ID: 906191346

View in Genome Browser
Species Human (GRCh38)
Location 1:43901371-43901393
Sequence CAGTCTGTCCAGTGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906191346_906191359 21 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191359 1:43901415-43901437 TAAGGCCAGGCCAAAGGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
906191346_906191355 15 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191355 1:43901409-43901431 TTCAAATAAGGCCAGGCCAAAGG 0: 1
1: 1
2: 0
3: 9
4: 153
906191346_906191354 8 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191354 1:43901402-43901424 CAGGCAGTTCAAATAAGGCCAGG 0: 1
1: 0
2: 7
3: 215
4: 3512
906191346_906191356 16 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191356 1:43901410-43901432 TCAAATAAGGCCAGGCCAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 256
906191346_906191358 20 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191358 1:43901414-43901436 ATAAGGCCAGGCCAAAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 171
906191346_906191357 17 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191357 1:43901411-43901433 CAAATAAGGCCAGGCCAAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 213
906191346_906191352 3 Left 906191346 1:43901371-43901393 CCTACTTCCCACTGGACAGACTG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 906191352 1:43901397-43901419 AAAGCCAGGCAGTTCAAATAAGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906191346 Original CRISPR CAGTCTGTCCAGTGGGAAGT AGG (reversed) Intronic
900185349 1:1330797-1330819 CAGTCAGGCCAGTGGGCAGCCGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
902661221 1:17905388-17905410 CTGTCTGTCCAGGGGAAAATAGG + Intergenic
903278939 1:22239176-22239198 CAGTGTGTCCTGCTGGAAGTGGG - Intergenic
903770129 1:25758580-25758602 CTGTCTTTTCAGTGGGAACTGGG + Exonic
903955409 1:27022050-27022072 CACCCTGTCCACTGGGAAGATGG + Intergenic
904397093 1:30229238-30229260 CAGGCTGTACAGTGAGGAGTAGG - Intergenic
904627541 1:31815422-31815444 CAGCCCGTTCAGTGGGAACTGGG + Intronic
905210959 1:36373961-36373983 GACTCAGCCCAGTGGGAAGTGGG + Intronic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
905887042 1:41496946-41496968 GGGCCTGTCCAGTGGGAAATGGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906670728 1:47652522-47652544 TCTTCTGTCCAGTGGGAACTCGG + Intergenic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
908339061 1:63157838-63157860 CACAGTGCCCAGTGGGAAGTTGG + Intergenic
909559732 1:76996697-76996719 CAGTATGTACAGTTGGAAGGAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
912227450 1:107751026-107751048 CAATTTTTCCAGTGTGAAGTAGG - Intronic
913081981 1:115396581-115396603 CAGTCTTTCCAGTGCTAATTTGG - Intergenic
914330716 1:146668090-146668112 CAGCCTGTCCAGATGGGAGTTGG + Intergenic
915431417 1:155869738-155869760 ATGTCGGTCCAGTGGGAAGAGGG - Intronic
915432816 1:155879674-155879696 AAGACTGTACAGTGGGAGGTAGG - Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916590914 1:166189383-166189405 CTTTCTGCCCTGTGGGAAGTTGG + Intergenic
916884766 1:169056438-169056460 CAGTCTGTCAAGTGTGAATCAGG - Intergenic
917246164 1:173003650-173003672 CAGTCTTTTCAGTGGAAAGAAGG - Intergenic
919792317 1:201300139-201300161 CATTCTGTCCCTTGGCAAGTAGG - Intronic
920434060 1:205936838-205936860 CAGGCTCTCCTCTGGGAAGTTGG - Intronic
920754440 1:208715720-208715742 TGGTCTGTCAAATGGGAAGTTGG - Intergenic
922291313 1:224211064-224211086 CTTTCTTTCCAGTGGGAAGAGGG - Intergenic
922744293 1:228035647-228035669 CAGGCTCTCCAGGGGCAAGTGGG + Intronic
924637141 1:245798919-245798941 CAGTGAGTCCAGTTGGAAGCAGG - Intronic
1065256045 10:23869237-23869259 GACTCTTTCCAGTGGGAAGATGG + Intronic
1066500875 10:35993413-35993435 CATTCTGTCAAGTGCAAAGTGGG - Intergenic
1067207917 10:44235461-44235483 CAGTCCGTCCAGGGGCAGGTAGG - Intergenic
1067271244 10:44793048-44793070 CTGGCTGTCCAGGGAGAAGTGGG - Intergenic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1073051413 10:100669748-100669770 CCATCTGTACAGTGGGAAGCAGG - Intergenic
1075648599 10:124112637-124112659 TAGCCTGCCCAGTGGGAAGCAGG - Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869234 10:133185312-133185334 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869238 10:133185358-133185380 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869240 10:133185381-133185403 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1078856405 11:15209107-15209129 GATTTTGTCCAGTGGGAACTAGG - Intronic
1079538787 11:21547019-21547041 CAGTCTTTCCAGTCTGGAGTGGG + Intronic
1079686031 11:23360937-23360959 CCGTGTGGCCAGTGAGAAGTAGG - Intergenic
1082805395 11:57446142-57446164 TATTCTGAACAGTGGGAAGTAGG - Intergenic
1083689799 11:64400420-64400442 CAAGGTGTCCAGTGGAAAGTGGG + Intergenic
1084011046 11:66348514-66348536 GATTCTGGCCAGTGTGAAGTTGG + Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1087250013 11:95888455-95888477 GAGTCTATCCAGAGGGAACTTGG - Intronic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1091018780 11:132079743-132079765 GGGTCTGTCCAGTATGAAGTAGG + Intronic
1092893888 12:12994755-12994777 CAAACTGTCCATTGGGTAGTTGG + Intronic
1094795097 12:33962611-33962633 TTGTCTGTCCAGTGTGATGTTGG + Intergenic
1095889786 12:47224896-47224918 CAGTCTTTCCAGTGGTTATTTGG + Intronic
1096785790 12:54016609-54016631 CAGCCTGGCCCGTGGGGAGTGGG + Intronic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102662600 12:114542870-114542892 CAGTCTGTCCCGTGACATGTGGG + Intergenic
1103993871 12:124816651-124816673 CTGTCTGTGAACTGGGAAGTGGG + Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105038359 12:132942802-132942824 CTGTCTCTCCAGTGGGCTGTGGG + Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1109118699 13:58425813-58425835 CCGTCTGTCCTCTGGGAATTTGG + Intergenic
1110573834 13:77034279-77034301 CAGTCTTTCCCCTGGGAATTTGG + Intergenic
1112669064 13:101613924-101613946 CTGTTTGCTCAGTGGGAAGTAGG - Intronic
1113899714 13:113789493-113789515 CAGGCAGTCCAGGGGGATGTGGG + Intronic
1114463057 14:22900485-22900507 AATTCTGTCCAGTGGGTAGCTGG + Intergenic
1116720900 14:48494450-48494472 CATTCTTTACAGTGAGAAGTAGG + Intergenic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119153542 14:72387699-72387721 AAGTCTTCACAGTGGGAAGTAGG + Intronic
1120027087 14:79598689-79598711 GGGTCTGTCCAGTGGGTTGTGGG + Intronic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1122025328 14:98871791-98871813 CCTTCTGTACAATGGGAAGTGGG - Intergenic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129298515 15:74612655-74612677 CAAGCTGTCCAGTGGGGAGAAGG - Intronic
1129627580 15:77218838-77218860 CAGTCTGTGCAGTGTGAAATGGG - Intronic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1135834009 16:25806441-25806463 CAGACAGTCCAGGGAGAAGTGGG + Intronic
1136033913 16:27524135-27524157 CAGGCTATACAGTGGGAAGCGGG + Intronic
1138024170 16:53509937-53509959 CAGTCTTATAAGTGGGAAGTAGG - Intergenic
1138650769 16:58459903-58459925 CAGTTTCTCTAGTGGGAGGTGGG - Intergenic
1140002836 16:71042813-71042835 CAGCCTGTCCAGATGGGAGTTGG - Intronic
1140299994 16:73748056-73748078 TAGTCTATCCAGTGGGTTGTAGG + Intergenic
1140418559 16:74796406-74796428 CAGTCTGGCCAGTGGAATGTTGG - Intergenic
1140858859 16:79001745-79001767 GCGTTTGTGCAGTGGGAAGTTGG + Intronic
1141954962 16:87364581-87364603 CAGTCTGACGGGTGGGCAGTTGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1144780385 17:17805456-17805478 GACTCTGTCCACTGGGAGGTGGG - Intronic
1146158599 17:30546284-30546306 CATTCTGTCTAGTGTGAAATGGG + Intergenic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1148494799 17:48047389-48047411 CAGACTCTCCAGTGGGACCTCGG + Intergenic
