ID: 906188232

View in Genome Browser
Species Human (GRCh38)
Location 1:43878073-43878095
Sequence TATGACCTAGAGCATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906188232_906188236 4 Left 906188232 1:43878073-43878095 CCCTCCAGATGCTCTAGGTCATA 0: 1
1: 0
2: 1
3: 14
4: 172
Right 906188236 1:43878100-43878122 TCTCTCGCCTCTTCTGCCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906188232 Original CRISPR TATGACCTAGAGCATCTGGA GGG (reversed) Intronic
901666726 1:10830406-10830428 TCTGTCCTAGAGCATGTTGAGGG + Intergenic
901798752 1:11694963-11694985 TAGAACCCAGAGCAACTGGAAGG + Intronic
902284722 1:15400021-15400043 TTTCACCTAGAGAAGCTGGAAGG - Intronic
902441449 1:16432784-16432806 TATGACCTTGAAGATCTTGATGG + Exonic
902446129 1:16465756-16465778 TCTGGCCTAGACCCTCTGGAAGG - Intergenic
903992346 1:27282291-27282313 TATGAGCTAGAGCACCTGAAGGG + Intronic
904474281 1:30754937-30754959 TAGGACCTTGAGCATCTGGATGG - Intronic
906188232 1:43878073-43878095 TATGACCTAGAGCATCTGGAGGG - Intronic
906651506 1:47516127-47516149 TATGACATAGAGCAAAAGGAAGG - Intergenic
907327860 1:53652549-53652571 TATGACCATGAGCCCCTGGAGGG + Intronic
908826111 1:68134328-68134350 TGTGACCTTGTGCATTTGGAAGG - Intronic
908943938 1:69471324-69471346 TATCAGCTAGAGCAGCTGAAAGG - Intergenic
910498153 1:87856586-87856608 TATCCCCTGGAGCCTCTGGAAGG - Intergenic
911467218 1:98270879-98270901 TATGATATTGAGCATCAGGATGG - Intergenic
913162761 1:116159985-116160007 TATGACCAAAATCATCAGGAAGG - Intergenic
914254934 1:145954195-145954217 TCTCCCCTAGAGCTTCTGGAGGG + Intronic
915250551 1:154585238-154585260 TATGACCTGGAGATCCTGGACGG - Exonic
918009043 1:180569466-180569488 TCTCCCCTAGAGCCTCTGGAGGG + Intergenic
919232985 1:194799774-194799796 TGTGACCTAGAGCCTCCAGAAGG + Intergenic
920362522 1:205429169-205429191 AATGACCTAGAGAGTATGGAAGG + Intronic
921821591 1:219623074-219623096 TAGGACCTAGAGCCTTTGGGAGG + Intergenic
923982152 1:239337185-239337207 TCTGCCCTAGAGTCTCTGGAGGG - Intergenic
924030877 1:239884395-239884417 TCTCTCCTAGAGCCTCTGGAGGG + Intronic
1063206809 10:3840033-3840055 TATGGCTTAGAATATCTGGAGGG + Intergenic
1063868958 10:10397708-10397730 TTTCCCCTAGAGCCTCTGGAGGG + Intergenic
1064985661 10:21207600-21207622 CATGACCTTGAGCTTCTGGTTGG + Intergenic
1068525772 10:58127728-58127750 TATCCCATAGAGCCTCTGGAGGG - Intergenic
1075245482 10:120818501-120818523 TCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1075662484 10:124207717-124207739 TCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1076485272 10:130811587-130811609 TTTGACCAATAGAATCTGGAGGG + Intergenic
1078466205 11:11552404-11552426 AAAGACCAAGAGCTTCTGGAAGG + Intronic
1078693318 11:13603780-13603802 TATGCCCTAGAGATACTGGATGG - Intergenic
