ID: 906182416

View in Genome Browser
Species Human (GRCh38)
Location 1:43833699-43833721
Sequence AATGAGAGGCAGAAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1254
Summary {0: 1, 1: 0, 2: 10, 3: 108, 4: 1135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906182409_906182416 23 Left 906182409 1:43833653-43833675 CCAAGCAGAGTGACTCTATTGTC 0: 1
1: 0
2: 1
3: 6
4: 99
Right 906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG 0: 1
1: 0
2: 10
3: 108
4: 1135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906182416 Original CRISPR AATGAGAGGCAGAAAGGGGA AGG Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900646973 1:3713384-3713406 AAAGAGAGGCCCACAGGGGAGGG + Intronic
900799835 1:4730446-4730468 AATGAGAGGGATCAAGAGGAAGG - Intronic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
900883513 1:5399357-5399379 AATGAGTGGAAGGATGGGGATGG + Intergenic
900918531 1:5656013-5656035 AAAGAGAGAGAGAAAGGAGAAGG + Intergenic
901089075 1:6629549-6629571 ACTGAGGGGCAGGAAGGGGTCGG - Intronic
901154256 1:7124903-7124925 AGTGGGAGTCAGGAAGGGGAAGG + Intronic
901193153 1:7424643-7424665 ACTGAGAGGAAGGAAGGAGAGGG - Intronic
901315483 1:8304779-8304801 AATGTGAGGGAGAAAGTCGAGGG + Intergenic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901781890 1:11599587-11599609 AATGAGGTCCAGAGAGGGGAAGG - Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902206096 1:14869173-14869195 CAAGACAGGCAGGAAGGGGATGG - Intronic
902301011 1:15502783-15502805 AATGAAAGACAGAAAGGGCAGGG - Intronic
902456814 1:16539333-16539355 AATGAGAGTCAGGAAGATGAGGG + Intergenic
902495355 1:16868580-16868602 AATGAGAGTCAGGAAGATGAGGG - Intronic
902801459 1:18832686-18832708 AAGGAGAGAGAGAAAAGGGAAGG - Intergenic
902967469 1:20018338-20018360 TACTAGAGGCAGAAAAGGGAAGG - Intergenic
903278344 1:22235964-22235986 AATGAGGGGCAGACCTGGGAAGG + Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903407458 1:23110147-23110169 AATGAGAGCCAGCATGGTGAAGG - Intronic
903729519 1:25481673-25481695 AATGAGAGACAGTATGGTGATGG + Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904201292 1:28821055-28821077 AAAGAGAGACAGAAAAGAGATGG - Intronic
904880438 1:33692583-33692605 AATGAGATGCAGAGAGGATAAGG + Intronic
905287936 1:36896563-36896585 CATGAAAGGCAGAAAAGGGCTGG + Intronic
905591239 1:39165949-39165971 AATGAAAGGAAGGAAGGAGATGG - Intronic
905869282 1:41394039-41394061 GCTGGGAGGCAGAAAGGTGAGGG - Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906484256 1:46222129-46222151 AAGGAGAGGGAGCAAGGGAAAGG + Intergenic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
906882571 1:49608164-49608186 AAAGAAAGGAAGAAAGGGGAAGG + Intronic
906935787 1:50212960-50212982 ACTGTGAGGCAGGAAGAGGAAGG - Intergenic
907014880 1:51002842-51002864 AGTGAGAGGAAGAGAGGGGAGGG + Intergenic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908572967 1:65428381-65428403 AAGGAGACACAGAGAGGGGAAGG - Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
909900016 1:81121810-81121832 AATTGGAGGCAGAAAGGAAAAGG - Intergenic
909946584 1:81670622-81670644 AATCAGAGGCAGTAAGGAGAGGG + Intronic
910103185 1:83600113-83600135 AAGGAGAGAAAGAAAGGGGCGGG + Intergenic
910280863 1:85500036-85500058 AGAGAGAGAAAGAAAGGGGAAGG - Intronic
910300483 1:85701342-85701364 ACTAAGAGGCTGAAAAGGGAGGG + Intronic
910329948 1:86060594-86060616 AATGAGAGATAGAAATGAGAGGG - Intronic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
912249238 1:107993644-107993666 AATGAGAGGGGGAAACTGGATGG - Intergenic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
912763549 1:112389005-112389027 GAAGAGAGGCAGTAAGGGGAGGG + Intergenic
913509312 1:119547805-119547827 AAAGAGAGGAAGAAATTGGATGG + Intergenic
913520156 1:119637983-119638005 AAAGAGAGAGAGAAAGGAGAGGG + Intronic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914716571 1:150259219-150259241 AATAAGAGACAGAGAGAGGAAGG + Intronic
914829724 1:151161812-151161834 AATCAGAGGCAGAGAGGTCATGG + Exonic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915345800 1:155196260-155196282 AAAGGGAGGCAGGAAGGAGAGGG + Intronic
915431617 1:155871346-155871368 AAGGAGAGGTAGACAAGGGAAGG - Intronic
915493854 1:156267238-156267260 TATGGGAGGCAGTAAGGAGAAGG + Intronic
915601332 1:156924718-156924740 AGTGAGAGGCACTGAGGGGATGG + Exonic
915892442 1:159784219-159784241 GAACAGAGGCAGAAAGGGCAAGG - Intergenic
916078375 1:161216633-161216655 AAATAGAGGCAGAAATGGGAAGG + Intronic
916397278 1:164404977-164404999 AATGAGAAGCAGAAAAGTGAAGG - Intergenic
916452440 1:164933959-164933981 GAGGAGAGGCAGAGAGGAGAAGG - Intergenic
917471184 1:175327267-175327289 TATATGAGGCAGAAATGGGAAGG - Intronic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
917497141 1:175550749-175550771 AATGAGAGTCAGAAAATGCAGGG + Intronic
917723712 1:177810804-177810826 AATCAGAGGAAGAGAGGGAAAGG + Intergenic
918379887 1:183943434-183943456 AATGAGAGAGAGAAAGGAGGAGG + Intronic
918586234 1:186192177-186192199 GATGACTAGCAGAAAGGGGAAGG + Intergenic
918596780 1:186303498-186303520 ACTGAGAAGCGGAAAAGGGAAGG + Intronic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
919056943 1:192583024-192583046 AGAGAGAGGGAGAAAGGGAAAGG + Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919174901 1:194007819-194007841 AAAGAGATTCAGAGAGGGGAAGG + Intergenic
919240847 1:194914361-194914383 AAGGAGAGCTGGAAAGGGGAAGG - Intergenic
919628981 1:199941218-199941240 AATGAGAGAGAGAGAGGAGAGGG + Intergenic
920170083 1:204066478-204066500 AAAGATACTCAGAAAGGGGAGGG - Intergenic
920413497 1:205781385-205781407 GAGGAGGGGAAGAAAGGGGAGGG + Intergenic
920441125 1:205980898-205980920 AAAGAAAGGAAGAAAGGGGAAGG - Intronic
920819522 1:209367355-209367377 AATTACAGGCAGAAAGGAGCTGG - Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921249374 1:213281960-213281982 AAAGAGACGGAGCAAGGGGAGGG - Intergenic
921390944 1:214612914-214612936 AATGGGGGGCAGGAAGGGGAAGG + Intronic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
921573813 1:216809999-216810021 AGAGAGAGACAGAAAGGGGGAGG + Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921774053 1:219076767-219076789 AAAGAGAGTTAGAAATGGGAAGG + Intergenic
921945529 1:220883640-220883662 CATGGGAAGCAGAAAGGGAAAGG - Intronic
922207945 1:223465382-223465404 AATGAGGAACAGAAAGGGCAAGG - Intergenic
922309403 1:224374013-224374035 AATGACAGGCTGATAGGGAAGGG - Intronic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922555895 1:226531690-226531712 AAAGCCAGGGAGAAAGGGGAGGG + Intergenic
922887076 1:229028352-229028374 AATGGAAGGGAGGAAGGGGAGGG + Intergenic
923026916 1:230211663-230211685 CTTGGGAGGCTGAAAGGGGAGGG + Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063004297 10:1953239-1953261 AATGAGCGGAAGAAAGGGAGAGG + Intergenic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064979394 10:21151039-21151061 ACTGAAAGGCAGAGACGGGAAGG + Intronic
1065953700 10:30674826-30674848 AAAGAAAGAAAGAAAGGGGAAGG + Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066382576 10:34913732-34913754 AAAGAGAGGAGGAGAGGGGAGGG + Intergenic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1067343132 10:45419928-45419950 AAAGAGAGGCCGGAAGAGGAGGG + Intronic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068075577 10:52249086-52249108 AAAGAGAGGAAGGAAGGGAAGGG - Intronic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068227794 10:54129073-54129095 AATGAGACTCAGAAATGGAAAGG - Intronic
1068590392 10:58846940-58846962 ACTGAGAGTCAGGAAGTGGAAGG + Intergenic
1068987179 10:63118227-63118249 AAAGATAGGAAGCAAGGGGAAGG - Intergenic
1068999977 10:63252079-63252101 AAATAAAGGCTGAAAGGGGATGG + Intronic
1069381845 10:67849745-67849767 AACGAGAGGCGGAAAGGGTCAGG - Intergenic
1069455717 10:68552228-68552250 AAAGAGAGAAAGGAAGGGGAGGG + Intergenic
1069518138 10:69096191-69096213 AATCAGGTTCAGAAAGGGGAAGG - Intronic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1070305950 10:75239343-75239365 AATGAGTAGCAAAAAGGGGAGGG - Intergenic
1070852768 10:79581243-79581265 AAAGAGAAACAGAAAGGGAAAGG + Intergenic
1071423514 10:85525843-85525865 AGAGAGTGGCAGAAAGGAGAGGG + Intergenic
1071478993 10:86048875-86048897 ACTGAGCTTCAGAAAGGGGAAGG - Intronic
1071617704 10:87091807-87091829 AATGAGATACAGAAAGCTGAAGG + Intronic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1071984908 10:91040578-91040600 AATGAGAGGCTGAAAGCACAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072295218 10:94002663-94002685 ATTGAGGGGAAGAAAGGAGAAGG + Intronic
1072454364 10:95562865-95562887 GATGAGGTGCAGATAGGGGAAGG - Intergenic
1072580916 10:96739722-96739744 AAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1072873060 10:99141176-99141198 AATGAGAGGGAGAATTGGGTAGG - Intronic
