ID: 906178950

View in Genome Browser
Species Human (GRCh38)
Location 1:43801489-43801511
Sequence GTGCAGTCACATCCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906178950_906178955 12 Left 906178950 1:43801489-43801511 CCTGGAACAGGATGTGACTGCAC 0: 1
1: 0
2: 1
3: 7
4: 135
Right 906178955 1:43801524-43801546 CCAACTGCACGTCAGAATGTAGG 0: 1
1: 0
2: 0
3: 7
4: 92
906178950_906178956 16 Left 906178950 1:43801489-43801511 CCTGGAACAGGATGTGACTGCAC 0: 1
1: 0
2: 1
3: 7
4: 135
Right 906178956 1:43801528-43801550 CTGCACGTCAGAATGTAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906178950 Original CRISPR GTGCAGTCACATCCTGTTCC AGG (reversed) Intronic
904264529 1:29310722-29310744 GTGCCCTCTCCTCCTGTTCCAGG + Exonic
905868290 1:41388176-41388198 GTACAGTCACACCCTGATGCTGG + Intergenic
906178950 1:43801489-43801511 GTGCAGTCACATCCTGTTCCAGG - Intronic
907625389 1:56024356-56024378 ATCCAGTCACCTCCTGTTGCAGG - Intergenic
909288711 1:73854746-73854768 GTGCAGGCAGATCCAGTGCCTGG - Intergenic
913188809 1:116395697-116395719 GTGCACTAATATCCTGTTGCTGG + Intronic
916433913 1:164759293-164759315 CTGCAGTCACAGCATGTTACTGG - Intronic
921975655 1:221200189-221200211 GGGCAGTCACTTCTTCTTCCAGG + Intergenic
1063473776 10:6310246-6310268 GTCCAGAAACATCCTGTCCCTGG + Intergenic
1064058561 10:12118283-12118305 GTTCAGTCACAGGCTATTCCTGG - Intronic
1064442344 10:15364996-15365018 GTAAAGTCACATACGGTTCCAGG + Intronic
1069906415 10:71735111-71735133 CTGCAGTCACATCTGCTTCCAGG - Intronic
1075622617 10:123939032-123939054 GAGCAGACACATTATGTTCCTGG + Intronic
1078181703 11:9017074-9017096 GTGCAGCCACTGCCTTTTCCAGG + Intergenic
1078324677 11:10369833-10369855 GTGCAATCCTATCATGTTCCTGG - Intronic
1082764429 11:57155975-57155997 GCTCCATCACATCCTGTTCCCGG - Intergenic
1084012191 11:66358239-66358261 GTGCAGTCACAACTTGCTGCAGG + Intronic
1086229846 11:84555197-84555219 TTGCAGTTACATCCTCTTACAGG - Intronic
1087782432 11:102315557-102315579 ATGCAGTCTCACTCTGTTCCAGG + Intergenic
1088284739 11:108175686-108175708 GTTCATTCACATCCTGTCCTTGG - Intronic
1088982303 11:114874819-114874841 GTGCAGCCTCACTCTGTTCCAGG + Intergenic
1090733745 11:129593510-129593532 GGACAGTCACACCCTGTTGCTGG - Intergenic
1097172457 12:57124797-57124819 TTGAAGTCACATCCTGTTCCAGG + Intronic
1097350106 12:58539201-58539223 GGGCAGTCACAGCCAGTTCCTGG + Intergenic
1102187172 12:110957814-110957836 GGGAAGTGACATCCTCTTCCAGG + Intergenic
1104232732 12:126900797-126900819 GTGCTCACACAACCTGTTCCGGG + Intergenic
1105247888 13:18668704-18668726 GTCCAGAAACATCCTGTCCCTGG + Intergenic
1109044310 13:57388806-57388828 GTTCAGTAACAACCTGTACCTGG - Intergenic
1119348390 14:73944590-73944612 GTGCAGGCACAGGCTGTGCCCGG + Exonic
