCTGGCAGGTGCCTGGAGCCTGG + Intergenic
1079379629 11:19926489-19926511 TCTGCAAGGTTCTTGGAGCCTGG - Intronic
1079896987 11:26132591-26132613 TCTTGAAGGTGCATGTAGCATGG + Intergenic
1079998126 11:27318078-27318100 TCTTCATGTTTCCTGAAGGCAGG + Intergenic
1083305272 11:61758701-61758723 TCTAGAAGGTTCCAGATGGCGGG - Intronic
1084682955 11:70677718-70677740 TGTTGAGGGCTCCGGAAGCCAGG + Intronic
1084778384 11:71392442-71392464 TAATGAAGTTTCCTAAAGCCAGG - Intergenic
1085774091 11:79350077-79350099 TCTGGAAGTTTCCTGAGGGCAGG - Intronic
1085865418 11:80285370-80285392 TATCAAAGGTGCCTGAAGCCAGG + Intergenic
1086558751 11:88142635-88142657 TTCTGAAGACTCCTGAAGCCAGG + Intronic
1089181604 11:116587079-116587101 TCAAGAAAGTCCCTGAAGCCTGG + Intergenic
1093685177 12:22046540-22046562 TCTGGAAGGCCCCTGAATCCAGG - Exonic
1098363499 12:69678386-69678408 TTTTCAAGGATCCTGGAGCCAGG + Intronic
1099286330 12:80717363-80717385 TCTTGAGGGTTTCGAAAGCCTGG - Exonic
1100206968 12:92360854-92360876 TCTAGAAGCTCCCTGAAGGCAGG + Intergenic
1100464712 12:94834761-94834783 ACTGGAAGGATGCTGAAGCCTGG + Intergenic
1100714081 12:97287864-97287886 TCTTGGAGGGTCATAAAGCCAGG + Intergenic
1101800791 12:108020257-108020279 TCCCTAAGGTGCCTGAAGCCAGG + Intergenic
1101900607 12:108788903-108788925 TCTGGAAGGTTCCAAAAGGCTGG + Exonic
1103557677 12:121775966-121775988 GCTTGAAGGTGGCTGAGGCCGGG + Exonic
1106599011 13:31171513-31171535 TCTTTCAGTTTCCTGAAGGCAGG - Intergenic
1108296833 13:49029179-49029201 TCTTTAAATTTACTGAAGCCTGG - Intronic
1110528970 13:76574484-76574506 TCTACAAGCTTCCTGAAGGCAGG + Intergenic
1112744473 13:102511235-102511257 TCTTGAAGGAGCCTGGAACCTGG - Intergenic
1113586515 13:111469677-111469699 TCTTGAAGGAGCCAGAAACCAGG + Intergenic
1116593350 14:46808505-46808527 TCTGGAAGGATCCTGAACACAGG + Intergenic
1119435880 14:74597573-74597595 ACTGGGAGCTTCCTGAAGCCAGG - Intronic
1120230235 14:81833901-81833923 GCTGGAAGGTTCCTGAAATCAGG - Intergenic
1124654498 15:31497638-31497660 CCCTGAAGGTTCCTGAGTCCTGG + Intronic
1124782498 15:32649556-32649578 TTTGGAAGATTCCTGAACCCTGG + Intronic
1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG + Intergenic
1126372351 15:47961008-47961030 TCTTGAAGTTTCTTGAATCTTGG + Intergenic
1128414328 15:67430246-67430268 TCCTGATGGGTCCTGGAGCCAGG + Intronic
1129091969 15:73160751-73160773 TCATGCAGGTTCCTGAAGGGTGG - Intronic
1129328155 15:74812833-74812855 TCGTGAAGGCGCCTGAAGTCTGG - Exonic
1129909016 15:79210783-79210805 TTTTGAAGGGTCCTGATGCATGG + Intergenic
1131111318 15:89766875-89766897 TGCTGAAGGTCCCTGGAGCCAGG - Intronic
1132366561 15:101262009-101262031 TCTGGAAGGGTCCTGAGGACAGG + Intergenic
1134208997 16:12260279-12260301 CCTTGTAGGTTCCTGGAGCAGGG + Intronic
1136187785 16:28598110-28598132 TCCTGAAGGTTGCTGAGGGCAGG - Intergenic
1136268508 16:29134361-29134383 TCTTGATGGTTCCTAGAGCCTGG + Intergenic
1138851952 16:60640328-60640350 TTTTGAGAGTTCCTGAAGTCTGG - Intergenic
1139216468 16:65130115-65130137 TTGTGGAGGTTCCTGAAGCATGG + Intergenic
1140189696 16:72804886-72804908 TCTTGAAGCTACCTGCAGACAGG + Intronic
1142028521 16:87827089-87827111 CCGGGAAGGTTCCTGAAGACAGG - Intergenic