1073010474 10:100355243-100355265 TATGAGAGGTACAAAGGGGAGGG + Intronic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073954957 10:108859603-108859625 AAAGAGAGGCAGGAAAGGAAGGG + Intergenic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075629776 10:123994092-123994114 GAAGAGAGGCAGAGAGGAGACGG + Intergenic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077777798 11:5290983-5291005 AATGAGAGAGAGAAATGGGGAGG + Intronic
1078950301 11:16124441-16124463 AATGAAAGGCAGAAAGTTGGAGG + Intronic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079194773 11:18315855-18315877 AGTGGGAGGCAGACATGGGAAGG - Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079525865 11:21386856-21386878 AATTAGAGTCAGAATGGTGAAGG + Intronic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079827476 11:25214876-25214898 TAAGAAAGGAAGAAAGGGGAGGG - Intergenic
1079950455 11:26795748-26795770 AATAAGGGGAGGAAAGGGGAAGG + Intergenic
1080312786 11:30913573-30913595 AAAGAGAGGCAGTTAGTGGAAGG - Intronic
1080321389 11:31014234-31014256 AAAGAGAGGAAGGGAGGGGAGGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080580632 11:33640423-33640445 AATGAGAGGCAGAAGAGGTGTGG - Intronic
1080604672 11:33855138-33855160 AAGGAAAGGAAGAAAAGGGAAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080867952 11:36212289-36212311 AATGAGAGACAGCACGGGAAGGG - Intronic
1081034390 11:38124140-38124162 GAGGAGAGTTAGAAAGGGGATGG + Intergenic
1081420689 11:42872876-42872898 AATAAGAGGCTGAAAGAGGTTGG - Intergenic
1081516259 11:43833334-43833356 AATGACGGGTAGAGAGGGGAGGG - Intronic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081789956 11:45775532-45775554 GAAGGGAGGCAGAGAGGGGAGGG - Intergenic
1082002865 11:47403341-47403363 ACTGAGATGGCGAAAGGGGAAGG + Intergenic
1082194376 11:49284494-49284516 AAGGAGGGGAAGGAAGGGGAGGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1083040132 11:59677872-59677894 AAAGAGAGGGAGAAAGATGAGGG + Intergenic
1083703033 11:64492807-64492829 AATGAAGGCAAGAAAGGGGAAGG - Intergenic
1083841870 11:65309199-65309221 AAGGAGAGGCTGGGAGGGGAAGG + Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1083894801 11:65614405-65614427 CAGGAGAGGCAGAGAGGGAAAGG + Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1083913030 11:65720987-65721009 AAGGAGAGGGGGAGAGGGGAGGG - Intergenic
1084433755 11:69126179-69126201 AAAGGGAGGCAGGCAGGGGAGGG + Intergenic
1084629213 11:70334908-70334930 AATGACAGGCAGAAAGGGACAGG - Intronic
1085272888 11:75280813-75280835 AATGAGAGGCAGGGAGATGAGGG + Intronic
1085305520 11:75483450-75483472 TATGGGAGGGAGAAAGGGTAGGG - Intronic
1085751288 11:79163189-79163211 AGTGAGAGAAGGAAAGGGGAAGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085998282 11:81948929-81948951 AGAGAGAGAGAGAAAGGGGAAGG + Intergenic
1086148416 11:83580909-83580931 AATGAGGGAGGGAAAGGGGAGGG - Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086678316 11:89637344-89637366 AAGGAGGGGAAGGAAGGGGAGGG - Intergenic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1087741206 11:101889229-101889251 AAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1087913622 11:103781979-103782001 AATGAGAGGAAGCTAGGGGAGGG + Intergenic
1088373910 11:109119826-109119848 GATGAGGGGCAGAAAGAGGCCGG - Intergenic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088677486 11:112209248-112209270 GCTGAGAGGAGGAAAGGGGAAGG - Intronic
1088895110 11:114072545-114072567 ACTGACAGGCAGGAAAGGGAAGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088998082 11:115021147-115021169 AGGGAGGGGAAGAAAGGGGAAGG - Intergenic
1089113046 11:116072212-116072234 AATTAGAAGCAGACAGGGAAAGG - Intergenic
1089351517 11:117824129-117824151 AGCCAGATGCAGAAAGGGGAGGG - Intronic
1089361175 11:117887695-117887717 AAAGAGAGACAGAGAGGGCAGGG - Intergenic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1090080305 11:123608012-123608034 AATGAGAGGCACACAGAGCAAGG - Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090450913 11:126805706-126805728 AATGAAAGAAAGAAAAGGGAAGG + Intronic
1090511641 11:127381855-127381877 AGTCAGAGGCGGAAAGGGGCTGG - Intergenic
1090612433 11:128483531-128483553 AAAAAGAGCCAGAAAGGGGAAGG + Intronic
1090989813 11:131806599-131806621 AATGAGGCCCAGAAAGGAGAAGG + Intronic
1091387235 12:103178-103200 ACTGAGAGCCTGAAAGGGAAGGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091664693 12:2410904-2410926 AATGGGAGGCAGCCAGGAGAAGG - Intronic
1091755894 12:3051240-3051262 AAAGAAAGAAAGAAAGGGGAGGG - Intergenic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1091969154 12:4771467-4771489 GATGAGAGGCAGGGAGGTGATGG + Intronic
1091988381 12:4933000-4933022 TAAGAGAGGCAGAAAATGGATGG - Intergenic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092618752 12:10239512-10239534 AAAGAAAGAAAGAAAGGGGAGGG - Intergenic
1093016884 12:14163852-14163874 AGTGAGAGACCTAAAGGGGATGG - Intergenic
1093093228 12:14944140-14944162 AATGAGAGGCGGGAAGGTGATGG - Intronic
1093123062 12:15295972-15295994 GAAGAGAGAGAGAAAGGGGAGGG - Intronic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093903242 12:24660826-24660848 AAGGAGAGGGAGGAATGGGAAGG - Intergenic
1094131754 12:27082313-27082335 GACGGGAGGCAGAAAGTGGATGG + Exonic
1094179044 12:27571433-27571455 AATGAGAGGGAAAATGGGGGAGG + Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094348178 12:29494797-29494819 TATGAGAGGCAGGAAAGGGTAGG + Intronic
1094387274 12:29908926-29908948 AATGAGAGACAGAAAGAGAAAGG - Intergenic
1095171674 12:39043285-39043307 TAGGAGTGGCAGAAAGGGAAAGG - Intergenic
1095556777 12:43516054-43516076 AATGAGAGCCAGAAAACTGAAGG - Intronic
1095631179 12:44379129-44379151 AAAGAAAGGAAGAAAGAGGAGGG + Intronic
1095649732 12:44593235-44593257 ACTGAGATCCAGAAAGGAGATGG + Intronic
1095650596 12:44604268-44604290 AAGGAGTGAGAGAAAGGGGAAGG + Intronic
1096009324 12:48199610-48199632 AAGGAAAGGAAGAAAGGGAAAGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078278 12:48818200-48818222 AACGAGCGGCAGACGGGGGAGGG - Intronic
1096242743 12:49968013-49968035 GAAGAGAGGGAGGAAGGGGAAGG - Intronic
1096586152 12:52621276-52621298 AAAGAGAGAAAGAAAGGGGGGGG + Intergenic
1097616997 12:61896029-61896051 AATGAGAGAGAGAAATGAGAGGG + Intronic
1098038595 12:66332299-66332321 AATGGGAACAAGAAAGGGGAGGG - Intronic
1099059094 12:77883642-77883664 AATGAGAGAGAGAAAGAGTATGG + Intronic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100759594 12:97792582-97792604 AATAAAAGTCAGCAAGGGGATGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1101830562 12:108253340-108253362 AATGAAGGAGAGAAAGGGGAAGG - Intergenic
1101842862 12:108340513-108340535 AAAGAAAGGAAGAAAAGGGAGGG + Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101907529 12:108838927-108838949 AATAAGATGAAGTAAGGGGAAGG - Intronic
1101926193 12:108973243-108973265 ACTGAGGGCCAGAGAGGGGAGGG + Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102217909 12:111174632-111174654 ACTGAGATTCAGAAAGGGCACGG + Intronic
1102555598 12:113724646-113724668 AATAAGTGTCAGGAAGGGGAGGG + Intergenic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1103135007 12:118499453-118499475 AAGGAGAGGAAGGAAGGAGAGGG - Intergenic
1103228667 12:119309443-119309465 AAGGAAAGGAAGAAAGGGAAAGG + Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103687435 12:122743168-122743190 AATCAGAGGCTGGAAGGGAAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104070620 12:125342268-125342290 AATGTGAGGCTGTACGGGGATGG + Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104265862 12:127231966-127231988 AAGGAGAGCTGGAAAGGGGATGG - Intergenic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1105813962 13:24016648-24016670 ACTGAGAGCCAGGAAGGAGAGGG - Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106236453 13:27865191-27865213 AATGAGGGGATGGAAGGGGAAGG + Intergenic
1106401641 13:29436791-29436813 AAAGAAAGGAAGGAAGGGGATGG - Intronic
1106816118 13:33408995-33409017 AAAGAGAGGCAGAGAGAGAATGG - Intergenic
1106903645 13:34381951-34381973 AATGAGTGGCATCAAGGGGTGGG - Intergenic
1107236655 13:38178654-38178676 AGTGAGAGGGAGAGAGGGAAAGG + Intergenic
1107988968 13:45800645-45800667 AACCAGAGGCAGAAAAGGAAGGG - Intronic
1107996050 13:45862177-45862199 AAAGAGGGAGAGAAAGGGGAAGG + Intergenic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108733773 13:53261135-53261157 AAGGAGTGGCAGCAATGGGAAGG + Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1108938906 13:55924066-55924088 AATGAGATGAAGCAAGGTGAAGG - Intergenic
1109273860 13:60283043-60283065 AAGGAGAGGCAGAGAGGGAGAGG - Intergenic
1109295849 13:60529902-60529924 AGTGAGAGCAAGAAAGGGAAAGG + Intronic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1110296019 13:73866871-73866893 AATGTGGGGCAAAAAGGGGGGGG + Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110829541 13:80014551-80014573 AAGGAGAGGGAGAGAGGTGAGGG - Intergenic