1120379489 14:83756845-83756867 ATGCCGTCACATCCTGTTGATGG - Intergenic
1121560805 14:94873864-94873886 GTGCAGTAGCTTCCTGTTACTGG - Intergenic
1122208997 14:100162815-100162837 GTGGAGGCCCATCCTGCTCCTGG - Intergenic
1124338107 15:28872445-28872467 GTGCTGGCACATCCAGTGCCTGG - Intergenic
1126255737 15:46623173-46623195 GTGGACTCACATCCTGTTTTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127498595 15:59535435-59535457 GTGCAGTCACTTCCGTTTGCTGG + Intergenic
1128671544 15:69577774-69577796 GTGCTGTCACCTCCAGTCCCTGG + Intergenic
1128807084 15:70539101-70539123 GTGCAGGCACAGCTTGTTGCTGG + Intergenic
1129396375 15:75250790-75250812 GTGCAGTGACATCATGATCTCGG + Intergenic
1129471695 15:75759043-75759065 GTGCAGTGACATCATGATCTCGG - Intergenic
1129867170 15:78918109-78918131 GTGCAGTCCTCTCCTGTGCCAGG - Intergenic
1133211985 16:4268435-4268457 CAGGAGTCACATCCTGTTCATGG + Intronic
1133282861 16:4677027-4677049 TTGCAGTCACGTCCTGTCTCGGG + Intronic
1135675830 16:24414133-24414155 GTGCAGTCACATCCACACCCAGG + Intergenic
1138094423 16:54200899-54200921 CTGCAGTCACATCCTGGCTCTGG + Intergenic
1203012099 16_KI270728v1_random:304166-304188 GTTCAGTCTCATCTTCTTCCTGG - Intergenic
1203030434 16_KI270728v1_random:577325-577347 GTTCAGTCTCATCTTCTTCCTGG - Intergenic
1203041287 16_KI270728v1_random:757106-757128 GTTCAGTCTCATCTTCTTCCTGG + Intergenic
1142894872 17:2967653-2967675 GGGCAGTCACATCATGTACTTGG + Intronic
1143783051 17:9239529-9239551 GTGCAGTCACTTCCTGGGGCTGG + Intronic
1147498309 17:40938271-40938293 GCGCAGCCACCTCCTGTGCCTGG + Intergenic
1148472169 17:47901649-47901671 GTGCAGTCCAGTCCTGCTCCTGG - Intronic
1153011641 18:545211-545233 GTTCAGGCCCATCCTGTTCAAGG + Intergenic
1154440961 18:14390430-14390452 GTCCAGAAACATCCTGTCCCTGG - Intergenic
1155318424 18:24594931-24594953 GTGAAGGCACAATCTGTTCCAGG - Intergenic
1159983128 18:74810457-74810479 ATACAGTCATATCCTGTTCTTGG + Intronic
1164642892 19:29839413-29839435 GTGCAGCCACCGCCTGTTCTGGG - Intergenic
1164914154 19:32037086-32037108 GTGCTGACAGAACCTGTTCCAGG - Intergenic
1165656067 19:37533298-37533320 GTGCCTTCATAACCTGTTCCGGG - Exonic
1167980843 19:53273508-53273530 CTGCAGTCACATTCTGTACCTGG - Intergenic
1168521599 19:57055533-57055555 GTGCTGGCAAATTCTGTTCCTGG + Intergenic
925446258 2:3929460-3929482 GTGTAGCCACTTCCTGTTCAAGG - Intergenic
925811961 2:7709821-7709843 GTGCTGGCAGATTCTGTTCCTGG - Intergenic
926289270 2:11515738-11515760 ATGCTGTCACCTCCTGTTCCCGG - Intergenic
928590958 2:32814730-32814752 GTACAGTCACATGCTGTACAGGG + Intronic
929127547 2:38535345-38535367 GTGCAGTCGCCTCCTGTCACAGG - Intergenic
937147137 2:119657027-119657049 TTGCAGTGACCTCCTGCTCCAGG - Intronic