1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG + Intronic
1143650601 17:8261922-8261944 TGCGGAAGGGTCCTGAAGCCTGG - Intronic
1143651199 17:8265159-8265181 TGTGGAAGGGTCCTGAAGCCCGG - Intronic
1144357252 17:14458084-14458106 CCATTAAGGTTCCTGAAACCAGG - Intergenic
1144385543 17:14746106-14746128 TCTTGAAGGCAGCTGGAGCCTGG - Intergenic
1145042127 17:19584813-19584835 GCTGGAAGGATACTGAAGCCTGG - Intergenic
1147565811 17:41535954-41535976 TCTTGAAGGGCCCAGCAGCCAGG + Intergenic
1149477024 17:56970936-56970958 TCTTCAAGAGTCCTGAGGCCTGG - Intergenic
1150628778 17:66861596-66861618 CCTTGCAGGCTTCTGAAGCCTGG + Intronic
1151677011 17:75603780-75603802 TCTTGGAGGTTTCTGAACTCTGG - Intergenic
1152242003 17:79165743-79165765 TCTGGAAGCTTCCAGAAGTCAGG + Intronic
1152552505 17:81036601-81036623 TCTGGAAGGTTTCTGAAGGCGGG + Intronic
1153803751 18:8694233-8694255 TCGTGGAGGTTCCTGGAGGCTGG + Intergenic
1157413190 18:47480912-47480934 TCATCAAAGTTCATGAAGCCAGG - Intergenic
1166604793 19:44131432-44131454 TCTTTGATGTTCCTGAAGCTGGG - Exonic
926024587 2:9530176-9530198 TATGGAAGATTCCTGTAGCCCGG - Intronic
927166726 2:20330557-20330579 TCTTGGAGGTTCCTGGAGAGTGG + Intronic
927204748 2:20600075-20600097 TGTTGAAGCTTTCTGAGGCCTGG - Intronic
929905248 2:46040084-46040106 GCTGGAAGTTTCCTGAAGGCAGG + Intronic
931238604 2:60432915-60432937 CCTTGATGGTTCCTGAAGAAAGG - Intergenic
931639976 2:64373444-64373466 TCTGGAATGTGGCTGAAGCCTGG + Intergenic
932813332 2:74842651-74842673 GATGGAAAGTTCCTGAAGCCAGG + Intronic
933485571 2:82918588-82918610 TTTTGAAGATTCTTCAAGCCAGG - Intergenic
933767303 2:85718950-85718972 TCTTGGAGGTTCCCACAGCCTGG - Intergenic
934616194 2:95772760-95772782 CCATGAGGGTTCCTGAAGGCTGG - Intergenic
934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG + Intergenic
934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG + Intergenic
935337738 2:102033037-102033059 TCTTGTAAGTTCCTCAAGGCAGG + Intergenic
936809242 2:116376477-116376499 TATTGAAAGGTCCTGAGGCCAGG - Intergenic
937468048 2:122152201-122152223 TCTTGAGGGTTTCTGTGGCCAGG + Intergenic
938364104 2:130720368-130720390 TCCTGAAGGTCCATGAAGTCTGG - Intergenic
939575185 2:143887067-143887089 ACATGAAGGTTCCTGGAGGCTGG + Intergenic
940154910 2:150645382-150645404 TATTGAAGCTTCCAGAAGCCTGG - Intergenic
943731032 2:191304125-191304147 ACTTGAAGCTTCCTGAGGCTGGG + Intronic
944702673 2:202259801-202259823 TTTAGAAGTTTCCTGAAGCTGGG - Intergenic
944988948 2:205212327-205212349 TCCTGAAGATTCTTGAAGCCTGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948377404 2:237530550-237530572 TCTGGAAGCTTCCTCAACCCTGG + Intronic
1169032900 20:2425576-2425598 TCTTAAAGGTACCTGAAGTCAGG + Intronic
1169476856 20:5939631-5939653 CCATGAAGCTTCCTGAAGCCAGG - Intronic
1169738509 20:8864440-8864462 TCTTGGGACTTCCTGAAGCCAGG + Intronic
1170823407 20:19773109-19773131 GCTTGAGGCTTCCAGAAGCCGGG - Intergenic
1172605381 20:36210223-36210245 TCTTGGGGGCTCCTGCAGCCTGG + Intronic
1172681257 20:36717343-36717365 TCCTTTAGCTTCCTGAAGCCTGG + Intronic
1175170404 20:57076393-57076415 TTTTGAAGTTTCCAGAAGTCAGG - Intergenic
1175400807 20:58698920-58698942 TCCTGAGGCTTCCTGGAGCCCGG - Intronic
1177563890 21:22794024-22794046 TCTTTACAGTACCTGAAGCCTGG - Intergenic
1178676295 21:34634422-34634444 TCTGGAAGGGTCCTGAACACAGG + Intergenic
1178765333 21:35445530-35445552 TCCTGAAGCTTCCAGAAGCTAGG - Intronic
1179536289 21:42054944-42054966 ACTTGAATGCTCCTGAGGCCAGG + Intergenic
1182748702 22:32624985-32625007 TCTTCATGGTCTCTGAAGCCAGG - Intronic
949740549 3:7228485-7228507 TCTCAAAGGTTCCTTAAGCCAGG - Intronic
952283165 3:31942638-31942660 TTTTGAAGGTTTCAGATGCCAGG - Intronic
955985331 3:64567962-64567984 TCTTGGAGGTTCTTGAAGAAAGG - Intronic
957671025 3:83303050-83303072 ACATGGAGGTTCCTGAAGGCTGG - Intergenic
958720486 3:97837388-97837410 ACTTGCTGGTTCCAGAAGCCTGG - Intronic
959263574 3:104111207-104111229 TCTGGAAAGGTCCTGAAGGCAGG - Intergenic
959686208 3:109149797-109149819 TCTTGAAGGCTCGTGAAACATGG + Intergenic
962385849 3:134931653-134931675 TCCTGAAGGTTCATGAGGCTTGG - Intronic
962716258 3:138128682-138128704 TCTACAAGTTTCCTGATGCCTGG - Intronic
964226979 3:154415192-154415214 TCTTTTAGGTTTCTTAAGCCAGG + Intronic
964893891 3:161570547-161570569 TCTTGAAGTTAGCTGTAGCCAGG - Intergenic
966461118 3:180177475-180177497 ACTGTAAGGTTCATGAAGCCAGG - Intergenic
967617520 3:191589782-191589804 TCTTGCAGTTAACTGAAGCCAGG + Intergenic
968001691 3:195210953-195210975 TCTTGATGGTTCCCCAAGCCTGG - Intronic
968093410 3:195911474-195911496 TCCTGATGCTTCCTGAAGCAGGG - Intronic
970367152 4:15371497-15371519 TCTGTAAGCTCCCTGAAGCCAGG - Intronic
974011778 4:56613644-56613666 GTTTTAAGTTTCCTGAAGCCAGG - Intergenic
976138658 4:81966295-81966317 TCTTGAAGGTACGTGAAAGCTGG + Intronic
978836851 4:113161009-113161031 TCTTCATTGTTCCTTAAGCCTGG + Intronic
979891948 4:126108759-126108781 TATTGAAGGTTCTACAAGCCAGG - Intergenic
981473515 4:145164001-145164023 TCTTAAAAGTTCCTATAGCCGGG - Intronic
982530556 4:156537015-156537037 TCTCTAATGTGCCTGAAGCCTGG + Intergenic
983187286 4:164714738-164714760 CCTTGTAGGTGCCTGAAGCAGGG + Intergenic
983627276 4:169814548-169814570 TATTGAAGGTCCCTGAACACTGG + Intergenic
985877559 5:2611786-2611808 ACTTGCAGGTCCCTGATGCCGGG - Intergenic
988564137 5:32307430-32307452 TCTTGATGGTACCTGATGGCTGG - Intronic
991255122 5:64604853-64604875 TCTTGAATGCTACTAAAGCCAGG - Intronic
992004956 5:72468290-72468312 TCTGGAAGGGTCCTGGGGCCTGG - Intronic
995251437 5:109997458-109997480 TCTTGATTGTGCCTGAAGCATGG + Intergenic
995358860 5:111270412-111270434 AGTTGAAGGTTCCAGAGGCCAGG - Intronic
1000582237 5:163048618-163048640 CCTGGAAGGAGCCTGAAGCCAGG - Intergenic
1001126110 5:169021032-169021054 TCTAGAAGGTTCTGAAAGCCAGG - Intronic
1003607299 6:7574707-7574729 TGTTAAAGGTTTATGAAGCCAGG + Exonic
1003775366 6:9354551-9354573 TCTAGATGGTGCCTTAAGCCTGG - Intergenic
1004179658 6:13370181-13370203 TCTTGAAAGCTTCAGAAGCCCGG + Intronic
1005408023 6:25512874-25512896 TCCTGGGGGTGCCTGAAGCCAGG + Intronic
1006779629 6:36623538-36623560 TCAGGAAGGTTCCAGTAGCCAGG - Intergenic
1007828797 6:44622251-44622273 TCTTTAAGGTGCCTGCAGGCAGG + Intergenic
1007831357 6:44641045-44641067 TCATAAAGGTACTTGAAGCCAGG - Intergenic
