ID: 906185376

View in Genome Browser
Species Human (GRCh38)
Location 1:43858509-43858531
Sequence CAGGTACAAGATCCCCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906185376 Original CRISPR CAGGTACAAGATCCCCACGT GGG Intronic
900593360 1:3469435-3469457 CATGTTCGAGATCCTCACGTCGG + Exonic
906185376 1:43858509-43858531 CAGGTACAAGATCCCCACGTGGG + Intronic
911636763 1:100244577-100244599 CACGTTCAAGATCCCCCGGTGGG + Intronic
921709491 1:218359216-218359238 CAGGTACAAGAAACCCAGGGTGG - Intronic
1066667808 10:37803318-37803340 CAGGGACAAGTTCCCCATCTAGG + Intronic
1070816628 10:79328533-79328555 CAGGAACAGGAACCCCAGGTGGG + Intergenic
1075207448 10:120459311-120459333 CAGGTAAAAGAGCCACAAGTTGG - Intronic
1081663986 11:44905830-44905852 CAGGTTTTAGATCCCCAGGTAGG + Intronic
1086079334 11:82887075-82887097 CATGTACAAGATCCTAAGGTAGG - Intronic
1094157426 12:27351594-27351616 CAGATACCAGATCCCTACGTAGG + Intronic
1122073614 14:99221609-99221631 CAGGAGCAGGATGCCCACGTGGG + Intronic
1129204701 15:74030025-74030047 CAGGTACCAGAACCCCGCGGTGG - Intronic
1131967222 15:97857363-97857385 CAGTTACAGAATCCCCACATTGG + Intergenic
1141444763 16:84050754-84050776 CAGCTGCAAGACCCCCATGTGGG + Intergenic
1146185227 17:30720205-30720227 CAGATCCCAGATCCCCACCTTGG + Intergenic
1152496968 17:80680046-80680068 CAGGGCCAAGACCCCCAAGTGGG + Intronic
1157725730 18:49962284-49962306 CAGGTCCAAGATACCCAGCTTGG + Exonic
1160133353 18:76249537-76249559 AAGGGACAAGATACTCACGTTGG + Intergenic
1162973549 19:14195484-14195506 CAGATCCCAGATCCCCACCTTGG - Intronic
925640324 2:5980921-5980943 CAGGCACAGGCTCCTCACGTGGG + Intergenic
936684198 2:114808739-114808761 CAGGTACAAGGGTCCCAGGTGGG - Intronic
940285935 2:152033104-152033126 CAGGGCCAAGGTCCCCAGGTGGG + Intronic
944977455 2:205071373-205071395 CAGGAACAAGATGCACACCTAGG - Intronic
945812653 2:214567487-214567509 CAGCTACAAAATCCCCATGTGGG - Intronic
1170519971 20:17175078-17175100 CAGGGACAAGAAACCCACCTGGG + Intergenic
1172648461 20:36486462-36486484 CAGGTCCAAAGGCCCCACGTGGG + Intronic
1173859077 20:46270287-46270309 CAGGTCCTACATCCCCAGGTAGG + Intronic
1181723789 22:24796871-24796893 CAGGTACAAAGTCCCCAAGGTGG - Intergenic
1183728026 22:39600232-39600254 CAGATAGAAGAGCCCCAGGTGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
954100964 3:48372303-48372325 CAGATTCAAGATCCCAAGGTAGG + Exonic
961700541 3:128741144-128741166 GAGGTACAAGAACCTCACATGGG - Intronic
968474513 4:796955-796977 CAGACACAGGACCCCCACGTGGG + Intronic
973626723 4:52779894-52779916 CAGCATCAAGATCCCCAGGTTGG + Intergenic
979133942 4:117085289-117085311 CAGGAAGAACATCCCCACGCAGG + Exonic
982063090 4:151624379-151624401 CAGGTACAAGAGGCACACGTGGG - Intronic
982305402 4:153925148-153925170 CAGGTACAAGGGCCCCAAGGTGG - Intergenic
996633067 5:125660660-125660682 CATGAACAAGATCCCCTCATGGG + Intergenic
1002946552 6:1766695-1766717 CTGGTTCAACATCCCCAGGTGGG - Intronic
1003308528 6:4949223-4949245 GAGGTGCAAGATTTCCACGTGGG - Intronic
1003644271 6:7901777-7901799 CAGGGAGAAAATCCCCATGTAGG + Intronic
1008564224 6:52751513-52751535 CAGATACAAGATCCCAAGATGGG + Intronic
1008568535 6:52792794-52792816 CAGATACAAGATCCCAAGATGGG + Intronic
1008574683 6:52848855-52848877 CAGATACAAGATCCCAAGATGGG + Intronic
1014732715 6:125052518-125052540 CAGGGAAGAGATCCCCAAGTAGG + Intronic
1026476987 7:70744811-70744833 GAGGTACAAGCTCCTCCCGTGGG - Intronic
1036690708 8:10943064-10943086 CAGGTAGAAGAGCCCCAGATGGG - Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1047492292 8:125384820-125384842 CAGGTACAGGACCCTCACATGGG - Intergenic
1048502612 8:134992502-134992524 CAGGTATGAGATCCACACGAAGG - Intergenic
1051024859 9:12596095-12596117 CTGGGACTAGATCCCCCCGTTGG - Intergenic
1056275402 9:84989973-84989995 CAAGTACAATATCCCAACATTGG + Intronic
1057184667 9:93050357-93050379 CAGTGACATGATCCCCACCTAGG + Intergenic
1059588249 9:115629369-115629391 CAGGTAGAAGGGCCCCACCTGGG - Intergenic