940366941 2:152858838-152858860 GTCAAGTCACATCCTGCTCATGG + Intergenic
944818159 2:203400902-203400924 CTGCAGTCATATCCTCTTCCAGG - Intronic
945126651 2:206519166-206519188 GTGCTGTCATATCCTGTCACAGG - Intronic
947138213 2:226995974-226995996 AGGCAGCCACATCCTGTTCCTGG - Exonic
948757716 2:240168975-240168997 GTGGAGTCACAGCCCGTCCCGGG - Intergenic
1169171170 20:3466936-3466958 ATGCACTCAGATCCTGTTTCAGG + Intergenic
1169446694 20:5677653-5677675 CAGCTGTCACATCCTCTTCCTGG - Intergenic
1170427223 20:16247029-16247051 GGCCAGTAACAGCCTGTTCCGGG - Intergenic
1170468540 20:16645177-16645199 TTGCACTAACATTCTGTTCCTGG + Intergenic
1171573949 20:26281252-26281274 GTGAAGACACATCCTTTTTCAGG - Intergenic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1172185582 20:33029156-33029178 GGGCAGCCACATCCTGCCCCTGG + Intergenic
1173934920 20:46852826-46852848 GGCCAGGCACATCCTGTGCCAGG + Intergenic
1174066107 20:47867290-47867312 GTGCAGCCACAGCCTTTCCCCGG + Intergenic
1178263794 21:31124216-31124238 TTGCAGACACATCCTCTTTCTGG - Intronic
1178270469 21:31184593-31184615 TTTCAGTCACATCCTGTTTTAGG - Intronic
950690514 3:14652240-14652262 ATGCAGACATATCCTCTTCCTGG + Intronic
951353248 3:21631866-21631888 ATGCAATCTCATCATGTTCCTGG + Intronic
952409184 3:33032215-33032237 GTGCAGTCTCAACCTCTCCCTGG + Intronic
952801640 3:37298056-37298078 GTGTAGTAACAGACTGTTCCTGG + Intronic
953015253 3:39069005-39069027 GTGCAGTGGCATCATGATCCTGG + Intronic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
955822598 3:62911987-62912009 GTGCAGTCACAAGCTCATCCAGG - Intergenic
957380465 3:79421503-79421525 GTGCTGTCAGCTCCTGTGCCTGG - Intronic
965001870 3:162964388-162964410 GTGCATTCACATCCTGCTTGAGG + Intergenic
967867621 3:194203580-194203602 GAGCTGTCACTTCCTCTTCCAGG + Intergenic
968466217 4:752703-752725 GTGCAGCCTCCTCCGGTTCCAGG + Intronic
969948420 4:10808142-10808164 CTGCAGTCACGTCCTGTCCAGGG - Intergenic
972280878 4:37601165-37601187 TTGCAGTTACATCTTGTACCTGG + Intronic
973641390 4:52906181-52906203 GTGCAGTCAGACCCTGTACAGGG - Intronic
974085432 4:57255685-57255707 GTAAGGCCACATCCTGTTCCTGG + Intergenic
978939565 4:114420300-114420322 GAGCAGTCACATCCTGGTAAGGG + Intergenic
984428178 4:179614580-179614602 GTGCTGGCAGATCCAGTTCCTGG - Intergenic
989167025 5:38442081-38442103 CTTGAGTCACATCATGTTCCAGG + Intronic
994701284 5:103138867-103138889 GTTCAAACACATGCTGTTCCAGG - Intronic
996714843 5:126578969-126578991 GTGCTGGCACAGCCTCTTCCTGG + Intronic
996763092 5:127005503-127005525 GGGCATTCACATCCTCATCCAGG + Intronic
997482435 5:134197138-134197160 GTGCAGTCACATCGTCTTACAGG + Exonic
998366084 5:141632658-141632680 GTTCAGTCACATGCTGTTTGGGG - Intronic