1086557502 11:88128483-88128505 AATCACCTAGGCCATCTGGAGGG + Intronic
1086618747 11:88858695-88858717 TATGAACTAGAGTTGCTGGAGGG - Intronic
1087815661 11:102655634-102655656 TATCCCCTAGAGCTTCTAGAGGG - Intergenic
1087823358 11:102736689-102736711 GAGGAGCTAGAACATCTGGAAGG - Intergenic
1092128825 12:6094110-6094132 AAGGACCTAGAGCCTCTGGAAGG + Intronic
1095581866 12:43809040-43809062 TCTGACCTAGATCATCTGTGTGG + Intergenic
1098439649 12:70504408-70504430 TCTGTCCTTGAGCCTCTGGATGG + Intergenic
1098965534 12:76783946-76783968 TCTCCCCTAGAGCCTCTGGAGGG + Intronic
1099092713 12:78333678-78333700 TCTCATCTAGAGCCTCTGGAGGG + Intergenic
1100779914 12:98013387-98013409 TAAGAAATACAGCATCTGGATGG + Intergenic
1100930125 12:99598937-99598959 TTTCCCCTAGAGCCTCTGGAGGG - Intronic
1104587698 12:130060798-130060820 TGTGCCCTAGAGCCTCTGCAGGG + Intergenic
1107056506 13:36110479-36110501 TATAATTTAGAGCATCTGAATGG + Intronic
1108219661 13:48220393-48220415 TCTCACCTGGAGCATCTGGAGGG + Intergenic
1109658626 13:65428568-65428590 AATGACCTTAAGCATCTTGAAGG + Intergenic
1112207200 13:97336641-97336663 TCTCCCCTAGAGCCTCTGGAGGG + Intronic
1114148189 14:20003050-20003072 TCTGACCCAGAGCTTCTGCATGG - Intergenic
1114284090 14:21223465-21223487 CATGAGCTATAGCATCTGGCTGG - Intronic
1119561414 14:75592850-75592872 GATAACCTAGGGCATCTGGCAGG - Intronic
1121171143 14:91855369-91855391 TCTCCCCTAGAGCCTCTGGAGGG - Intronic
1126075054 15:44901016-44901038 TCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1126083310 15:44986805-44986827 TCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1126548594 15:49901918-49901940 TTAGATCTAGAGCATTTGGAGGG - Intronic
1128567916 15:68713550-68713572 TTTCTCCTAGAGCATCTGTAGGG - Intronic
1128976684 15:72159452-72159474 TATGACCCAGAGCCTATGTAAGG - Intergenic
1129923840 15:79344401-79344423 TCTTCCCCAGAGCATCTGGAAGG - Intronic
1130914230 15:88292047-88292069 ATGGACCTAAAGCATCTGGATGG - Intergenic
1132083184 15:98884717-98884739 TATGTCCAGGACCATCTGGAAGG - Intronic
1135527025 16:23221386-23221408 TTTCCCCTAGAGCCTCTGGAGGG - Intergenic
1135829027 16:25756965-25756987 TATGACCAAGAGCAACCTGAGGG + Intronic
1138863206 16:60785012-60785034 TATGGCCAAGAGAATCTGGAGGG + Intergenic
1141603029 16:85137639-85137661 TGTGACCTCCAGCTTCTGGACGG + Intergenic
1145376673 17:22355846-22355868 TTGGACCTAGAGCAGCAGGAGGG + Intergenic
1148405795 17:47414083-47414105 TATGTCATAGAGCATCTCTAGGG + Intronic
1151025501 17:70671830-70671852 TCTGCCCTCGAGCCTCTGGATGG + Intergenic
1151400947 17:73855676-73855698 TCTTCCCTAGAGCCTCTGGAAGG + Intergenic
1151874482 17:76859094-76859116 TCTCCCCTAGAGCCTCTGGAAGG - Intergenic
1156170043 18:34471927-34471949 TCTGCCCTAGAGCATATGGAAGG - Intergenic
