ID: 906179403

View in Genome Browser
Species Human (GRCh38)
Location 1:43805387-43805409
Sequence GTTCCCTGAAGGAAACCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906179395_906179403 20 Left 906179395 1:43805344-43805366 CCCATCGACAGTCTCACCACTTG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG 0: 1
1: 1
2: 2
3: 13
4: 161
906179399_906179403 4 Left 906179399 1:43805360-43805382 CCACTTGCCTGCAATGGGAGAAG 0: 1
1: 0
2: 2
3: 14
4: 176
Right 906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG 0: 1
1: 1
2: 2
3: 13
4: 161
906179400_906179403 -3 Left 906179400 1:43805367-43805389 CCTGCAATGGGAGAAGAGCAGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG 0: 1
1: 1
2: 2
3: 13
4: 161
906179396_906179403 19 Left 906179396 1:43805345-43805367 CCATCGACAGTCTCACCACTTGC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG 0: 1
1: 1
2: 2
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906179403 Original CRISPR GTTCCCTGAAGGAAACCCAA GGG Intronic
906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG + Intronic
906242659 1:44251531-44251553 GTCCCCTGTAGGCAATCCAAAGG - Intronic
907241779 1:53085007-53085029 GTTCCCTGGAGAAGACACAAGGG + Exonic
907865805 1:58397995-58398017 GTGACCTGAAGGAAATCCAAGGG - Intronic
911366023 1:96938339-96938361 GTTCCCAAACAGAAACCCAAAGG + Intergenic
912454873 1:109790705-109790727 GTTACCTGAAGGAGGCCCCACGG - Intergenic
920169864 1:204065287-204065309 GATCCCTGGCAGAAACCCAAAGG + Intergenic
923295301 1:232589090-232589112 GTTCCCTCAAGGAAACACAGGGG + Intergenic
924032702 1:239902714-239902736 GTTCTTAGAAGGAAACCCAAGGG + Intronic
1063200328 10:3781259-3781281 GTTTCCTAAATGAAACTCAAGGG - Intronic
1065799576 10:29339510-29339532 GTCCCTTGAAGGAAACTCCAGGG - Intergenic
1069121402 10:64574077-64574099 GTTCCCTGCAGTAAACACAATGG - Intergenic
1069273212 10:66556870-66556892 GCTCCCAGCAGGAAAACCAATGG + Intronic
1069919824 10:71809802-71809824 GCTCCCTGCAGGAAGCCCAAAGG - Exonic
1075386226 10:122057346-122057368 GTGGCCAGAAGGAATCCCAAGGG + Intronic
1077252800 11:1568017-1568039 GTGCCCCGTAGGATACCCAAGGG + Intronic
1079219515 11:18547732-18547754 GTTCCTTGAAAGAAACTCAGAGG + Intronic
1083600476 11:63944398-63944420 GTCCCCAGAAGGCATCCCAAAGG - Intronic
1083891113 11:65596226-65596248 GTTCCATGAAGGAAACACCCTGG + Intronic
1087095202 11:94311509-94311531 GTTCCCTGAACCAAACACATAGG - Intergenic
1087138480 11:94743056-94743078 GATCCCAGAAGGGAACCCCATGG - Intronic
1087835146 11:102866270-102866292 CTTCCTTGAAGTAAACTCAATGG + Intronic
1088842359 11:113637809-113637831 GCTCCCTGCAGGGAACCCAGTGG + Intergenic
1089147175 11:116337587-116337609 GTTGCCTGAGAGAAACCCCATGG - Intergenic