1111390100 13:87582645-87582667 AAAGAGAGGAAGGAAAGGGAAGG - Intergenic
1111404674 13:87787940-87787962 AAAAACAGGCAAAAAGGGGAAGG - Intergenic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112719505 13:102227161-102227183 AATGGGAGGCAGAAAGAGATAGG - Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113677010 13:112214590-112214612 AAGGAGAGGAAGGAAGGGAAAGG + Intergenic
1113885948 13:113658471-113658493 AAGGAGAGGAGGGAAGGGGAAGG - Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1116299819 14:43164328-43164350 AATGAAAGTCAGATGGGGGAAGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116638412 14:47428665-47428687 AATGAGAGACAGAAATGATAGGG - Intronic
1116687353 14:48056897-48056919 GTTGGGAGGCAGAAAGGGAATGG - Intergenic
1116694683 14:48157712-48157734 AATTAGAGGAAGTAAGGTGAGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117517889 14:56520676-56520698 AATGTGATGCAGACAGGGCAGGG + Intronic
1117701234 14:58415752-58415774 AAGGAGAGGAAGAAAAGGGTAGG + Intronic
1118016743 14:61668528-61668550 AATGGGAGGAAGTTAGGGGATGG - Intergenic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1118767985 14:68922759-68922781 AGTGAGAGGGGGAAAGGGGCTGG - Intronic
1119131341 14:72175827-72175849 AAAGGGAGGAAGAGAGGGGAAGG + Intronic
1119399068 14:74349514-74349536 AGGGAGAGGAAGAAAAGGGAGGG + Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1119568755 14:75651223-75651245 AATAAAAGGGAAAAAGGGGAAGG + Exonic
1119800212 14:77437709-77437731 ATGGATAGGCAGGAAGGGGAGGG - Intronic
1119829825 14:77692217-77692239 TATGAGACACAGAAAGGTGAAGG + Intronic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1119913560 14:78373702-78373724 AATGCAAGGCAGAAAGGGAATGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120360171 14:83490476-83490498 AAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120601102 14:86510847-86510869 AATGTGAGGCTTAACGGGGATGG - Intergenic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121898735 14:97672922-97672944 AATGTGGGGCAGGAAGGAGATGG + Intergenic
1122053715 14:99078089-99078111 ACTGAAAGGCAGAGAGGTGAAGG - Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122647940 14:103207404-103207426 GAGGAGAGGGAGGAAGGGGAGGG - Intergenic
1202942434 14_KI270725v1_random:164859-164881 TATGAGAGGGACAAAGGGAAAGG - Intergenic
1123971688 15:25513779-25513801 AAGAAGAGTCACAAAGGGGAAGG + Intergenic
1123999432 15:25742473-25742495 GATGAAAGGCAGAAAAGGCAAGG - Intronic
1124363814 15:29057343-29057365 AATGAGTAGAAGAGAGGGGAGGG - Intronic
1124816358 15:32997836-32997858 GAAGAGAGGAAGAAAGGGAAAGG + Intronic
1124827768 15:33115702-33115724 TATGAGAGGCAGGAAGGGTGAGG - Intronic
1124899078 15:33805908-33805930 AAGGGGAGGGTGAAAGGGGAGGG - Intronic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125957341 15:43799593-43799615 AGTAAAAGGAAGAAAGGGGAAGG - Exonic
1127946138 15:63755796-63755818 AAAGAGAGGAAGAGAGAGGAGGG + Intronic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128134069 15:65249782-65249804 AATGTGGGGCAGGAAGGGGATGG - Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1129706920 15:77799619-77799641 AAAGAGAGAGAGAAAGGGCAAGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130552619 15:84900817-84900839 AAAGACAGACAGAAAGGGAAGGG + Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131266017 15:90915891-90915913 CATGAGGTCCAGAAAGGGGAAGG - Intronic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131620441 15:94062476-94062498 AGTGAGAAGTAGAAAGGGAAAGG + Intergenic
1131643064 15:94313202-94313224 AATGAGAGGCAGAGTGGAGGGGG - Intronic
1131838603 15:96414238-96414260 AATGAAAGGAAGAAAAGGAAGGG + Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132212708 15:100036212-100036234 GCAGAGAGGCAGCAAGGGGAAGG + Intronic
1132293375 15:100718564-100718586 AATGAGATGAAGAAATGGGGCGG + Intergenic
1133304454 16:4800801-4800823 AAAGAGGTGAAGAAAGGGGAAGG + Intronic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133485579 16:6215312-6215334 AGAGAGAGACAGAGAGGGGAGGG + Intronic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133936780 16:10275797-10275819 AATGAGAGACAGGAAGTGGGAGG - Intergenic
1133971551 16:10571760-10571782 ACTGAGATGAAGAGAGGGGATGG + Intronic
1134040397 16:11063971-11063993 GATTGGAGGAAGAAAGGGGAAGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1135088093 16:19490792-19490814 AAAGAGAGGGAGGGAGGGGAAGG - Intronic
1135619653 16:23944933-23944955 AATGAGGGACAGAGAGAGGAGGG + Intronic
1136176706 16:28522071-28522093 AATGAGAGAGAGAAAAGGGAGGG - Intergenic
1136279508 16:29199705-29199727 ACTCAGAGGCAGAAAGGAGGCGG - Intergenic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1136631731 16:31492921-31492943 AATGAGAGGCTGACCTGGGAGGG + Intronic
1137824111 16:51475036-51475058 GATGAGAGGAGGTAAGGGGAGGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137929780 16:52576012-52576034 AAAGAGAGGAAGAGAGAGGAAGG + Intergenic
1138158936 16:54735272-54735294 GATGATAGGCAGGAAGGTGAGGG + Intergenic
1138418370 16:56884329-56884351 ATTGGGAGGGATAAAGGGGAGGG - Intronic
1138755275 16:59476502-59476524 AGAGAGAGACAGAGAGGGGAGGG - Intergenic
1138802665 16:60052978-60053000 AAAGAGAGGAAGAAAGGAAAGGG - Intergenic
1139092347 16:63663513-63663535 AATAACAGGGAGAGAGGGGAGGG - Intergenic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139884095 16:70196668-70196690 GGTGAGAGCCAGGAAGGGGAAGG + Intergenic
1140329581 16:74041171-74041193 AATGATAGGTAAAAAGAGGATGG - Intergenic
1140368423 16:74398828-74398850 GGTGAGAGCCAGGAAGGGGAAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140979999 16:80099016-80099038 AACAAGAGACAGCAAGGGGAGGG - Intergenic
1141012468 16:80415740-80415762 AATGCGAATCAGGAAGGGGAGGG - Intergenic
1141199418 16:81885520-81885542 AAAGAAATGAAGAAAGGGGAAGG - Intronic
1141206110 16:81934252-81934274 AGTGAGAGGAAGAAACGAGAGGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141891796 16:86930983-86931005 GAGGAGGGGGAGAAAGGGGAGGG - Intergenic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142473414 17:176077-176099 AATGAGGCTCAGAGAGGGGAGGG + Intronic
1143462347 17:7112031-7112053 GATGAGAGAGAGAGAGGGGAGGG + Intronic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1144027186 17:11287681-11287703 AGAGAGAGAGAGAAAGGGGAAGG + Intronic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144230634 17:13199646-13199668 AAAGAAAGGAAGAAAGGGAAGGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144581255 17:16460774-16460796 GATGAGAGGGTGAAAGGCGATGG - Intronic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1144847229 17:18226180-18226202 AATGAGAGGCAGAGAGATAAAGG - Intronic
1145398870 17:22515492-22515514 AAGGAGAGGAGGGAAGGGGAGGG + Intergenic
1146126022 17:30232401-30232423 AGTGACAGACAGCAAGGGGAGGG - Intronic
1146297152 17:31659158-31659180 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297162 17:31659184-31659206 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297170 17:31659204-31659226 AGGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297198 17:31659276-31659298 GAGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297214 17:31659322-31659344 GAGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146412390 17:32597951-32597973 AATAAGAGGAAAAAAGGGCAAGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146516670 17:33495081-33495103 AATGAGAGGGAGAGAAGTGAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146627655 17:34446479-34446501 AATGGGAGCCAAACAGGGGAAGG - Intergenic
1147155942 17:38544544-38544566 AATCAGAGACAGGAAGGGGAGGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1147529613 17:41263268-41263290 AAAGAAAGAAAGAAAGGGGAGGG + Intergenic
1147604438 17:41766290-41766312 AAAGAGAGGAAGAGAGGGAAAGG + Intronic
1147610218 17:41797603-41797625 AATGAAAGGAAGAAAGGAGGAGG - Intergenic
1147615635 17:41825666-41825688 AATGAGAGGCAGAAGCCAGAGGG + Intronic
1147999327 17:44378593-44378615 TATGATAGGCAGAAAGGGCCAGG + Intronic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1149278279 17:55070661-55070683 AATGGCAGGCATGAAGGGGAAGG - Intronic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1149911333 17:60569611-60569633 GATGCGAGGGAGAAAAGGGAGGG - Intronic
1149968718 17:61194131-61194153 AAGGAAAGGCAGGGAGGGGAGGG + Intronic
1151351508 17:73534746-73534768 GATGAGAGGAAGAAAGGTCAGGG - Intronic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151429830 17:74055001-74055023 AGAGAGAGGGAGAAAGGGAAAGG - Intergenic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151942031 17:77298713-77298735 AATGAGATGCAGAAAGGCAGGGG - Intronic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152268850 17:79312013-79312035 AATGATAGTCAGGAAGGGGGAGG - Intronic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152721368 17:81925293-81925315 ACTGAGAGCCAGGAAAGGGAGGG + Intronic
