ID: 906189257

View in Genome Browser
Species Human (GRCh38)
Location 1:43885431-43885453
Sequence CTCGCGTGCCGGGGTGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 8, 3: 14, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906189246_906189257 27 Left 906189246 1:43885381-43885403 CCTTCTCACGCACTCACACACAC 0: 1
1: 2
2: 154
3: 1288
4: 7067
Right 906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG 0: 1
1: 0
2: 8
3: 14
4: 92
906189247_906189257 5 Left 906189247 1:43885403-43885425 CCCTGCTGAAACCTGATCCTGAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG 0: 1
1: 0
2: 8
3: 14
4: 92
906189250_906189257 -6 Left 906189250 1:43885414-43885436 CCTGATCCTGAGGCTGCCTCGCG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG 0: 1
1: 0
2: 8
3: 14
4: 92
906189248_906189257 4 Left 906189248 1:43885404-43885426 CCTGCTGAAACCTGATCCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG 0: 1
1: 0
2: 8
3: 14
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906189257 Original CRISPR CTCGCGTGCCGGGGTGCTGG CGG Intronic
900313313 1:2045031-2045053 CGCGGGTCCCGGGCTGCTGGCGG - Intergenic
902080854 1:13819772-13819794 CTCACGTGGCGGGGGCCTGGGGG + Intronic
902466554 1:16622104-16622126 CTCTCGTGCAGGGGAGTTGGCGG - Intergenic
902508105 1:16950942-16950964 CTCTCGTGCAGGGGAGTTGGCGG + Exonic
905390628 1:37633791-37633813 CGCGCTTGCGGGGGTGATGGAGG - Intronic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
915461721 1:156074666-156074688 CTCGGTTGCCGGGGGGCAGGTGG - Exonic
921257109 1:213352441-213352463 CTCGTGGGAGGGGGTGCTGGTGG + Intergenic
922413445 1:225397568-225397590 CTCTCCTGCAGGTGTGCTGGAGG - Intronic
1062812866 10:478705-478727 CTCGTGTCCGGGCGTGCTGGGGG + Intronic
1069424675 10:68279022-68279044 CTCTCCAGCCGGGGTGGTGGCGG + Intergenic
1071273081 10:84026781-84026803 ATGGCCTGCTGGGGTGCTGGTGG + Intergenic
1072485351 10:95849451-95849473 CTCTCTTGCTGGGGTCCTGGAGG - Intronic
1076190628 10:128480861-128480883 CTGGAGTGCCTGCGTGCTGGGGG - Intergenic
1076806014 10:132859039-132859061 CTCCCGTGCAGGGGTCGTGGAGG + Intronic
1081997676 11:47375784-47375806 CCAGCGTGCGGGGGTGCTGCAGG - Intronic
1083306147 11:61762881-61762903 CTCCCGTGCCAGGGTCCGGGCGG - Intronic
1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG + Intergenic
1084270533 11:68027026-68027048 CTCGGGGGCCTGGGAGCTGGGGG - Intronic
1084590796 11:70088965-70088987 CTCGAGTGCCTGGCTGCTGCGGG + Intronic
1088663782 11:112074323-112074345 CTCGCGTGGCGGGGGGTAGGGGG - Exonic
1090641964 11:128737393-128737415 CTCGTGTTCCGGTGTGGTGGGGG - Intronic
1091759604 12:3077869-3077891 CGCGGGTGCCGGGGGGCTGCAGG - Intronic
1093366228 12:18302624-18302646 CTCGCATGCTTGGGTCCTGGTGG + Intronic
1105027108 12:132856751-132856773 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027125 12:132856814-132856836 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027143 12:132856879-132856901 CTCACTTGCCTGGGTGCTGGTGG + Intronic
1105027153 12:132856912-132856934 CTCACTTGTCTGGGTGCTGGTGG + Intronic