1156257464 18:35411393-35411415 TGTGACCTGGAGCATTAGGAGGG - Intergenic
1157635838 18:49153500-49153522 GATGAACTGGAGCATCTTGATGG + Intronic
1162874652 19:13611787-13611809 TCTTCCCTAGAGCCTCTGGAAGG + Intronic
1162897809 19:13775891-13775913 GATGACCTATGGCATCTGGAAGG - Intronic
925802994 2:7619958-7619980 TATGACCCATAGCAATTGGAAGG - Intergenic
929458599 2:42084754-42084776 TATGAACAAGAGGATGTGGAAGG + Intergenic
932842420 2:75095833-75095855 TACCACCTGGAGCATCTAGAAGG - Intronic
934167478 2:89307340-89307362 TGTGACCTGGAGCACCTGGGAGG - Intergenic
934199797 2:89875106-89875128 TGTGACCTGGAGCACCTGGGAGG + Intergenic
935586492 2:104804333-104804355 TCTCCCCTAGAGCCTCTGGAGGG - Intergenic
936632078 2:114214594-114214616 TGTAACCTAGGGCGTCTGGAGGG + Intergenic
938694040 2:133819309-133819331 TATGAACAAGAACATCTGAATGG + Intergenic
938960240 2:136334317-136334339 TCTTCCCTAGAGCCTCTGGAGGG - Intergenic
939320175 2:140609836-140609858 TATTACCTAGAGTTGCTGGATGG - Intronic
941031052 2:160512137-160512159 AATTATCTAGAGCCTCTGGATGG - Intergenic
945579358 2:211573257-211573279 TTTTCCCTAGAGCTTCTGGAGGG + Intronic
946806498 2:223476015-223476037 AAAACCCTAGAGCATCTGGAGGG + Intergenic
947228797 2:227865000-227865022 AATGGCCTAGAGGATCTGGAAGG - Intergenic
948604383 2:239125675-239125697 TTTGACATAGAGCATCTTTAAGG - Intronic
1170268824 20:14500540-14500562 TACCACGAAGAGCATCTGGAAGG - Intronic
1170879279 20:20280329-20280351 TCTTCCCTAGAGCCTCTGGAGGG + Intronic
1171080767 20:22181204-22181226 TATGACCTAGACAATTTTGAGGG + Intergenic
1172107145 20:32523542-32523564 TATTAACTAGAGCATCTGCTAGG - Intronic
1172582805 20:36061900-36061922 TCTTCCCCAGAGCATCTGGAGGG - Intergenic
1173605926 20:44331443-44331465 CATGACCTAGATCATCTCTAAGG + Intergenic
1173946768 20:46957688-46957710 TCTCACCTGGAGCCTCTGGATGG + Intronic
1174711645 20:52712462-52712484 TATCACATAGAGTATATGGAAGG + Intergenic
1176958495 21:15133230-15133252 TCTGCCCTATAGCATCTGAAAGG - Intergenic
1177653367 21:23985773-23985795 TCTGTCCTAGAGCCTCTGGAAGG - Intergenic
1181161582 22:20963050-20963072 GATGACCTAGAGCAGCTGGGAGG - Intergenic
1183346317 22:37310247-37310269 TATGACATAGAGCTTCTCGGGGG - Intronic
1184056839 22:42058282-42058304 TGTGAGCTAGAGTATCTGAAAGG - Intronic
1185058077 22:48591648-48591670 GGTGACCCAGAGCAGCTGGAAGG + Intronic
950461583 3:13125354-13125376 AATGACAGAGAGCAGCTGGAGGG - Intergenic
951942915 3:28101360-28101382 AATGGCCTATAGCATTTGGAAGG + Intergenic
952748236 3:36802347-36802369 TTTGATCTACAGCACCTGGAGGG - Intergenic
953542870 3:43837737-43837759 TCTCTCCTAGAGCCTCTGGAAGG - Intergenic
954594390 3:51812898-51812920 TCTCCCCTAGAGCTTCTGGAAGG - Intergenic
954952591 3:54488539-54488561 TATGACCTAGAGAGTCAGGATGG - Intronic
960373565 3:116870726-116870748 TATGACCTAAAGCAACAGGAGGG - Intronic