1089698868 11:120232223-120232245 GATGCCTGAAGAAAACCCACAGG - Intergenic
1091360877 11:134977737-134977759 GTGCCATGGAGGAAGCCCAATGG + Intergenic
1096112774 12:49039184-49039206 GTTCCCTGGGGGTAAACCAAGGG - Intronic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1099681436 12:85834509-85834531 CTTCCCTGAGGGAAACTCAGGGG + Intronic
1100224360 12:92541170-92541192 GTCTCCTGAAGCAAACTCAAGGG - Intergenic
1102893422 12:116579707-116579729 GTTCCCTGAAGCCACCACAACGG + Intergenic
1102937472 12:116910006-116910028 ATTTCCAGAAGGAAATCCAAGGG - Intergenic
1103523194 12:121549783-121549805 GATCCCAGAAGGAAAGCCGATGG - Intronic
1105498724 13:20953105-20953127 GTTTCCTGAAGGAATGCAAAAGG + Intergenic
1110451617 13:75642890-75642912 CCTCACTGGAGGAAACCCAATGG - Intronic
1111684576 13:91486438-91486460 GACCCCTAAAGAAAACCCAATGG - Intronic
1114718126 14:24850262-24850284 GTATGCTAAAGGAAACCCAATGG - Intronic
1117746268 14:58872672-58872694 GTTTCCTGAAGGAAACCCAAAGG - Intergenic
1121288425 14:92754719-92754741 ATCCCCTGAAGGAGGCCCAAGGG - Intergenic
1122397274 14:101442240-101442262 GTTACCTGTTGAAAACCCAAGGG - Intergenic
1124555227 15:30719165-30719187 TTTCCCAGGAGCAAACCCAAAGG + Intronic
1124676027 15:31686516-31686538 TTTCCCAGGAGCAAACCCAAAGG - Intronic
1126324908 15:47465903-47465925 GTTCCCTGGAGGAAACCAATAGG - Intronic
1128283632 15:66417887-66417909 GTGCCCAGAAGCACACCCAAGGG - Intronic
1128924848 15:71645668-71645690 TTTCCCCAAAGCAAACCCAAGGG - Intronic
1129695685 15:77739513-77739535 GTTCCATCAAGGCATCCCAAGGG - Intronic
1132994992 16:2818146-2818168 GTTCCCTCCAGGAGACCCAAAGG - Intronic
1133293845 16:4740401-4740423 CTGCCATGAAGGAGACCCAAAGG + Exonic
1133880418 16:9776624-9776646 GTTCCCTGTAGGAAACCACCAGG - Intronic
1135350222 16:21723057-21723079 GGTTCCTGAAGAAAACCCAGTGG - Intronic
1139350407 16:66331443-66331465 CTTTCCTGAAAGAGACCCAAAGG - Intergenic
1139400071 16:66674313-66674335 GAGTCCTGCAGGAAACCCAAAGG + Intronic
1145177670 17:20715342-20715364 GTTCCAGGAAGTTAACCCAATGG - Intergenic
1146489176 17:33267844-33267866 GTTCCCTCAAGGAAACACCAGGG - Intronic
1148551506 17:48553090-48553112 CTAGCCTGAAGGAAAACCAAAGG + Exonic
1150576200 17:66433227-66433249 GTGCCCTGGAGGAAACCCCAGGG + Intronic
1151077291 17:71288187-71288209 CTTCCCAGAAGGAAATACAAAGG + Intergenic
1153720374 18:7895585-7895607 GGTCCCTGAATACAACCCAAGGG - Intronic
1153737328 18:8084299-8084321 GTTCCCTGGAGGTATCCGAATGG + Intronic
1156283999 18:35672624-35672646 GTTTCCTGAAGGAAACTGGAGGG + Intronic
1157609379 18:48946828-48946850 TGTCTCTGCAGGAAACCCAAGGG + Intronic
1158162123 18:54496904-54496926 GGTTACTGTAGGAAACCCAATGG + Intergenic
1163373187 19:16914065-16914087 GTTCCCTGAAGCCAACCCTTGGG + Intronic