1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG + Intronic
1105027180 12:132857008-132857030 CTCACGTGCCTGGGTGCTGGTGG + Intronic
1105027190 12:132857041-132857063 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027201 12:132857074-132857096 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027211 12:132857107-132857129 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027220 12:132857140-132857162 CTCACGTGCCCGGGTGCTGCTGG + Intronic
1105027230 12:132857172-132857194 CTCACGTGCCCAGGTGGTGGTGG + Intronic
1105027248 12:132857235-132857257 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027259 12:132857268-132857290 CTCACGTGCCCGGGTGCTGGTGG + Intronic
1105027268 12:132857301-132857323 CTCACGTGCCCGGGTGCTGCTGG + Intronic
1105027279 12:132857333-132857355 CTCACGTGCCTGGGTGGTGGTGG + Intronic
1108199063 13:48024783-48024805 GTCGGGGGCTGGGGTGCTGGGGG + Intergenic
1109626904 13:64986344-64986366 CTCGGGGGGTGGGGTGCTGGGGG - Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1115566459 14:34629625-34629647 CACGCGGGGCGGGGTGCAGGTGG - Intronic
1118186429 14:63542745-63542767 CGGGCGAGCCGCGGTGCTGGAGG + Intronic
1119330036 14:73786959-73786981 CTGGGGTGCCGGGGTGCTGCAGG - Intronic
1121291507 14:92779689-92779711 CAGGCGTGCAGGTGTGCTGGAGG - Intergenic
1121342801 14:93115433-93115455 CTCGCGAGCCGGTGGGCGGGCGG - Intronic
1122541741 14:102501861-102501883 CTCTGCTTCCGGGGTGCTGGGGG - Exonic
1129329400 15:74819255-74819277 CTCACCTGCCAGGGTGCCGGTGG - Exonic
1132640213 16:974758-974780 CTGCCAGGCCGGGGTGCTGGGGG - Intronic
1134015995 16:10888809-10888831 TTCCCTCGCCGGGGTGCTGGGGG + Intronic
1135673571 16:24395196-24395218 CTCACTTTTCGGGGTGCTGGTGG - Intergenic
1140098746 16:71896234-71896256 CTCTTCTTCCGGGGTGCTGGAGG + Intronic
1140407361 16:74719568-74719590 CTGGAGTGCTGGAGTGCTGGAGG + Intronic
1142407691 16:89900224-89900246 CTCGCGTGGCGGGCTGCTCTCGG + Intronic
1144620502 17:16815642-16815664 CTCAGGTGCCGGGGTGCCGTGGG - Intergenic
1146057519 17:29588868-29588890 TACGCCTGCCGGGGTGGTGGAGG - Intronic
1147562334 17:41516774-41516796 CTCGGGTTCAGGGGTGATGGGGG + Intronic
1152757440 17:82092864-82092886 CCGGGGTTCCGGGGTGCTGGGGG - Intronic
1157590067 18:48831162-48831184 CTTGCTTGCTGGGGTGATGGGGG - Intronic
1163035490 19:14566723-14566745 GTTGCGGGCCGGGGTGTTGGGGG + Intronic
1163697212 19:18769972-18769994 CTCGCCTGCGTGGGTGATGGAGG - Intronic
1167449149 19:49556845-49556867 CGTGCGTGCCGGGGCGCTGTGGG + Intronic
1168062036 19:53898560-53898582 CTGGGGGGCCGGGGTCCTGGCGG + Exonic
1168712730 19:58511277-58511299 CTCTGGGGCCCGGGTGCTGGTGG - Exonic
927918226 2:26950170-26950192 CCTGGGTGCTGGGGTGCTGGAGG - Exonic
932316886 2:70790557-70790579 CCCGCAAGCCGAGGTGCTGGAGG - Exonic
935692732 2:105745215-105745237 CTCGCGGGCCGGGGTGCGCCCGG + Intronic
937310399 2:120899112-120899134 CTCTCCTGGCGGGGTGCAGGAGG - Intronic
938246087 2:129779105-129779127 GACGCGTGCAGGGGTGCTGCTGG + Intergenic
938540435 2:132280324-132280346 CTCCCGTGAGGGGGTGCTGGTGG - Intergenic