1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG + Exonic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1152718300 17:81910471-81910493 CAGCCTGTCCAGTGGGTACATGG - Intronic
1153617421 18:6947598-6947620 CAGTCTTTCCCGTGGGCTGTTGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156888675 18:42165155-42165177 GAGTCTTGCCAGTGGGAAGCAGG + Intergenic
1157093824 18:44668241-44668263 CAGTCTGTCTATTGTGAAGAGGG - Intergenic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1161064790 19:2232310-2232332 CAGTCTGTTCAGTGGTCAGCAGG + Exonic
1163736891 19:18987261-18987283 CAGTTTTTCCATTGGGAAATGGG + Intergenic
1164037246 19:21466022-21466044 CACTCAGTCCAGTGGAAAGGAGG - Intronic
1164401640 19:27906000-27906022 CATGCAGTCCAGTGGGAAGGAGG - Intergenic
1164428807 19:28168898-28168920 CACTCTGACCAGGGGGATGTTGG - Intergenic
1165407510 19:35639786-35639808 GAGACTGTGCAGTGGGAAGGGGG + Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925280926 2:2683835-2683857 CAGCCTGCACAGTGGTAAGTGGG - Intergenic
927475635 2:23412380-23412402 TACTCAGTCCAGTGAGAAGTGGG + Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931902433 2:66804601-66804623 CCATCTGTCCAGGGGGAAGGGGG + Intergenic
933584041 2:84160805-84160827 CAGTCTGTCCAGGGTGCAGCTGG + Intergenic
938581843 2:132653328-132653350 AGCTCTGTCCATTGGGAAGTTGG - Intronic
938725834 2:134108348-134108370 CAGTCTGTTCAGTGCAAACTAGG - Intergenic
940192555 2:151057949-151057971 TTGTCTGTAAAGTGGGAAGTAGG + Intergenic
944346841 2:198677469-198677491 CAGTCACTCCATTGGAAAGTTGG - Intergenic
946869574 2:224073739-224073761 CAGTCTGTCCTGAGGGACATGGG - Intergenic
948600389 2:239104600-239104622 CCGTCTGTCCAGAGGGAACTTGG - Intronic
1170763901 20:19274257-19274279 CAGCCTGTCCAGTGGGCAAGGGG - Intronic
1171097628 20:22347027-22347049 TTGTCTGTCCAGAGGGAAATAGG - Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172765964 20:37351048-37351070 CAGGCTGTACTGTGGGAAGGAGG - Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1175275118 20:57763127-57763149 GAGTCTGTCCATTCGGAAGGAGG - Intergenic
1175432857 20:58919210-58919232 CAGGCTCTCCTGTGGTAAGTGGG + Intergenic
1177543164 21:22521258-22521280 CAGTCTGTGAGGTGGGAAATGGG + Intergenic
1179105988 21:38400928-38400950 GAGATTGCCCAGTGGGAAGTGGG - Intronic
1179507434 21:41851255-41851277 CAGTCTGAACAGTGAGAACTGGG + Intronic
1179571641 21:42282102-42282124 CAGGCTGCCCAGTGCCAAGTGGG - Intronic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1179951321 21:44710336-44710358 CGGGCTGTGCAGTGGGAGGTAGG - Intronic
1180913166 22:19467563-19467585 CAGTATGTCCAGTGGAAGGAGGG - Intronic
1181333240 22:22111049-22111071 CAGTCTGGCCAGTGAGCAGCAGG + Intergenic
1181432031 22:22887711-22887733 CAGGCTGCCCTTTGGGAAGTGGG + Intronic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1183747645 22:39700780-39700802 CGTTCTGTCCAGTGGGATGTGGG - Intergenic
1183779912 22:39992815-39992837 CAATCTGCCCAGTGGGAACTGGG - Intergenic
1185358156 22:50387575-50387597 CAGCCTATCCAGTGGTATGTTGG + Intronic
951669483 3:25164123-25164145 CAGTCTGGCCACTGGGGAGAAGG + Intergenic
952171866 3:30815974-30815996 TCGTCTGTACAGTGGGAAGGGGG + Intronic
955484007 3:59417631-59417653 CAGTGTGGCCAGTGGTATGTGGG + Intergenic
956362990 3:68469286-68469308 ATTGCTGTCCAGTGGGAAGTAGG + Intronic
960010091 3:112824401-112824423 GAAGCTGTCCAGTTGGAAGTTGG + Intronic
960338250 3:116444947-116444969 CAGGCAGTCCTGTGGGAAGAAGG + Exonic
961664881 3:128488849-128488871 CAGTCTGTACAATGGGAGGGAGG - Intronic
962036043 3:131652887-131652909 CAGACTATACAGTGGGCAGTTGG - Intronic
962907147 3:139814324-139814346 GGGCCTGTCCAGTGGGAGGTGGG + Intergenic
964501697 3:157355036-157355058 CCGTCTGTCCTGTGGAAAGAAGG - Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