1002161098 5:177314536-177314558 GCCCCGTCCCATCCTGTTCCTGG - Intergenic
1003031081 6:2601058-2601080 GTGCTGACAGATCCTGTACCTGG - Intergenic
1003501446 6:6706396-6706418 GTGCAGTCACTTACTGGCCCTGG + Intergenic
1007107401 6:39293274-39293296 TTGCAGCCAGATCCTGTCCCAGG + Intergenic
1016810756 6:148259156-148259178 GTGGGGGCACCTCCTGTTCCAGG + Intergenic
1017036080 6:150268536-150268558 GTACAGACACATCCAGTTACTGG + Intergenic
1019650381 7:2154233-2154255 GTGCAGTTTCTTTCTGTTCCTGG - Intronic
1020256622 7:6506038-6506060 CTGCAGTCTCCTCCTGCTCCGGG - Intronic
1023726591 7:43148402-43148424 ATGCAGGCACATCCTCTTCCAGG - Intronic
1024224324 7:47314193-47314215 GTGCAGTCACTTCCAGTGACTGG + Intronic
1024980312 7:55152689-55152711 GTGCAGCCCCAGCCTGCTCCAGG - Intronic
1025529036 7:61853577-61853599 GTTCAGTCTCATCTTCTTCCTGG + Intergenic
1030232578 7:107223667-107223689 AAGCATTCAAATCCTGTTCCGGG + Intronic
1033973594 7:147072509-147072531 CTGCAGTCATATCCTGTGACAGG - Intronic
1037199002 8:16226902-16226924 GTGCAGTCACATAGTATTACTGG + Intronic
1037560211 8:20066685-20066707 GTACATTCACATGCTGTTACAGG - Intergenic
1038352213 8:26787007-26787029 ATACAGTCACATCATGTTCTTGG - Intronic
1040038988 8:42897286-42897308 GTGCCGTCACATCCGGGGCCTGG + Intronic
1043526919 8:81107250-81107272 GTGCTGTCAATTCCTGCTCCTGG + Intronic
1043833286 8:85015976-85015998 GTGCACTCAGCTCCTGTCCCTGG + Intergenic
1045224010 8:100226998-100227020 GTACAGTAACATGCTGTTACAGG + Intronic
1048133526 8:131723146-131723168 GTGTTATCACAACCTGTTCCTGG - Intergenic
1048961778 8:139585625-139585647 GTGCAAACTCATCCTCTTCCTGG + Intergenic
1050815192 9:9802135-9802157 GTGCAGACACAGTCTGGTCCAGG + Intronic
1051869762 9:21724483-21724505 GTCCAGTCACACCCTTTTCTTGG + Intergenic
1053668448 9:40335233-40335255 CTGCAGTAATATCCTGTTCTAGG + Intergenic
1053918248 9:42961530-42961552 CTGCAGTAATATCCTGTTCTAGG + Intergenic
1054379588 9:64475285-64475307 CTGCAGTAATATCCTGTTCTAGG + Intergenic
1054876419 9:70101618-70101640 GTACAGTAACATACTGTTACAGG + Intronic
1057049413 9:91911352-91911374 GTACAGTCACATGCTGTACAGGG - Intronic
1061411525 9:130424709-130424731 GGGCAGCCACCTCCTGTTCAAGG - Intronic
1061557922 9:131383342-131383364 GTGCAGTCATGAGCTGTTCCAGG - Intergenic
1062425221 9:136503142-136503164 CTGCAGGCAGAGCCTGTTCCCGG + Intronic
1062477964 9:136738743-136738765 CAGAAGTCACATCCTGTTCTGGG + Intronic
1189081542 X:37978113-37978135 GTCCATTCTCATCCTTTTCCAGG - Intronic
1198513803 X:137383308-137383330 GTGCAGTAACATGCTGTCCTAGG - Intergenic
1199897576 X:152138577-152138599 GTGGCGTCACATCCGGTCCCCGG + Exonic
1200048354 X:153414705-153414727 GTGCAGTCACCACCTCTACCTGG + Intergenic