ID: 906180312

View in Genome Browser
Species Human (GRCh38)
Location 1:43812271-43812293
Sequence GCGGGGCCTGCGTTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906180305_906180312 27 Left 906180305 1:43812221-43812243 CCTTAAAAATCCAGATTCCTGGC 0: 1
1: 3
2: 3
3: 42
4: 278
Right 906180312 1:43812271-43812293 GCGGGGCCTGCGTTGCTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 199
906180307_906180312 10 Left 906180307 1:43812238-43812260 CCTGGCTTGAAAAAAATCTGAAG 0: 1
1: 0
2: 1
3: 21
4: 268
Right 906180312 1:43812271-43812293 GCGGGGCCTGCGTTGCTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 199
906180306_906180312 17 Left 906180306 1:43812231-43812253 CCAGATTCCTGGCTTGAAAAAAA 0: 1
1: 0
2: 6
3: 22
4: 364
Right 906180312 1:43812271-43812293 GCGGGGCCTGCGTTGCTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906180312 Original CRISPR GCGGGGCCTGCGTTGCTGCC TGG Intronic