1152864844 17:82716545-82716567 ATTGAGGGGCGGGAAGGGGAGGG - Intergenic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152984292 18:307861-307883 AATGAGAGGAACTGAGGGGAAGG + Intergenic
1153281122 18:3415276-3415298 AACCAGAGGCAGAAAGCTGAGGG + Intronic
1153345081 18:4016984-4017006 GATGAGGGGCTGAAAGGTGAAGG - Intronic
1153495960 18:5699993-5700015 AATGAGATGAAGGAAGGTGAAGG - Intergenic
1153506486 18:5804388-5804410 AAAGAGAGGGAGAGAGGGCAAGG - Intergenic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1155481039 18:26287919-26287941 AATGAGATGCAGAGTGGGAAGGG - Intronic
1155481727 18:26296263-26296285 AATAAAAGGCAAAAAGGAGAGGG - Intronic
1155634460 18:27936228-27936250 TATGAGAGGCAAAAAGGAAAAGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1156400644 18:36736508-36736530 AAGGAGAGCTGGAAAGGGGATGG + Intronic
1156492110 18:37502406-37502428 AGTGGGAGGGAGAAAGGAGAGGG + Intronic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157472940 18:48003627-48003649 ACTGAGAGTCAGAAAAGGCATGG - Intergenic
1157602454 18:48902331-48902353 AAGGGGATGGAGAAAGGGGAAGG - Intergenic
1157903237 18:51541242-51541264 AATGACACCCAGAAAGGAGAGGG - Intergenic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158443898 18:57502105-57502127 AAGGAGAGGAGGAAAGGAGACGG + Intergenic
1158648965 18:59269709-59269731 AGAGAGAGAGAGAAAGGGGATGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159325693 18:66913716-66913738 AATCAGAGGCAGGAAGGGCATGG + Intergenic
1160817105 19:1041258-1041280 AATGAGGTTCAGAAAGGGGCAGG + Exonic
1160951615 19:1670176-1670198 AAAGAGAGAGAGAGAGGGGAGGG - Intergenic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162104564 19:8362545-8362567 AATGAGGGAGAGAAAGAGGAAGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162829971 19:13278294-13278316 AATGAGAGGAAGTGAGGGCAGGG - Intronic
1162933572 19:13969195-13969217 AAGGAGAGGAAGAGAGGGGCGGG + Intronic
1163864899 19:19764840-19764862 AAAGAAAGGAAGGAAGGGGAGGG - Intergenic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1163982281 19:20912260-20912282 AATGAGTGGGTGAAAGGGAACGG - Intergenic
1164389607 19:27806255-27806277 AAAGAAAGAAAGAAAGGGGAAGG - Intergenic
1164650461 19:29887460-29887482 CATGAGACCCAGAAAGGGGCTGG + Intergenic
1164680412 19:30130782-30130804 AAGGAGAGGGAGGAAGGGAAGGG - Intergenic
1165016771 19:32886841-32886863 AAAGAAAGGCTGAAAGGGAAGGG - Intronic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166648137 19:44547950-44547972 ACTGAGATTAAGAAAGGGGAAGG - Intergenic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166856356 19:45784299-45784321 GATGAGAGGGAGAGATGGGAGGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167103649 19:47418774-47418796 ACAGAGAGGCAGAAAGGAGGAGG + Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167762844 19:51460277-51460299 AATGAGGGGAAGATAGGAGACGG - Intergenic
1168001431 19:53449430-53449452 AATGAGAAGAAGAGAGGTGAAGG - Intronic
1168254931 19:55159967-55159989 ATTGAGCGGCAGGAAGTGGACGG + Exonic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168517083 19:57017583-57017605 GATGAGAGGAGGGAAGGGGAGGG - Intergenic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
924982297 2:235328-235350 AATGAGAGGCAGCATGGGTCAGG + Intronic
925225910 2:2183978-2184000 AAAGAGAGAGAGAAAGGGGGAGG + Intronic
925631085 2:5894358-5894380 AAGGACAGGCAGAGAGGGAAAGG - Intergenic
925755313 2:7127941-7127963 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755418 2:7128135-7128157 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755441 2:7128176-7128198 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755464 2:7128217-7128239 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755471 2:7128230-7128252 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755494 2:7128271-7128293 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925834235 2:7928667-7928689 ATTGAGAGGAAGAAAGGGATGGG - Intergenic
926053772 2:9761709-9761731 AAGCAGAGGCAGGAAAGGGAGGG - Intergenic
926072517 2:9909658-9909680 AGTGACGGGAAGAAAGGGGATGG + Intronic
926079966 2:9977250-9977272 AATGAGAGACAGAAAAACGATGG - Intronic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926772699 2:16392567-16392589 AATGGGTGGCTGAAATGGGATGG + Intergenic
926837211 2:17036279-17036301 AATGATAGGCAGATAGAAGAAGG + Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
927648820 2:24898622-24898644 AGTCAGAGGCGGAAATGGGAGGG - Intronic
927657124 2:24958713-24958735 AATGCAAGGAAGGAAGGGGAAGG - Intronic
928075772 2:28263162-28263184 AAGGAGAGGAGGAGAGGGGAGGG + Intronic
928218018 2:29378707-29378729 AAAGAGAGGGAGGGAGGGGAGGG - Intronic
928620513 2:33083510-33083532 AATGGGAGGCAAACAGGAGAGGG + Intronic
928752464 2:34486700-34486722 AAAGAGAGGCAGCAAGGATAAGG - Intergenic
928873618 2:36011316-36011338 AATGAGAGGCTGAGGAGGGATGG - Intergenic
929058601 2:37900677-37900699 GATGGGAGTTAGAAAGGGGATGG + Intergenic
929505591 2:42525574-42525596 AAGGAAAGGAAGGAAGGGGAAGG - Intronic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929863469 2:45698607-45698629 AAAGAGAGGAAGAGAGGGGGAGG + Intronic
930136260 2:47906175-47906197 AAAGAGAGGGAGAGAAGGGAGGG + Intergenic
930434624 2:51325043-51325065 AATGACAGCCAGGAAGGAGAAGG - Intergenic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
930927128 2:56831850-56831872 AAAGAGAGGAAGAAAAGGAAGGG + Intergenic
931178850 2:59879848-59879870 AATGAGAGGGAGAGCGGGAAGGG + Intergenic
931330080 2:61271689-61271711 AAGGAGGGGAAGAAGGGGGAAGG + Intronic
931340774 2:61398592-61398614 AAGGGGAGGGAGAAAAGGGAAGG + Intronic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932110601 2:68995613-68995635 TTTGAGGGGCTGAAAGGGGATGG + Intergenic
932501884 2:72189733-72189755 AAAGAAAGGAAGGAAGGGGAGGG - Intronic
932549394 2:72752528-72752550 AGTGAGAGAGAGAAAGGGAAGGG - Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932628454 2:73317967-73317989 AAAGAGAGGAGGAGAGGGGAGGG - Intergenic
933016403 2:77132851-77132873 AATAAGAGACAGAAAGGGAAAGG + Intronic
933105206 2:78316075-78316097 AAAGAGAGGCAGTAAGAGGTAGG + Intergenic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933354557 2:81196216-81196238 AGAGAGAGGCGGAAAGGGGGGGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934531324 2:95091039-95091061 AATTACAGGCAGAAAAGGGTAGG - Intronic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935701620 2:105817200-105817222 AATGAGATGCAGACAGATGAAGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937100592 2:119265124-119265146 AATGAGAGGCAGGGAGAGCATGG + Exonic
937277764 2:120696415-120696437 AATGGGAGGAAGCAAGGGGGTGG - Intergenic
937302099 2:120848815-120848837 AAGGAGTGGCAGGAAGGGGCTGG + Intronic
937400189 2:121575746-121575768 GAGGAGAGGCAGAAAGGAGGAGG + Intronic
937468999 2:122159203-122159225 AAGAAGAGGCAGAGAGGAGAGGG + Intergenic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
937704413 2:124902734-124902756 AAAGAGAGATAGATAGGGGAGGG + Intronic
937795418 2:126012560-126012582 AATGAAAGACAGGGAGGGGAAGG + Intergenic
937873019 2:126799255-126799277 AAAGAGAGGAAGAAAGAGGGAGG - Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938396617 2:130954873-130954895 AAAGAGAGAGAAAAAGGGGAAGG - Intronic
938809490 2:134839989-134840011 AATGAGGGGTAGAAAGTGGTGGG - Intronic
939209835 2:139160105-139160127 AATGTTTGGAAGAAAGGGGATGG - Intergenic
939737879 2:145872098-145872120 AGAGAGAGGAAGAAAGGGAAAGG + Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
941186447 2:162326001-162326023 AGTGAGAGGCTGAAACTGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941920492 2:170845778-170845800 AATGAAAGGTAGGCAGGGGAGGG + Exonic
941956114 2:171206412-171206434 GAGGAGAGGTAGAAAGGTGATGG + Intronic
942157111 2:173141614-173141636 AAGGAGAGAGAGAGAGGGGATGG + Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942766783 2:179466942-179466964 AAAGAGAGAGAGAAAGGGAAGGG + Intronic
943208145 2:184927703-184927725 AATGGGAGGCATAAATGGGAAGG - Intronic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943911279 2:193571260-193571282 AATGAGAGGAATAAATGGAAGGG + Intergenic
944068166 2:195641261-195641283 AATCAGAGGGTGCAAGGGGAAGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
945367815 2:208977920-208977942 AGAGAAAGACAGAAAGGGGAGGG - Intergenic
945672650 2:212820676-212820698 ATTGAGAGACAGGAAGGGGTAGG - Intergenic
946026738 2:216676450-216676472 AACGAGAGGAAGAGAAGGGAAGG - Exonic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
946396547 2:219446239-219446261 AAAGAAAGGCAGGAAGGGAAAGG - Intronic
946686984 2:222280358-222280380 AAAGAGAGAAATAAAGGGGAAGG + Intronic
946817831 2:223597465-223597487 AAGAAAAGGCAGAAAAGGGAAGG - Exonic