962780391 3:138709548-138709570 GATGACCTAGGGACTCTGGATGG + Intronic
964670374 3:159218880-159218902 TCTCTCCTAGAGCCTCTGGAAGG - Intronic
965056621 3:163725353-163725375 TCTAACCTAGAGGCTCTGGAAGG - Intergenic
966278291 3:178201765-178201787 TATTCCCTAGAGCCTTTGGATGG - Intergenic
967282940 3:187839948-187839970 TATGCCCTAGAGGGTCTGCAAGG + Intergenic
967671639 3:192242753-192242775 TATGGCCAAGTGTATCTGGAAGG - Intronic
967698808 3:192567608-192567630 TCTCACCTAGAGCTTTTGGAAGG - Intronic
968316913 3:197732688-197732710 TAAGCCCCAGAGCATCTGGCTGG + Intronic
969048442 4:4355661-4355683 TGTCACCTAGAGCCTTTGGAAGG - Intronic
969282271 4:6178759-6178781 CATGACCTAGAGAATTTGGTAGG - Intronic
971818593 4:31522507-31522529 TATGGCCTTGAGCAGCTGGCTGG + Intergenic
972874950 4:43347067-43347089 TATTTTCTAGAGCCTCTGGAGGG - Intergenic
972918244 4:43905812-43905834 TATCACATGGAGCATCAGGAAGG + Intergenic
973611341 4:52638365-52638387 TCTCCCCTAGAGCCTCTGGAAGG + Intronic
973800280 4:54470802-54470824 CATGACCTTGAGAATCTGGTGGG + Intergenic
975621924 4:76305205-76305227 TGTGATCTGGAGCAACTGGAGGG + Intronic
977767715 4:100819991-100820013 GATGACCTATAAAATCTGGAAGG - Intronic
978842305 4:113229256-113229278 TCTCACCTAGAGCCTCCGGAAGG - Intronic
980609295 4:135136605-135136627 TCTGCCCTAGGGAATCTGGAAGG + Intergenic
981541501 4:145851126-145851148 TTTCCCCTAGAGCCTCTGGAAGG + Intronic
983555540 4:169056073-169056095 TATGAACCAGATCATCTGGTGGG - Intergenic
984846300 4:184110840-184110862 TATGACCAAGAGCGTCTTAACGG + Intronic
985374132 4:189315259-189315281 GATGACCTAGGGTATCAGGAGGG - Intergenic
987181583 5:15373535-15373557 TTTCTCCTAGAGCCTCTGGATGG - Intergenic
989093101 5:37755071-37755093 ACTGACATAGAGCTTCTGGAAGG - Intergenic
989519294 5:42382118-42382140 TATGACCTAAGTAATCTGGATGG - Intergenic
993845075 5:92931230-92931252 TCTTCCCTAGAGCTTCTGGAAGG + Intergenic
996414683 5:123197485-123197507 TATTCCCTAGAGCGTTTGGAGGG + Intergenic
996650188 5:125866447-125866469 CTTGATCTAGAGCAACTGGAAGG - Intergenic
996982803 5:129520007-129520029 TCTGACTTAGTGCATCTGGATGG - Intronic
997639945 5:135442561-135442583 TGTGACCTTCAGCATCTGTAAGG - Intergenic
998161923 5:139817835-139817857 AAAGACCTAGAGCATCTGGCAGG - Intronic
1001581078 5:172798909-172798931 CATGACAGAGAACATCTGGAAGG + Intergenic
1001945639 5:175775315-175775337 CAGGATCTGGAGCATCTGGATGG - Intergenic
1004678365 6:17866598-17866620 TATCACCTAGTGCATGTAGAGGG + Intronic
1004923424 6:20398022-20398044 TCTCTCCTAGAGCCTCTGGAGGG - Intergenic
1005105347 6:22218665-22218687 TCTCCCCTAGAGCCTCTGGAAGG + Intergenic
1008586780 6:52957901-52957923 TATGAGCTAGAGCATTTATAGGG - Intergenic
1012205830 6:96459186-96459208 TATCCCCTAGAGCTTTTGGAGGG + Intergenic
1018836791 6:167491226-167491248 TCTCCCCTAGAGCCTCTGGAAGG - Intergenic
1018918877 6:168156958-168156980 CATGGCTTAGAACATCTGGACGG - Intergenic
1020828595 7:13064261-13064283 TTTGAGCTTGAGCATCTGGGAGG - Intergenic
1023980191 7:45065080-45065102 TATGACCAAGAGCTCCTGGGAGG - Intronic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1026511316 7:71029488-71029510 CCTGCCCTAGAGCATCTGGCCGG - Intergenic
1028943501 7:96551855-96551877 TCTCCCCTAGAGCCTCTGGAAGG + Intronic
1031966133 7:128029891-128029913 CATGACCCAGAGCTTCTTGAGGG + Exonic
1032168353 7:129563493-129563515 TCTCTCCTAGAGCCTCTGGAAGG - Intergenic
1033189659 7:139265816-139265838 TCTTCCCTAGAGCCTCTGGAGGG + Intronic
1033915459 7:146319147-146319169 TCTGACCTAGAGGATAAGGAGGG - Intronic
1034972315 7:155427025-155427047 TCTGACCTATAGGACCTGGAAGG + Intergenic
1038415448 8:27391619-27391641 TACAACCTGGTGCATCTGGAGGG + Intronic
1039422171 8:37452265-37452287 TATGAACTTGTGCTTCTGGAGGG - Intergenic
1039965911 8:42283623-42283645 TCTCCCCTAGAGCCTCTGGATGG + Intronic
1043927961 8:86059434-86059456 TTTCCCCTAGAGCCTCTGGAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046165695 8:110431986-110432008 TCTCTCCTAGAGCCTCTGGAGGG - Intergenic
1047303445 8:123634574-123634596 TCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1048123320 8:131605976-131605998 TATCTCCTTCAGCATCTGGAAGG - Intergenic
1051869106 9:21715951-21715973 GATGACCTAGGGTATCTGGCAGG - Intergenic
1052620226 9:30899142-30899164 TAGGATCTAAAGAATCTGGAAGG - Intergenic
1057792708 9:98134655-98134677 TCTTCCCTAGGGCATCTGGAGGG + Intronic
1057967454 9:99517963-99517985 TCTTCCCTAGAGCCTCTGGAGGG + Intergenic
1058313676 9:103537000-103537022 CATGTCCTAGAGAATCTGGTAGG - Intergenic
1060762837 9:126270679-126270701 TCTCTCCTAGAGCCTCTGGAGGG + Intergenic
1185822725 X:3220385-3220407 CCTCACCTAGAGCCTCTGGAGGG - Intergenic
1188450433 X:30302875-30302897 TTTCACCTAGACCTTCTGGAAGG - Intergenic
1190468191 X:50748440-50748462 TAGGACCTAGATCAGCTGGAGGG + Intronic
1191995731 X:67093395-67093417 GATAACCTAGGGTATCTGGAAGG + Intergenic
1192498435 X:71632341-71632363 TCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1193734471 X:85140526-85140548 TATATCCTAGTTCATCTGGATGG + Intergenic
1193741627 X:85224169-85224191 TTTCCCCTAGAGCCTCTGGAGGG - Intergenic
1198979666 X:142380633-142380655 AATGAACTAGTGTATCTGGAAGG + Intergenic
1199610335 X:149607104-149607126 TGGGACCTAGAGCACCAGGAAGG - Intronic
1200136528 X:153877762-153877784 CCTAACCTGGAGCATCTGGAAGG - Intronic
1200179103 X:154139663-154139685 TGTGACTTAGAGCGGCTGGACGG + Intergenic
1201265955 Y:12206787-12206809 TGTTTCCTAGAGCATCTAGAAGG + Intergenic
1201332849 Y:12846039-12846061 TAGGGCCTAGAGAAGCTGGAAGG - Intronic