ID: 906178946

View in Genome Browser
Species Human (GRCh38)
Location 1:43801451-43801473
Sequence TCTTGAAGGTTCCTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906178946_906178949 3 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178949 1:43801477-43801499 TCTCTCTTTTGTCCTGGAACAGG 0: 1
1: 0
2: 0
3: 21
4: 270
906178946_906178951 22 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178951 1:43801496-43801518 CAGGATGTGACTGCACAGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 266
906178946_906178948 -3 Left 906178946 1:43801451-43801473 CCTGGCTTCAGGAACCTTCAAGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 906178948 1:43801471-43801493 AGAAGCTCTCTCTTTTGTCCTGG 0: 1
1: 0
2: 4
3: 224
4: 3685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906178946 Original CRISPR TCTTGAAGGTTCCTGAAGCC AGG (reversed) Intronic