946936285 2:224724399-224724421 AACCAGAGGCTGAAAAGGGAAGG - Intergenic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947429389 2:230012378-230012400 AATGAGAAGCAGAGAGGGCTAGG - Exonic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947698935 2:232216536-232216558 AATCAGAGGCAGAATGGCTAGGG - Intronic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948805820 2:240453188-240453210 CAGGAGGGGCGGAAAGGGGATGG - Intronic
948982950 2:241504103-241504125 AAGGAAAGGCAGTTAGGGGAGGG + Intronic
1168781974 20:500326-500348 AATTAGAGGAAGAAATGGAAAGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169345231 20:4823625-4823647 AAGGGGAGGAAGAAAGGCGAAGG - Exonic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169600844 20:7259065-7259087 AAGGAGAGGGAAAAAGGAGAAGG - Intergenic
1169920617 20:10730955-10730977 AAAGGGAGGAAGGAAGGGGAGGG - Intergenic
1170014578 20:11766325-11766347 AATGAGAGGAAGGCAGGGGTAGG - Intergenic
1170309017 20:14972365-14972387 AAAGAGAGTGAGAAAGAGGAAGG - Intronic
1170351652 20:15448004-15448026 AAGGGGAGGCAGAGATGGGATGG - Intronic
1170900576 20:20458631-20458653 AAGGAGAGGGAGCAAGGGGCTGG + Intronic
1171990058 20:31689228-31689250 AAGGAAAGGAAGAAAGGGGAAGG + Intronic
1172038168 20:32025112-32025134 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
1172038175 20:32025147-32025169 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
1172057910 20:32166888-32166910 AATGTGGGGCAGTGAGGGGAGGG - Exonic
1172165064 20:32893886-32893908 AATAAGAGGCAGAAAGGGTAAGG + Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172471151 20:35197424-35197446 AAGAAGAGGGAGAAAGGTGAGGG - Intergenic
1172486960 20:35304150-35304172 GAGGAGAGGAAGGAAGGGGACGG + Intronic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1172800399 20:37572371-37572393 AAAGAAAGAAAGAAAGGGGAAGG - Intergenic
1173007998 20:39155914-39155936 GATGAGAAGAAGAGAGGGGAAGG + Intergenic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1173283449 20:41649468-41649490 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173337869 20:42127438-42127460 AATGCAAGGCAGAACAGGGAAGG + Intronic
1173577187 20:44120076-44120098 AATGAGAGGCAGGATGGCGTAGG - Intronic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173662256 20:44742832-44742854 AGTGAGAGCCAGAGAGGCGATGG + Intergenic
1173722038 20:45268008-45268030 AAAGAGAGAAAGAAAGGGAAAGG + Intergenic
1174190548 20:48737508-48737530 AATGAAAGGAAGAAAAGAGAAGG + Intronic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1174872535 20:54196350-54196372 ACTGATAGGGAGGAAGGGGAGGG + Intergenic
1175309941 20:58004902-58004924 GATGAGAGCCAGAAACGAGATGG - Intergenic
1175330850 20:58162765-58162787 CACCAGAGGCAGAAATGGGAGGG + Intergenic
1175674481 20:60934946-60934968 ACAGGGAGGCGGAAAGGGGAGGG - Intergenic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177801667 21:25834213-25834235 TGTGAGAGGTAGAAAGGGGTGGG + Intergenic
1177953537 21:27568654-27568676 AGTGAGAGGCAGATATGGGATGG - Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178865281 21:36321686-36321708 AAAGAGAGGGGGAAAAGGGAGGG - Intronic
1179262806 21:39773458-39773480 AAGAAAAGGAAGAAAGGGGAGGG - Intronic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1180749671 22:18115606-18115628 AATGACAGGAATGAAGGGGATGG + Intronic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181164967 22:20978327-20978349 AAACAGAGGCATAAATGGGAAGG - Intronic
1181389798 22:22571946-22571968 AAAGAAAGGAAGGAAGGGGAAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181685156 22:24523087-24523109 ATAGAGATGCAGAAAGGGCAGGG + Intronic
1181851158 22:25750860-25750882 AGTCAGAGCCAGGAAGGGGAAGG + Intronic
1182081072 22:27529174-27529196 AACGAGAGCCAGCCAGGGGAAGG + Intergenic
1182093372 22:27610858-27610880 AATGTGAAGCAGAAAGGGAGGGG + Intergenic
1182100736 22:27655775-27655797 GAAGAGAGGAAGGAAGGGGAAGG + Intergenic
1182131396 22:27855388-27855410 AATGAAAGGGAGAAAAGGCAAGG + Intronic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183273732 22:36878182-36878204 AGTGGGAGGGAGAAAGGGTATGG - Intergenic
1183660832 22:39220312-39220334 AAAGGGAGGAAGAAAGAGGATGG + Intergenic
1184437554 22:44488789-44488811 AAGGAAAGGAGGAAAGGGGAGGG + Intergenic
1185165925 22:49262234-49262256 CATGTGAGGCAGAGAGGAGATGG - Intergenic
1185318524 22:50189657-50189679 AAGGACAGGTAGAAAGGGGGTGG + Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949316678 3:2764014-2764036 AAGGAGAGGTATAAAGTGGAGGG + Intronic
949616802 3:5762531-5762553 AATGAGCGGCAGCAGTGGGATGG + Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
950542699 3:13621674-13621696 AATGAGACCCAGCAAGGGGCAGG - Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950975585 3:17239459-17239481 AAGTAGAGGAAGAAATGGGATGG - Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951273757 3:20659757-20659779 AAAGAGAGAGAGAAAAGGGAAGG - Intergenic
951413014 3:22387959-22387981 AGAGAGAGGAAGAAAGGAGAAGG + Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952069059 3:29610901-29610923 AAGGAAAGGCAGAAAGGTCAGGG - Intronic
952121201 3:30246389-30246411 AATGAAAGGAAGGAATGGGAAGG - Intergenic
952184642 3:30955437-30955459 AAAAAGAGGCAGAAAGGGACCGG - Intergenic
952603904 3:35120592-35120614 TAGGAGGGGCAGAAATGGGATGG + Intergenic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
953143879 3:40254938-40254960 AATGATAGGGAGGAAGAGGAAGG - Intronic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953550453 3:43898472-43898494 AACGTGAGGGAGAATGGGGAGGG + Intergenic
953553540 3:43923906-43923928 AAAGAGAGAATGAAAGGGGAAGG - Intergenic
954390772 3:50267057-50267079 CATGACAGCCAGATAGGGGAGGG - Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
955080594 3:55654859-55654881 AATGAGAGACAGGCAGAGGAAGG - Intronic
955578014 3:60387586-60387608 GAGCAGAGGCAGAAAGGTGAGGG - Intronic
956205363 3:66749512-66749534 AGTGGTAGGCAGAAAGGGGTAGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956887591 3:73575956-73575978 AAAGAGAGACAGAGAGGGGCAGG + Intronic
957225496 3:77439747-77439769 AATGAGAGGAAAATTGGGGAGGG - Intronic
957717845 3:83954352-83954374 AATGAGAGGAAGAGAAGGAAGGG + Intergenic
957875738 3:86144024-86144046 AGAGAGAGGCAGAGAAGGGATGG - Intergenic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
958431220 3:94043652-94043674 AAAGAAAGAAAGAAAGGGGAGGG - Intronic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
959378015 3:105608721-105608743 GATGGGAGTAAGAAAGGGGATGG - Intergenic
959383739 3:105675585-105675607 AATGAAAGTCATAAAGGGGCTGG + Intronic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959475348 3:106804596-106804618 ATTGAGAGGGAAAAAGGAGAGGG - Intergenic
959536468 3:107491802-107491824 AATGAGAGGTAGAATGGTGCAGG - Intergenic
960347705 3:116555157-116555179 AAAGAGAGACAGAGAGGAGAGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961449815 3:126997623-126997645 CAGGAGAGGCGGAAAGGGGGCGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962003340 3:131323494-131323516 AAAGAGAGGAAGATGGGGGAAGG - Intronic
962072143 3:132044561-132044583 AAAGAGAGGAAGGGAGGGGAAGG + Intronic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962360917 3:134742112-134742134 AATGAGAGGATGAAAGTTGAAGG - Intronic
962406996 3:135108994-135109016 AATGGGAGGGAACAAGGGGAAGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963049713 3:141130525-141130547 AATGGTCGGCAGATAGGGGAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963509630 3:146230677-146230699 AATGAGAGAGGGAAAGGAGAGGG + Intronic
963607871 3:147427805-147427827 AGGAAGAGGCAAAAAGGGGAAGG - Intronic
963700107 3:148614946-148614968 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
963863624 3:150336226-150336248 AATGTGATAGAGAAAGGGGAAGG - Intergenic
963998100 3:151734951-151734973 AATAAGAGGCTCAAAGGAGAAGG + Intronic
964183137 3:153912047-153912069 AAGGAGAGGGAAAAATGGGAAGG - Intergenic
964516399 3:157513648-157513670 AATGAGAAACAAAAAGGGGCGGG + Intronic
964539946 3:157768872-157768894 AAGGAAAGGAAGAAAGGGAAAGG + Intergenic
964539950 3:157768891-157768913 AAGGAAAGGAAGAAAGGGAAAGG + Intergenic
964571430 3:158110699-158110721 AGTGTGAGCCAGAAAGGGTAGGG - Intronic
964877549 3:161385457-161385479 ACTAGGAGGGAGAAAGGGGAAGG + Intergenic
964926102 3:161959974-161959996 AATGAGAGACAGAAAGAGACAGG + Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965634893 3:170770883-170770905 GATGAGGGGCAGGAAAGGGAGGG + Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
965938683 3:174147775-174147797 AATCAGAGGAAGAAAGGGTGTGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966916581 3:184587607-184587629 AATGAGAAACAGAGAGGGGCAGG - Intronic
966979791 3:185121494-185121516 CATGAGAGGCTGAAAGGGGGAGG + Intronic
967032117 3:185617624-185617646 AATGATAGCCAAAAGGGGGAGGG - Intronic
967095524 3:186174416-186174438 AATGAAAGGGAGGGAGGGGAAGG + Intronic