948823243 2:240560840-240560862 CGCGCGGGCCGGGCTGCTGGCGG - Exonic
1171869358 20:30513329-30513351 CTCCCGTGAGGGGGAGCTGGTGG - Intergenic
1172474290 20:35226171-35226193 CTCCTGGGCCGGGGTGGTGGGGG - Intergenic
1178872657 21:36389159-36389181 CTGCAGTGCCGGGCTGCTGGAGG + Intronic
1178942971 21:36922989-36923011 CTCCCGGGCCGCGGAGCTGGTGG - Intronic
1179162905 21:38912577-38912599 CGTGGGTGCCGGGGGGCTGGGGG + Intergenic
1180090585 21:45531851-45531873 CTCGCGCGCTGCGGTGCTGCTGG - Exonic
1180251911 21:46595756-46595778 CTTGCCTGCCAGGTTGCTGGTGG + Intergenic
1182093643 22:27612311-27612333 CACGGGTGCCGGGGGGTTGGGGG - Intergenic
1183903399 22:41022368-41022390 CTCGCGTCCCGGGGGGCGAGTGG + Intergenic
1185362777 22:50418987-50419009 CTGGTGGGCCGTGGTGCTGGTGG + Intronic
950455896 3:13092567-13092589 AGCGCGTGCCTGGGTGCTGGGGG + Intergenic
955228547 3:57079665-57079687 CTCTCGTGCCGGGGTGGTAGGGG + Intergenic
965077892 3:164002537-164002559 CTGTCGTGGCAGGGTGCTGGGGG + Intergenic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
969261303 4:6035859-6035881 CAAGGGTGCCGGGGTGCTGTGGG + Intronic
969314217 4:6371889-6371911 TTGGCCTGCCGGGGGGCTGGTGG - Intronic
969611476 4:8229765-8229787 CTGGGGTGCCGGGTTTCTGGAGG - Intronic
969711848 4:8849233-8849255 CTCCCGTTCTGGGGTGCTGCCGG - Intronic
969971712 4:11054683-11054705 CTTGTGTGCAGAGGTGCTGGAGG - Intergenic
971196297 4:24473457-24473479 CACGCGCGCGGGGGGGCTGGAGG - Intergenic
973230811 4:47837403-47837425 CTCGGGCGCCGGGTGGCTGGAGG - Intronic
973923906 4:55717477-55717499 GTCGCGTTCTGGGGTGCTGGGGG + Intergenic
982422149 4:155209934-155209956 CTCGGGTGGTGGGCTGCTGGGGG + Intronic
992765094 5:79991125-79991147 CTCGCGGGCCAGGGCGCAGGAGG - Intronic
995712856 5:115052445-115052467 CTCGCCCTCCTGGGTGCTGGAGG + Intergenic
997356412 5:133265743-133265765 CAGCCGTGCAGGGGTGCTGGGGG - Intronic
999188570 5:149730609-149730631 GGCGCGTGCCGGAGCGCTGGGGG + Intronic
1003552192 6:7109016-7109038 CTCGCGGGCGGGGGGGGTGGGGG + Intronic
1011418977 6:87152298-87152320 CTCGCGTGCTGGGGCGAGGGCGG + Intergenic
1014001443 6:116370661-116370683 CTGGCGGGCGGGGGTGCGGGTGG + Intronic
1019149137 6:169992861-169992883 CCCGCCTGGCCGGGTGCTGGAGG - Intergenic
1020027793 7:4911287-4911309 CTCGAGGGCCGGGGTCCTGGTGG - Intronic
1020070478 7:5223806-5223828 CTTGGGTGCCAGGGTGCTGGCGG - Intronic
1029220885 7:98989341-98989363 CTGGCGTGCTGGGGTGGTTGTGG + Intronic
1032011700 7:128351654-128351676 CTCGCGTGCCGCCGCGCTGCTGG - Exonic
1035222133 7:157412281-157412303 CTCCGGTGTCAGGGTGCTGGTGG + Intronic
1036910525 8:12754549-12754571 GTCGGGTCTCGGGGTGCTGGGGG - Intronic
1038840234 8:31177841-31177863 CTAGGGTGCTGGGGTCCTGGTGG - Intergenic
1045516471 8:102864393-102864415 TTCGCCTGCCGGGGAGCTGCGGG - Exonic
1053003231 9:34589376-34589398 CTCGGGGGCGGGGGCGCTGGAGG - Intronic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1059153059 9:111966527-111966549 CTGGTGTGCAGGGGTGGTGGTGG + Intergenic
1200978136 Y:9235444-9235466 CTCGCGCGCCGCTGTGCAGGTGG + Intergenic