970025917 4:11623950-11623972 GTGTCTGTCCTGTGGGAATTAGG + Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
981048762 4:140290845-140290867 CAGACTGTCCACTGTGATGTGGG - Intronic
983760923 4:171405486-171405508 CAGCCTGGCCAGTTAGAAGTAGG + Intergenic
984543487 4:181070484-181070506 CTGTCTGTCAACTGGGAAGTGGG - Intergenic
984607253 4:181799872-181799894 CAGCCTGTCTATTAGGAAGTGGG + Intergenic
985216149 4:187656446-187656468 CAGCCTCTCCAGTGGGAGGCAGG + Intergenic
985886737 5:2686059-2686081 GAGTCTGTCCAGGAGGGAGTGGG + Intergenic
987084829 5:14458589-14458611 ATCTCTGTCCAGTGGGAAATCGG + Intronic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
992979191 5:82149814-82149836 CTGTCTGTCCTATGGGAAGGTGG + Intronic
994530688 5:100966546-100966568 AAGACTGTCCAGTGAGATGTGGG + Intergenic
1000576577 5:162982466-162982488 CATTCTGTTCACTGTGAAGTAGG + Intergenic
1001601170 5:172929491-172929513 CAGTGTCTCCAGTGGGCATTTGG + Intronic
1001836114 5:174834142-174834164 CAGTCTTTCATGTGGGAAGCTGG - Intergenic
1006014638 6:31070618-31070640 CAGTCTGTCCACTGGGGAGGGGG - Intergenic
1006562801 6:34928107-34928129 CAGAGTGTCCAGTGGGACTTGGG + Intronic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1007653698 6:43439098-43439120 AAGCCTTCCCAGTGGGAAGTGGG - Intronic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011656438 6:89556099-89556121 CAGTCTGCCCCCTGGCAAGTGGG + Intronic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014509365 6:122302096-122302118 CATTCTGTCCAGTGGACAGTGGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018483280 6:164213692-164213714 TAGCCTGTCCAGTGGGCAGAAGG + Intergenic
1018720011 6:166565362-166565384 CAGTCAGTCCCGAGGGAAGCTGG - Intronic
1021474927 7:21050122-21050144 CAATCTTTCCAGTGAGAAGTGGG - Intergenic
1022878810 7:34564691-34564713 CAGTATGTCCAGTAGGGACTGGG + Intergenic
1023636625 7:42217935-42217957 CAGCCTGTGAAGTGTGAAGTAGG + Intronic
1028473866 7:91232850-91232872 CAGGCTGGCCAGTGGGAATTTGG + Intergenic
1029728727 7:102425602-102425624 CACTCACTCCAGTGGGAAGTGGG + Exonic
1033622675 7:143076394-143076416 CTGTCTGCCTAGTGGGAAGCGGG + Intergenic
1034981971 7:155484838-155484860 ACGTCTGTCCAGTGGGAGCTCGG - Intronic
1037047117 8:14320758-14320780 CAGTCTGTCATGTAGGAAGCTGG + Intronic
1037797432 8:22008268-22008290 CATTTTTTCCAGTGGGGAGTTGG - Intergenic
1038625148 8:29185222-29185244 AAGTTGGTCCACTGGGAAGTTGG - Intronic
1038700662 8:29846682-29846704 GTGTCTGGCCAGTGGCAAGTGGG - Intergenic
1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048837171 8:138531029-138531051 AAGTCTATGCATTGGGAAGTTGG + Intergenic
1049133578 8:140872525-140872547 CAGTCAGTCCAGGGGCAGGTGGG - Intronic
1053263016 9:36687113-36687135 AAGTAAGTCCAGTGAGAAGTTGG + Intergenic
1053415754 9:37945858-37945880 ACATCTGTCCAGTGGGGAGTTGG - Intronic
1056124482 9:83521734-83521756 CTTACTGTGCAGTGGGAAGTTGG - Intronic
1057466059 9:95315800-95315822 CAGCCTGGCCAGTAGAAAGTTGG - Intronic
1057802472 9:98198618-98198640 CAGCCTGTGAAGTGGGCAGTGGG + Intergenic
1058654272 9:107205740-107205762 CAGTCTCTCCAGCTGAAAGTGGG - Intergenic
1059237500 9:112774142-112774164 CAGACTCTCCAGTGGGGATTTGG - Intronic
1060472451 9:123959524-123959546 CACTGTGTCCAGTGGGAAAGAGG - Intergenic
1060997468 9:127883238-127883260 CTGTCTGTCCACTGGGGAGGGGG - Intergenic
1061296947 9:129681996-129682018 CAGCCTGTACCGTGGGAAGGTGG - Intronic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1194195243 X:90883826-90883848 GATTCTGTCCAGTGAGAAGTGGG + Intergenic
1195670021 X:107461859-107461881 GAGTCTGGGCATTGGGAAGTGGG - Intergenic
1197540304 X:127751431-127751453 CATTCTGTCCATTGGGAAGTAGG - Intergenic
1199188415 X:144942081-144942103 CACTCTGTTCATTGGGAACTCGG + Intergenic
1199608586 X:149595286-149595308 CATGCAGTCCAGTGGGGAGTCGG + Intergenic
1199630536 X:149774074-149774096 CATGCAGTCCAGTGGGGAGTCGG - Exonic