967223006 3:187264982-187265004 ACTGAGAGCTAGAAAGGAGATGG - Intronic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
967577931 3:191118968-191118990 GATGAGAGACAGAGAGAGGAAGG + Intergenic
968148515 3:196319243-196319265 CAGGAGAGGCTGAAAGGGCAGGG + Intronic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968738768 4:2316174-2316196 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
968862813 4:3185948-3185970 AATGGAAGGGAGGAAGGGGAGGG + Intronic
970225432 4:13852049-13852071 AATGAGAGGGAGAGAAGGAAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970597391 4:17612922-17612944 AATGAAACCCAGTAAGGGGATGG - Intergenic
970781572 4:19744141-19744163 AATGAGAGGAGGAGAGAGGAAGG - Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971109645 4:23570783-23570805 AGTGAGAGGCAAAAAGAGAATGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971782647 4:31056502-31056524 AAAGAAAGAAAGAAAGGGGAAGG + Intronic
972281447 4:37605892-37605914 AAAGAAAGGAAGAAAGAGGAAGG + Intronic
972341676 4:38157490-38157512 CAAGAGAGGAAGCAAGGGGAGGG + Intergenic
972386370 4:38570319-38570341 AGTGGGAGGAAGAAAGGGGTTGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972775416 4:42235323-42235345 TATGAGAGGTAGTAAGAGGAAGG + Intergenic
972962615 4:44472773-44472795 AATTAGATGTAGAAAGGGAAGGG + Intergenic
973134492 4:46689493-46689515 GATGCGAGCCAGAAGGGGGATGG - Intergenic
973241122 4:47956681-47956703 AATGAGGGAAAGGAAGGGGAAGG + Intronic
973541700 4:51941595-51941617 AATGAGGGGAAGAAATGGAAAGG - Intergenic
974412887 4:61564847-61564869 AAAGAGAGGAAGAGAGGAGATGG + Intronic
974880905 4:67756276-67756298 AATGAAAGGAGGAAAAGGGAAGG - Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975468502 4:74736670-74736692 ATTGAGAGGTAGAAATGGAAAGG - Intergenic
975697136 4:77024442-77024464 AATGCCAGCCAGAAAGGGGCTGG - Intronic
976081141 4:81356191-81356213 AAAGAAAGGCAGGAAGGGAATGG + Intergenic
976621997 4:87137816-87137838 AATGATAGGACAAAAGGGGAGGG - Exonic
976716648 4:88129987-88130009 AAAAAGAGGCAGAGAAGGGAGGG + Intronic
976759596 4:88533964-88533986 AATGGGAGGTAGAAAGAGGGAGG - Intronic
976802344 4:89006785-89006807 AAGGAGAGCTAGACAGGGGATGG + Intronic
976849934 4:89533265-89533287 AAAGAGAGAAAGAAAGGGAAAGG + Intergenic
976883656 4:89960801-89960823 AATTCTAGGCAGAAAGGGCAGGG - Intergenic
977377339 4:96222527-96222549 AAAGAAAGGAAGGAAGGGGAAGG - Intergenic
977435647 4:96990774-96990796 AAAGAGAGGCAGAAAGCTGTGGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978157788 4:105509378-105509400 AAGGAGAGGAAGACAGGGAAAGG + Intergenic
979101055 4:116615254-116615276 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
980806965 4:137827817-137827839 AAGGAAGGGAAGAAAGGGGAAGG + Intergenic
980806993 4:137827890-137827912 AAGGAAGGGAAGAAAGGGGAAGG + Intergenic
980807015 4:137827948-137827970 AAGGAAGGGAAGAAAGGGGAAGG + Intergenic
980807037 4:137828006-137828028 AAGGAAGGGAAGAAAGGGGAAGG + Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
981813999 4:148807643-148807665 AAGGAAAGGAAGGAAGGGGAAGG + Intergenic
982178614 4:152729486-152729508 TATGAGAGGCAGATAGGAAAAGG + Intronic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983096456 4:163568100-163568122 AATGCGAGGGAGAAATGGTATGG - Intronic
983173359 4:164559952-164559974 TATAAGAGACAGAAAGGAGAAGG + Intergenic
984073841 4:175150596-175150618 GATGTGAGACAGAAAGGGAAGGG - Intergenic
984195666 4:176656248-176656270 AGTTAGAGGCAGAAAGGAGGAGG - Intergenic
984229383 4:177075652-177075674 AATAATAGGCAGACAGGGGCAGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985839572 5:2296075-2296097 TATGATGGGCAGAGAGGGGAAGG + Intergenic
985850860 5:2388254-2388276 AAAGAGAGGGAGAGACGGGAGGG - Intergenic
985966817 5:3344007-3344029 AATGAGGGGAAGAAAAGGGTAGG - Intergenic
985993751 5:3584819-3584841 AATGAAAGGAAGAAGGGGGGAGG + Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986125630 5:4880472-4880494 AGTGAGAGACAGGAAGGGGAAGG + Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986169100 5:5301524-5301546 AGTGAGAGACAGAAAGGAGAAGG - Intronic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986749830 5:10776906-10776928 AAGGAGAGGCAGACAAGAGAAGG + Intergenic
986781661 5:11071966-11071988 AATCTGAGGAAGAAAGGAGATGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987294980 5:16541794-16541816 AAGGAAAGGAAGGAAGGGGAAGG + Intronic
987517048 5:18924083-18924105 AATGAGAGAGAGAAAGAAGAAGG + Intergenic
988174005 5:27696795-27696817 AAAGAGAGGGAGAAAAAGGAGGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988567603 5:32331842-32331864 ACTGGGAGCCAGAAAGGGGGCGG + Intergenic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988801191 5:34698136-34698158 GAAGGGAGGCAGAGAGGGGAGGG - Intronic
988846546 5:35133431-35133453 AATGGGAGTCAGAAATGGGTGGG - Intronic
989141987 5:38210591-38210613 AAAGAGAGGAGGAAAGGGGGAGG + Intergenic
989322380 5:40151371-40151393 AAAGAGAGGAAGAAAGGAGATGG - Intergenic
989513532 5:42316151-42316173 AAGCAAGGGCAGAAAGGGGAGGG - Intergenic
989814672 5:45721829-45721851 AATGAGAGGGGGAAAAAGGAAGG + Intergenic
990007441 5:50960510-50960532 AATGAAAGAAAGAAAGAGGAAGG - Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990210475 5:53478577-53478599 AAAGAGAGGGAGAAAAGGGAGGG + Intergenic
990584751 5:57200155-57200177 AAAGAGAGGAAGGAAAGGGAAGG - Intronic
990626112 5:57613259-57613281 AATAAAAGGAAGAAAGGAGAGGG + Intergenic
990792239 5:59495330-59495352 AATGAGAGACACAAAGAGAATGG - Intronic
991361109 5:65821106-65821128 AATGGGGGGCGGAAAGGGAAGGG + Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
992219163 5:74555033-74555055 AATGGAAGGCAGAGAAGGGAGGG - Intergenic
992860459 5:80904109-80904131 AATAACAGGCAGACTGGGGAGGG + Intergenic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993391522 5:87324284-87324306 AAAGAGAGGAGGAAAAGGGAGGG - Intronic
993426136 5:87766205-87766227 AATGAGAGCCAGAAAGGGGTGGG + Intergenic
993587469 5:89747969-89747991 AAGGAAAGGAACAAAGGGGAGGG - Intergenic
994487901 5:100402301-100402323 TATGAGAGGCAGGAAATGGATGG + Intergenic
994727592 5:103454571-103454593 AATGAGGGGCAGAATGGGCAAGG - Intergenic
995609415 5:113893057-113893079 AATGAGAGGGAGAAAGTGCCAGG + Intergenic
995695340 5:114872921-114872943 ACTGAGAGGGAGAAAGGCTATGG - Intergenic
996347306 5:122500982-122501004 AATGAGATGCTGAAAAAGGAGGG - Intergenic
996542131 5:124641355-124641377 AACGGGAGGCAGAAAGGGAAAGG - Exonic
996547765 5:124698480-124698502 AATGTGAGGCAGTAAAGAGAAGG + Intronic
996696540 5:126402951-126402973 AATGTGAGGCTAAAAGGAGAGGG + Intronic
996931101 5:128888759-128888781 TATGAAAGGCTGAAAGGGGTTGG + Intronic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
997581266 5:135018874-135018896 AAAGACAGGCAGAACTGGGATGG - Intergenic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998005762 5:138655837-138655859 AGTGAGAGGCACAAAAGGGAAGG + Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998876101 5:146600985-146601007 AATGAGAATCAGAAAGTAGATGG - Intronic
999087424 5:148905040-148905062 ACTGAGACACAGAAAGGGGCAGG - Intergenic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000219515 5:159199568-159199590 AATGAGAGCCAGAACTGGCAAGG - Intronic
1000233456 5:159336258-159336280 AAGGGGAGGTGGAAAGGGGAGGG - Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1000935988 5:167303363-167303385 AAAGAGAGTCAGCAAAGGGAGGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001461914 5:171923868-171923890 AATCCTAGGCAGACAGGGGAGGG + Intronic
1001646099 5:173283443-173283465 TAAGAGAGGGAGAGAGGGGAAGG + Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1003016040 6:2468261-2468283 AATGGGAGACAGAGAGGGAAGGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003315337 6:5006510-5006532 CAAGAGAGGCAGCAAGGAGAAGG - Intergenic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004444974 6:15689607-15689629 AAGGACTGGGAGAAAGGGGAAGG - Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004506064 6:16247731-16247753 AAACTGAGGCAGAGAGGGGAGGG + Intronic
1004983312 6:21050842-21050864 AGTGACAGGCAGATAGGGGCAGG - Intronic
1005443254 6:25894249-25894271 AATGAGAGGGAGAAAAAGAAGGG - Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005662912 6:28018505-28018527 AATGAGAGACAAACAGGAGATGG - Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1007567143 6:42860413-42860435 AATCAGAGACAGAAAGGTCAAGG + Intronic
1007590920 6:43020631-43020653 AATAAGAGACAGAAAGAAGAGGG - Intronic
1007594228 6:43041645-43041667 AAGGAGAGGAAAAGAGGGGAGGG + Intronic