1010057725 6:71585499-71585521 ACTGGAAGGATGCTGAAGCCTGG + Intergenic
1013510536 6:110840589-110840611 TCCTGAATGTTCCTGAAGGGTGG - Intronic
1015646809 6:135400484-135400506 TCTGTAAGCTTCTTGAAGCCAGG - Intronic
1017602947 6:156103268-156103290 TCTTGAATGCTTCTGAAGTCGGG - Intergenic
1018325334 6:162661614-162661636 ACTTGAAGGTTCCTGTGTCCTGG + Intronic
1019221329 6:170475147-170475169 TGTTGGAAGTTCCAGAAGCCTGG + Intergenic
1020123499 7:5519188-5519210 TGTTGAATGTTCCTGAAACTTGG - Intergenic
1021761372 7:23905285-23905307 GCTTTAAGGTCCCGGAAGCCAGG - Intergenic
1021803881 7:24335917-24335939 TCTTGCTGGTTCCTGAAGTGAGG - Intergenic
1023298987 7:38748128-38748150 TCTTGAATGTTCCTGGACCATGG + Intronic
1024506646 7:50167707-50167729 CCTTCAAGGTTCCTGGAGTCTGG + Intergenic
1026272763 7:68850882-68850904 TCTTGAGGATTCCTTGAGCCTGG + Intergenic
1026324504 7:69297171-69297193 TCTAGGAGGTTCCTAAAGTCTGG - Intergenic
1027123159 7:75536779-75536801 TCTTGAAGGCTGATGTAGCCGGG + Exonic
1029366442 7:100119532-100119554 TCTTGAAGGTCCTGGCAGCCGGG - Intronic
1031342086 7:120615292-120615314 TCATAAAGGATCTTGAAGCCAGG - Intronic
1032794620 7:135267833-135267855 TCTTGCAGGTCCTTGAAGCCTGG - Intergenic
1034482418 7:151332747-151332769 ACATGAAGGTTCCTGAAGGGTGG + Intergenic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1036927596 8:12922201-12922223 TCTCCAAGATTCCTGAACCCTGG - Intergenic
1038298877 8:26323670-26323692 TCTGGAAGGGTCCTGAATGCAGG + Intronic
1039981712 8:42414006-42414028 CCTTGAAGGCTCCTGGAGTCTGG - Intergenic
1043758665 8:84036084-84036106 TGTTGAAGTTTGCTGAAGCAGGG - Intergenic
1046538587 8:115549224-115549246 TCTTAAAGGTTCCTGATAGCAGG - Intronic
1046685109 8:117216176-117216198 TCTTGAAAGTTTCTGAGGACAGG + Intergenic
1047409788 8:124615015-124615037 TGTTGGAGGTTCCAGAAGGCGGG + Intronic
1048525711 8:135200511-135200533 TCTTGACAGTTCTTGAATCCAGG + Intergenic
1049403835 8:142442915-142442937 TCTTGAGGGTTCCTGCAGGCTGG - Intergenic
1049622787 8:143606112-143606134 TCTTGACGGCTCCTTCAGCCAGG + Exonic
1052748699 9:32466910-32466932 TCTAGAAGGTTCTTGAAGGAGGG - Intronic
1056956438 9:91085296-91085318 CCATGAAGGTTCCTGAAGGATGG + Intergenic
1057816657 9:98300985-98301007 ACGTGAAGGTTCCTGGAGCATGG + Intronic
1057919178 9:99082568-99082590 TCTTCAAGGTTCCCTGAGCCAGG + Intergenic
1058466987 9:105238503-105238525 TCTTGAAGTTTACTCATGCCCGG - Intergenic
1059142883 9:111870691-111870713 TCTGGAAGGATCCTGAGCCCAGG - Intergenic
1059150214 9:111942875-111942897 TCCTCCAGGTTCCTGATGCCTGG + Intergenic
1060302622 9:122384154-122384176 ACATGAAGATTCCTGAAGGCCGG - Intronic
1061696624 9:132380594-132380616 TCTTGTTGCTTCCTGAAGCATGG - Intronic
1061827915 9:133273453-133273475 GCTAGAAGGTGCCTGCAGCCAGG - Intronic
1062170230 9:135130842-135130864 ACTGGAAGGTGCCAGAAGCCGGG - Intergenic
1187049023 X:15677695-15677717 TCTTGATAGTTCCTGCAGCCAGG - Intergenic
1188942350 X:36255408-36255430 TCATTAAGGCTCCTGAAGCTGGG + Intronic
1189536904 X:41944559-41944581 TCTGGAAGGTTCCTGTACCCAGG + Intergenic
1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG + Intronic
1199677687 X:150201503-150201525 TCTTGCAGTTTCCTGAGGGCAGG - Intergenic