1166956770 19:46470251-46470273 GTGCCCTGGAAAAAACCCAAAGG - Exonic
1166976505 19:46608101-46608123 CTTCCCTGGAGGAAGGCCAAGGG - Intronic
1167248119 19:48386051-48386073 GTTCCCTAAGGGCAACCCCAGGG - Intronic
925156357 2:1651461-1651483 CTTCTCTGCAGGAAACCCTAAGG + Intronic
926630066 2:15128084-15128106 CATCCCTGGAGGAAACCCAAGGG + Intergenic
928178272 2:29049840-29049862 GTTCCCTGCAAGAGCCCCAAGGG + Intronic
929092755 2:38235932-38235954 GTACCCTCATTGAAACCCAAGGG - Intergenic
930068336 2:47345049-47345071 GGTCCCTGCAGGAAGCCCAGGGG + Intergenic
930970342 2:57387022-57387044 GTTCTTTCAAGGAAACTCAATGG + Intergenic
932818676 2:74881537-74881559 GCTCCCTGAAGGAAGCTGAAGGG - Intronic
935117259 2:100147189-100147211 CTTCCCTCCAGGAAAGCCAAAGG - Intergenic
936008714 2:108911165-108911187 GTTCCCTGAAAGCATCCCAGGGG - Intronic
937433446 2:121860414-121860436 GCTGCCTCAAGGAAACCCACAGG + Intergenic
938748459 2:134304492-134304514 ATTCCCAGTAGGAAACACAAAGG - Intronic
939147251 2:138430591-138430613 GTTCAGAGAAGGAAACCTAAAGG - Intergenic
940187021 2:150997038-150997060 TCTTCCTGAATGAAACCCAATGG + Intergenic
941838247 2:170050046-170050068 ATTGCCTGAAGTATACCCAAAGG + Intronic
942551503 2:177124476-177124498 ATTCCCTCCAGGAAACCAAAGGG - Intergenic
943165157 2:184313111-184313133 GTACCCAGAAGCAAAGCCAAAGG - Intergenic
943241522 2:185390328-185390350 GTTCCCTGAAGGACATGCAGAGG - Intergenic
946181494 2:217951719-217951741 GTTCCCTGAAGCAAAACCAAGGG - Intronic
946611758 2:221465981-221466003 GTTTCCGGGAGGGAACCCAAAGG - Intronic
946726754 2:222669275-222669297 GTGCCCTGAAGGAAACACATAGG - Intergenic
947373575 2:229473062-229473084 GGTCCTTGAAGGAAACAAAATGG + Intronic
947597884 2:231425508-231425530 GTTCCCAGAAGGGGAGCCAAAGG + Intergenic
948112944 2:235471589-235471611 GCTCCCTGGAGGAATCCCTATGG - Intergenic
948617973 2:239213673-239213695 GTTCCCAGGAGAAAAACCAAGGG + Intronic
949020701 2:241739610-241739632 GTCGTCTCAAGGAAACCCAAAGG + Intronic
1170344749 20:15372491-15372513 ATTCACAGAAAGAAACCCAATGG - Intronic
1171340442 20:24422920-24422942 CTGCCCTGATGGGAACCCAAGGG - Intergenic
1172533671 20:35653615-35653637 GTTCCTAGAAGGAATCCCAGTGG - Exonic
1172982752 20:38956763-38956785 GTTACATGAAGGAAACCCAAGGG + Intergenic
1173375902 20:42483024-42483046 GTGTTCTGAAGGAAACACAAGGG + Intronic
1174201489 20:48809395-48809417 GTTCCCAGAAGGAAGCCCCCAGG - Intronic
1174802896 20:53579977-53579999 GTTCCCTGAAAGAAATGAAAAGG - Intronic
1176158103 20:63633180-63633202 CTTCCCATAAGGAAACCAAATGG - Intergenic
1178523052 21:33302395-33302417 GTTGCCTGAAGTTAACGCAAGGG - Intergenic
1179201261 21:39223774-39223796 TTTCCTTGAAGGAAGACCAAGGG + Intronic
1179420034 21:41228105-41228127 ATTCCCTGAAGTAAATGCAAAGG + Intronic
1180062886 21:45394593-45394615 GTTCCCTCAGTGAAGCCCAAGGG - Intergenic
1181894178 22:26092602-26092624 GTTTCCTGAAGGATGACCAAGGG - Intergenic
1183315975 22:37136994-37137016 GTTCCATCAAGAAAACCCAACGG - Intronic
1184026063 22:41857454-41857476 GAATCATGAAGGAAACCCAAAGG - Intronic
949224309 3:1675064-1675086 TTTCTCTTAAGGAAACCCCAAGG + Intergenic
953704508 3:45220936-45220958 GGTCCCTGAAGGATTCCAAAGGG + Intergenic
957342867 3:78923303-78923325 ATTTCATGAAGGAAACTCAATGG + Intronic
959494282 3:107031015-107031037 GTACCCAGAAGCAAAGCCAATGG + Intergenic
960632308 3:119744438-119744460 GTTCCATGAAGGAAACAAATAGG + Intronic
962772285 3:138623751-138623773 GTTCCATGAAAGAAAGCCTAGGG - Intronic
964452921 3:156829356-156829378 GTTGCCTGAAGAAATCCAAAAGG + Exonic
964931614 3:162031548-162031570 GTCCAATGGAGGAAACCCAAAGG - Intergenic
967344876 3:188443862-188443884 GTTCCCTGGAGGAAAGCTAAGGG - Intronic
971515136 4:27476161-27476183 TTTCCCTGCTGGAAACACAAGGG - Intergenic
971573620 4:28245995-28246017 CTTCCCTCTAGGAAACCCACAGG + Intergenic
977554751 4:98477377-98477399 GTCCCCTGGAGGAAGCCCACAGG + Intronic
978189628 4:105896235-105896257 CTTCCCTCAAGAAAACCAAATGG - Intronic
981870869 4:149484852-149484874 GTACCCTACAGGAAACACAAAGG - Intergenic
982250609 4:153402680-153402702 GTTCCCTGGAGGACACCAATAGG + Intronic
982663858 4:158236810-158236832 GTTCCTTGAAGTTAACACAAAGG - Intronic
982688545 4:158522509-158522531 GTTCCTTGAAAGAAAAACAAGGG + Intronic
984011455 4:174376485-174376507 GTTGCCTGAAGAAATCCTAATGG + Intergenic
984183636 4:176515390-176515412 GTTGCCTCAAGGAAACCCTGGGG + Intergenic
984754851 4:183315409-183315431 GTTCCCTGAAGGGAACTTACGGG + Intronic
985673453 5:1218280-1218302 GTTCCCTGCAGGGAGCCCCACGG + Intronic
986286363 5:6362007-6362029 GGGCCATGAAGGAAAACCAAGGG + Intergenic
987416618 5:17669323-17669345 GTTCACAGATGAAAACCCAAGGG - Intergenic
988629906 5:32917752-32917774 GTTCCCTGGAGATAACTCAAGGG + Intergenic
993498352 5:88633824-88633846 TTTGCCTGAAGGTATCCCAAAGG + Intergenic
999241570 5:150130814-150130836 GTACCCAGAAGGGAACCCATCGG - Intronic
999401425 5:151267278-151267300 GTTCCCTGCGGGAAAGCCAGTGG - Exonic
1001041334 5:168337741-168337763 GTTCCATGAAGGAAATAAAATGG + Intronic
1001950763 5:175814979-175815001 GTTCCCACAAGGAAAATCAAAGG + Intronic
1002094589 5:176823506-176823528 GTGCCCTAAAGGAAACCGGATGG - Intronic
1003194282 6:3901418-3901440 GATCCCTGAAGGAGACACAGAGG - Intergenic
1003665993 6:8111848-8111870 GTTTCCTGCAGGAAACCTGATGG + Intergenic
1004916241 6:20334672-20334694 GCTCCCTAAAAGAAACTCAAGGG + Intergenic
1013810065 6:114034754-114034776 GGTCCCTGAAGCAAACAAAAAGG - Intergenic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1016987354 6:149905383-149905405 GCACCCTGAAGGAGACCCAGGGG + Intergenic
1017292116 6:152750482-152750504 ATTTTCTGAAGGAATCCCAATGG + Intergenic
1018346721 6:162906726-162906748 GTTCCCTAAAGAAATCCCACAGG - Intronic
1018883398 6:167908141-167908163 GATCTTTGAAGGAAACACAATGG - Intronic
1018964001 6:168469244-168469266 GCTCCCTGAAGGAAACCTGTTGG + Intronic
1022350967 7:29565922-29565944 TTCCCCTGAAGGAAAGGCAAAGG + Intronic
1023122467 7:36923667-36923689 GTTCCCTGAATGAAATTGAATGG - Intronic
1025759532 7:64377261-64377283 CATCCCTGAAGCCAACCCAAAGG + Intergenic
1026193102 7:68147606-68147628 GATCCCTGGAGAAGACCCAAGGG - Intergenic
1028926231 7:96359248-96359270 CTGCCCTAAAGGAAACCTAAAGG - Intergenic
1030246618 7:107389941-107389963 GTTCCCTTAAGGAAAACATATGG - Intronic
1032446421 7:131987711-131987733 GGTAGATGAAGGAAACCCAAGGG + Intergenic
1035488556 7:159252115-159252137 GTAGGCTGCAGGAAACCCAAAGG - Intergenic
1035812761 8:2506251-2506273 CTTCCCTGAAGGAGACCGCACGG + Intergenic
1036550473 8:9810980-9811002 GTTCCCATAAGGAAACCATATGG - Intergenic
1042007973 8:64204029-64204051 GTGCCTTGAGGGAATCCCAAAGG - Intergenic
1043807545 8:84691237-84691259 CTCTCCTGAAGGAAAGCCAAAGG + Intronic
1044083628 8:87916125-87916147 GTTCACTGAGGGAAACAAAATGG + Intergenic
1044524168 8:93232786-93232808 GTTCTCTGCAGGAAACCACAGGG + Intergenic
1045643053 8:104272991-104273013 TTTCCCTGGAGGGATCCCAAAGG + Intergenic
1050095748 9:2064102-2064124 GTACCCTGTAGGAAACCTCAAGG - Intronic
1053122497 9:35557435-35557457 GTTCTCTGAAGCAGAACCAAGGG + Intronic
1055326382 9:75135065-75135087 GTTCCCTGGAGGACAGCAAAGGG - Intronic
1056297242 9:85205418-85205440 GTCCACTGAAGGAAAGCAAAAGG - Intergenic
1059344074 9:113616447-113616469 GTTCCTGGAAGGAACTCCAAGGG + Intergenic
1059357952 9:113715838-113715860 GTACCCAGAAGGAAATCAAAGGG + Intergenic
1060909512 9:127338342-127338364 GTTCCATGAAGGAGACCTAGGGG + Intronic
1061906290 9:133701001-133701023 GTTCCCTTGTGGAAACTCAAAGG - Intronic
1188933870 X:36149508-36149530 GTTTCCTGCAGGAAACAGAATGG - Intergenic
1191882943 X:65860487-65860509 ATTCCCTGAAGGCATCCCCAAGG + Intergenic
1194339648 X:92692959-92692981 ATTCACAGAAAGAAACCCAAAGG - Intergenic
1196587955 X:117451871-117451893 GTTCTCTGAAAGATATCCAAAGG - Intergenic
1197413805 X:126150558-126150580 TTTCCCTGAGGGAAACCCCTAGG - Intergenic
1198427407 X:136533688-136533710 GTTATCTGAAGGAAACCAGATGG + Intronic
1198834788 X:140793654-140793676 GTTCCCTGATGGAAAACTATTGG - Intergenic
1200448549 Y:3295753-3295775 CATCACTGAAGGAAATCCAAGGG - Intergenic
1200648032 Y:5809738-5809760 ATTCACAGAAAGAAACCCAAAGG - Intergenic