1007610961 6:43148499-43148521 GTTGAATGGCAGAAAGGGGATGG + Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008505347 6:52224682-52224704 AAAGAGAGACAGAAAGAAGAGGG - Intergenic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1008853186 6:56049617-56049639 ATTGAGGGGCAAAAAGGAGAGGG - Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009704031 6:67221447-67221469 AAAGAGAGGCAGATAGAGTAAGG + Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1010408412 6:75532773-75532795 AAAGAGAGCCAGAAAGGGAGAGG + Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010813255 6:80324457-80324479 AGTGAAAGGCAGAAAAGAGATGG + Intronic
1010960578 6:82141345-82141367 AATGGCTGGCAGGAAGGGGAAGG - Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1012244573 6:96912205-96912227 GATGAGAGTCAGGAATGGGAAGG - Intergenic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012404461 6:98879302-98879324 AATGCAAGGCAGAAATGGAATGG + Intronic
1012760754 6:103297600-103297622 GATGGAAGGGAGAAAGGGGATGG - Intergenic
1012769039 6:103405280-103405302 AAGGAGAGCTGGAAAGGGGATGG + Intergenic
1013150146 6:107438000-107438022 AATGAGAGGCACCCAGGGAAAGG + Intronic
1013164181 6:107574991-107575013 AATGAGTGGCAGAAACCGCAGGG - Intronic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013542386 6:111123362-111123384 AATGAGAGGTTGAAAGGGAATGG - Intronic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014004771 6:116405516-116405538 AAAGAGAGGCAGAAAGAGTGAGG - Intronic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014590581 6:123262697-123262719 AATGAGACACAGAAATGTGAAGG - Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015018160 6:128439196-128439218 TATGTGAAGCAGGAAGGGGAAGG - Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015312198 6:131778424-131778446 AAAGAGAGGGATGAAGGGGAAGG - Intergenic
1015505926 6:133988167-133988189 AATAAGATACAGCAAGGGGAAGG - Exonic
1015703042 6:136056920-136056942 AATGATAGGGCCAAAGGGGAGGG - Intronic
1015896785 6:138025491-138025513 CAAGAGAGGCAGAAAGGGCTAGG + Intergenic
1015994574 6:138984998-138985020 TTTGAGTGGCAGAAAGGGTAAGG - Intronic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016098281 6:140065155-140065177 AAAGACAGGAAGAAAGGGAAGGG + Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1016876139 6:148867248-148867270 AAAGAAAGGTAGAAATGGGAAGG - Intronic
1016882749 6:148927177-148927199 AGAGAGAGAGAGAAAGGGGAGGG + Intronic
1017447210 6:154517800-154517822 AAAGAAAGGAAGGAAGGGGAGGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017777756 6:157692616-157692638 ACTGGGAGGCAGTAAGGAGATGG - Intergenic
1017799568 6:157881347-157881369 AAGGAGAGGGAGAAAGACGAGGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018149684 6:160926362-160926384 AAGGAGACGCATAAAGGGAACGG + Intergenic
1018285266 6:162231122-162231144 AAGGAGAGGGAGAAAGGAAAAGG - Intronic
1018601108 6:165542364-165542386 AACTAGAGGCTCAAAGGGGATGG - Intronic
1018929618 6:168232320-168232342 AAGGAGAGGAAGACAGGGCATGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019263550 7:97607-97629 AAGGAGAGGGAGAAAGGTGAAGG + Intergenic
1019511027 7:1417352-1417374 AGGAAGGGGCAGAAAGGGGATGG - Intergenic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020032935 7:4945569-4945591 AAAGGAAGGGAGAAAGGGGAGGG - Intronic
1021030367 7:15725331-15725353 AATGAGTGGCAGATAGAGAAAGG + Intergenic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021286770 7:18789958-18789980 AATGAGAGGGACAAAGAGGGAGG + Intronic
1021680196 7:23122345-23122367 AAGGAGAGGGAGAAAGGGGTGGG - Intronic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022320885 7:29286533-29286555 AATGAGAGGAAGAAAGGGTAAGG - Intronic
1022367300 7:29735637-29735659 AATTAGAGGCTGAGAGGGAAGGG + Intergenic
1022437100 7:30398782-30398804 AATGAGAGCCAGCTATGGGAAGG + Intronic
1022702791 7:32777249-32777271 AATGAGAGGCAGCAAGTGCGAGG - Intergenic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1022907016 7:34867369-34867391 AATGAGAGGCAGCAAGTGAGAGG - Intronic
1022907247 7:34868988-34869010 AATGAAAGACAGCAAGGGGCAGG - Intronic
1023088890 7:36599833-36599855 ACTGAGAGGCAGAAAGCAGGAGG - Intronic
1023709649 7:42977917-42977939 AGAAAGAGACAGAAAGGGGAGGG - Intergenic
1024123632 7:46269950-46269972 GATGAGAGGAAGGGAGGGGAGGG - Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024937250 7:54722831-54722853 AAAGAGAGAAAGAAAGGGGAGGG - Intergenic
1026157867 7:67843053-67843075 AATGAGAAGGACAAAGGAGAAGG + Intergenic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027223648 7:76230633-76230655 ATTGAGAGTCAGGAAGGGAAGGG + Intronic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1028251624 7:88545011-88545033 AAAGAAAGGAAGAAAAGGGAAGG - Intergenic
1028260685 7:88660650-88660672 AATGAGGGGAGGAAAGAGGAAGG - Intergenic
1028308025 7:89290649-89290671 AAGGAGAGGTAAAAGGGGGAAGG + Intronic
1028528186 7:91808724-91808746 AATGAGAGGTAGTGGGGGGAGGG + Intronic
1029027180 7:97429174-97429196 AATGAGTAGGAGAAAGGGCAAGG + Intergenic
1029678678 7:102092238-102092260 AAGGAGAGGCAGAACAGGAAGGG - Intronic
1029745132 7:102512353-102512375 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1029763124 7:102611514-102611536 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1029843970 7:103394179-103394201 AAACAGAGGAAGAAAGGGAAAGG + Intronic
1029982291 7:104890391-104890413 AATGCGGGGGAGGAAGGGGATGG - Intronic
1030357822 7:108561639-108561661 AAGGAGAGGCAGGAAAGGAAGGG + Intronic
1030918484 7:115348356-115348378 AATGAGAGGTAAAATGGTGAAGG - Intergenic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031514311 7:122683144-122683166 GATGAGAGTTGGAAAGGGGATGG + Intronic
1032355953 7:131210719-131210741 AAAGAGAGAGAGAAAGGGGAAGG + Intronic
1032433682 7:131883028-131883050 AATGAGATGGGGAAAGGCGAGGG - Intergenic
1032516073 7:132507365-132507387 AATGAGACTCAGAGATGGGATGG + Intronic
1032553927 7:132812101-132812123 AATGAAAGGGGGAAAGGGGGAGG - Intronic
1032804249 7:135339544-135339566 AATGGGAGGAAGAGAGGGGTAGG - Intergenic
1032906836 7:136377891-136377913 CATAAGAGGAAGAAAGGGCAAGG + Intergenic
1033215821 7:139492824-139492846 AATGAGAGGGAAAAAGGGAAGGG - Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033301319 7:140188696-140188718 AAGGAAAGAAAGAAAGGGGAAGG + Intergenic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1033570354 7:142621764-142621786 AATGAGAGGAAGAAAACGAAAGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033804407 7:144937642-144937664 AAGGAAAGGAAGGAAGGGGAAGG - Intergenic
1034075234 7:148225242-148225264 AATATGAGGCAGAAAAGGGAGGG + Intronic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034516726 7:151586796-151586818 ATTAAGAGGCACAAAGGGAAGGG - Intronic
1034701181 7:153097836-153097858 ACTGAGAGAGAGAGAGGGGAAGG + Intergenic
1034859875 7:154585946-154585968 AAGGAGAGGAAGGCAGGGGAAGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035276390 7:157750482-157750504 TATGAGAGGCAGGAAGTGGCAGG + Intronic
1035453327 7:158993097-158993119 AAAGGAAGGCAGGAAGGGGACGG - Intergenic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035971883 8:4258325-4258347 AAAGAGAGGGAGGGAGGGGAGGG + Intronic
1036005509 8:4657411-4657433 AAAGAGAGACAGAGAGGGAAGGG - Intronic
1036284695 8:7433870-7433892 AATCAAAGGCAGTAATGGGAAGG - Intergenic
1036336779 8:7877660-7877682 AATCAAAGGCAGTAATGGGAAGG + Intergenic
1036546238 8:9771963-9771985 AGTGAGAGGGAGAAAGAGGTGGG + Intronic
1037215358 8:16445103-16445125 GATGAGGGACAGAAAGGGGTGGG - Intronic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037802015 8:22041045-22041067 GATGAGAGCCAGAGAGGGCAAGG - Intergenic
1038021390 8:23554422-23554444 ACTGCGAGACAGAAAGGGAAGGG - Intronic
1038085896 8:24195837-24195859 AATGAAATGAATAAAGGGGAAGG + Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1038531348 8:28320299-28320321 AATGAAAGGATGAATGGGGAAGG - Intronic
1039127814 8:34223388-34223410 AAAGAGAGACAGAAAGGTGATGG - Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039388380 8:37157155-37157177 AATGAGGGGCAGGGAGGGGAAGG + Intergenic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1039839406 8:41283101-41283123 AAAGAGAGGAAGAAACAGGATGG - Intronic
1040075240 8:43222775-43222797 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1040390979 8:46950355-46950377 TATGAGGGGCAGAACAGGGATGG + Intergenic
1040571506 8:48615556-48615578 AATGAGAAGCAGAACTGTGAGGG - Intergenic
1040910855 8:52517350-52517372 AATGAGTGGGAGAAAGAAGAAGG - Intergenic
1041051975 8:53943165-53943187 AAAGAGAGGAAGAAATGAGATGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042081517 8:65059582-65059604 AATCCTAGGCAGAAAAGGGAGGG + Intergenic
1042181342 8:66090797-66090819 GGTGAGTGGCAAAAAGGGGAAGG - Intronic
1042829614 8:73012154-73012176 GAAGAGAGGGAGTAAGGGGAAGG + Intronic
1042905255 8:73766041-73766063 AATGAGAGAGGAAAAGGGGAGGG + Intronic
1043242961 8:77959562-77959584 AATGAGATAGAAAAAGGGGAGGG - Intergenic
1044446317 8:92280888-92280910 AATTAGAGAAAGAAAGGGGGGGG + Intergenic
1044542406 8:93422519-93422541 AATGAGAATCAGAGAGGAGAGGG - Intergenic
1044837783 8:96313051-96313073 TTTGGGAGGTAGAAAGGGGAAGG + Intronic
1045026038 8:98087617-98087639 AAAGAAAGGCAGGGAGGGGAGGG - Intronic
1045297848 8:100887981-100888003 AATGAAGGGCAGAGAGAGGAAGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046155853 8:110289353-110289375 AATGAGAGGAAGGAAGTGGGGGG - Intergenic
1046538392 8:115547300-115547322 AGAGAGAGGGAGAAAGGGAAGGG - Intronic
1047137117 8:122092001-122092023 TCTGAGAGGAGGAAAGGGGAAGG - Intergenic
1047360515 8:124164708-124164730 AGTGACAGGCAGTGAGGGGAAGG - Intergenic
1047676234 8:127206237-127206259 AATGTGAGTCAGAAAGCTGAAGG + Intergenic
1048161871 8:132028777-132028799 AAAGAGAGGAAGAAAGAAGAAGG + Intronic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048507119 8:135031671-135031693 AATGAGTGGCAGAGAAGGGTGGG - Intergenic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048573154 8:135671465-135671487 AATGAGACGCAGGCAGAGGAAGG + Intergenic
1049047147 8:140161816-140161838 AGAGAAAGGCAGAAAGGGCAAGG + Intronic
1049319511 8:141988535-141988557 GATGAGAGTGGGAAAGGGGAGGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049553032 8:143269436-143269458 GATGAGAGACTGACAGGGGACGG - Exonic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1050025473 9:1330389-1330411 CTTGAGAGGCTGAAATGGGAGGG + Intergenic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1051480417 9:17554036-17554058 AAAGAGAGAGAGAAAGGGGAGGG - Intergenic
1051555553 9:18378666-18378688 CATGAGAGCCAGAAAAGAGAAGG - Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052055523 9:23902812-23902834 AGAGAGAGGCAGAAAGGGAGAGG - Intergenic
1052087554 9:24286504-24286526 AAGGAGGGGAAGAGAGGGGAAGG - Intergenic
1052119363 9:24691996-24692018 AATGAGCTGCAGATAGGGGCTGG - Intergenic
1052327287 9:27228833-27228855 AATGAGATTCAGACAGAGGAAGG + Intronic
1052804326 9:32999619-32999641 AAGCAGAGGCAGAAATGTGAGGG + Intronic
1052871753 9:33514401-33514423 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053168243 9:35859742-35859764 CATGAGAGGCACAAAGGAGGAGG + Intergenic
1053404324 9:37858617-37858639 AATGAGAGGGTGAAAAGAGAGGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056800915 9:89690869-89690891 AACGAGAGGGACAGAGGGGAGGG - Intergenic
1057218100 9:93240594-93240616 AATGAGAGGCAGAAGAGACAGGG + Intronic
1057226059 9:93293778-93293800 GATGAGAGGCAGACAGGGTGAGG - Intronic
1057685852 9:97233553-97233575 AATGAGAAGCAGTTAGGGGCTGG - Intergenic
1057802596 9:98199238-98199260 ACTGAGGGCCAGAGAGGGGAAGG + Exonic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057932778 9:99210690-99210712 AGAGAGAGAAAGAAAGGGGAAGG - Intergenic
1057936392 9:99242931-99242953 AATGAGGACCAGAAAGGTGAAGG - Intergenic
1058024440 9:100125551-100125573 AATGACAGGCAGAGAAGGGAAGG - Intronic
1058426503 9:104879874-104879896 GAGGAGAGGCAGAAATGGGGAGG + Intronic
1058748404 9:108015141-108015163 AATGGGGGTTAGAAAGGGGAGGG - Intergenic
1058888166 9:109338746-109338768 AATGAGAGTGAGCAGGGGGAGGG - Intergenic
1058939738 9:109801909-109801931 AATGAGAGGGACCATGGGGAGGG + Intronic
1059054101 9:110960688-110960710 AGAGAGAGGAAGAAATGGGAGGG + Intronic
1059098717 9:111447946-111447968 AAAGAAAGGCAGAGAGGGAAAGG + Intronic
1059105862 9:111510963-111510985 AATGAGAGAAACACAGGGGAAGG + Intergenic
1059227085 9:112682135-112682157 AAAGAAAGGTAGATAGGGGAGGG + Intergenic
1059578584 9:115519159-115519181 AAGGAGAGGAAGAGAAGGGAAGG - Intergenic
1059658553 9:116378707-116378729 AACGAGGGCCAGAGAGGGGATGG + Intronic
1060424524 9:123493400-123493422 ACTGAGAGGGTGAAAGAGGATGG + Intronic
1060430134 9:123543852-123543874 AGTGAGAGGCAGAGAAGGAAAGG - Intronic
1060442689 9:123656233-123656255 AGTGAGAGGCAGGGCGGGGAGGG + Intronic
1060816724 9:126639029-126639051 GAGGAGAGGAGGAAAGGGGAGGG + Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1061245049 9:129397308-129397330 GATGGGAGGCTGAAATGGGAAGG + Intergenic
1061357205 9:130115363-130115385 AATGAGCGGAAAAAAGGGGGAGG - Intronic
1061456638 9:130703026-130703048 AAGGAGACACAGAGAGGGGAAGG - Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062407293 9:136403080-136403102 GGTGGGGGGCAGAAAGGGGAGGG + Intronic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185485974 X:481955-481977 AAGGAGAGGGAGGAAGGAGAGGG + Intergenic
1185485982 X:481985-482007 AAGGAGAGGAAGGAAGGAGATGG + Intergenic
1185604604 X:1360868-1360890 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604609 X:1360892-1360914 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604614 X:1360916-1360938 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604624 X:1360962-1360984 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604629 X:1360986-1361008 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604639 X:1361032-1361054 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604644 X:1361056-1361078 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604649 X:1361080-1361102 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604654 X:1361104-1361126 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604659 X:1361128-1361150 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185679118 X:1873818-1873840 AAAGAGAGAGAGAAAGGAGAGGG - Intergenic
1185679121 X:1873841-1873863 AGAGAGAGTCAGAAAGGAGAGGG - Intergenic
1185701461 X:2233984-2234006 AATGAGAGGCATAGCAGGGAAGG + Intronic
1185762766 X:2701099-2701121 AAAGATGGGCAGTAAGGGGATGG - Intronic
1185999789 X:4995914-4995936 AGAGAGAGAGAGAAAGGGGAAGG - Intergenic
1186017822 X:5218030-5218052 AATGAGAGAGAGAAAAAGGAAGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186652933 X:11580405-11580427 TAGGACAGGAAGAAAGGGGAGGG - Intronic
1186903704 X:14087848-14087870 AATGAGGGTCAGAAATAGGAAGG - Intergenic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187478483 X:19633165-19633187 GAAGAGAGGGAGGAAGGGGAAGG + Intronic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188192010 X:27182818-27182840 AATGGGAGGCAAAAACGGGAAGG + Intergenic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188407723 X:29832439-29832461 AATTAGAGGCAGAAAAGGCAAGG + Intronic
1188755624 X:33958200-33958222 AATAAGAGGCTGGAAAGGGAAGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189819971 X:44860865-44860887 AATGAGAAACAGACAGGGTAAGG - Intergenic
1189840306 X:45068847-45068869 AAAGAGAGAGAGAAAGGGAAAGG - Intronic
1189846725 X:45145345-45145367 AAAGAGAGGCAGACATGGGCGGG + Intergenic
1189953494 X:46255949-46255971 AATGAGAGGGAGATGGGGAAGGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190723651 X:53172099-53172121 AAAGAGAGGAAGAAGAGGGAGGG + Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191591182 X:62887380-62887402 AGAGGGAGGAAGAAAGGGGAAGG - Intergenic
1191795029 X:65012484-65012506 AATGAGAGCAAGAGAGGGAAAGG - Intronic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191869998 X:65737809-65737831 AAACAGAGGCAGAAATGGGTGGG - Intronic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192145270 X:68678020-68678042 ACTGAGACCCAGAAAAGGGAAGG + Intronic
1192353161 X:70373295-70373317 AAGGAGGGGGAGAACGGGGAGGG + Intronic
1192555019 X:72082340-72082362 AAGGAGAGGCAGGAAAGGGGAGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1192784606 X:74324263-74324285 AATGAGGGGCTGAAATGAGAGGG - Intergenic
1192848976 X:74933587-74933609 AATGAGGGGGAGAGATGGGAAGG + Intergenic
1194268082 X:91779301-91779323 ACCGAGGGGGAGAAAGGGGAAGG - Intronic
1194388206 X:93283117-93283139 AATAAAAGGAAGTAAGGGGAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1195742104 X:108075312-108075334 AATGGGACTCAGAAACGGGAAGG + Intronic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1196069607 X:111506204-111506226 GATATAAGGCAGAAAGGGGAGGG - Intergenic
1196099670 X:111834454-111834476 AGAGAGAGACAGAGAGGGGAGGG - Intronic
1197176484 X:123491630-123491652 AATGATAGGAGGAAAGGAGAGGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197817145 X:130509677-130509699 AATGAGAGACTGAAAGAGGGTGG - Intergenic
1197986125 X:132268327-132268349 AATGTGAGGAAGAATGGAGACGG - Intergenic
1198370688 X:135985940-135985962 AAGGCGAGGCAGAAAATGGAAGG - Intronic
1198916206 X:141675274-141675296 ATCAAGAGGCAGAAAAGGGAAGG - Intronic
1199506041 X:148562720-148562742 AAAGAGAGGAAGAGAGAGGAAGG - Intronic
1199540442 X:148952587-148952609 AATGAGAAAAAGAAAGGTGATGG + Intronic
1199542384 X:148971583-148971605 AATGAGAGGCGGGAAGGTGATGG - Intronic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199622622 X:149713698-149713720 TATGGGAGGCAGAAAGTGAAGGG - Intronic
1199971987 X:152868002-152868024 AATGAGTGGGAGAAAGGGTGAGG - Intronic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200944454 Y:8819706-8819728 ATCAAGAGGCAGAAAAGGGAAGG - Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201458237 Y:14194360-14194382 GAAGAGAGGTGGAAAGGGGATGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic