ID: 906192644

View in Genome Browser
Species Human (GRCh38)
Location 1:43907896-43907918
Sequence GACGGCAAACAGGGAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906192644_906192648 1 Left 906192644 1:43907896-43907918 CCAGTGTCTCCCTGTTTGCCGTC 0: 1
1: 0
2: 1
3: 12
4: 168
Right 906192648 1:43907920-43907942 GTTTCTCAGCCTCTCCATCCTGG 0: 1
1: 0
2: 4
3: 24
4: 248
906192644_906192652 24 Left 906192644 1:43907896-43907918 CCAGTGTCTCCCTGTTTGCCGTC 0: 1
1: 0
2: 1
3: 12
4: 168
Right 906192652 1:43907943-43907965 CTTCCAAAGCCACTCTCACCTGG 0: 1
1: 0
2: 1
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906192644 Original CRISPR GACGGCAAACAGGGAGACAC TGG (reversed) Intronic
900506337 1:3031478-3031500 GATGGCATCCAGGGACACACGGG + Intergenic
902609446 1:17588509-17588531 GGTTGGAAACAGGGAGACACCGG + Intronic
904162423 1:28531552-28531574 AAAGGGAAACAAGGAGACACTGG - Intronic
904349774 1:29897628-29897650 GAGGCCAAGCAGGGACACACAGG - Intergenic
905471632 1:38196567-38196589 CAGGGCAAAGAGGAAGACACAGG - Intergenic
906192644 1:43907896-43907918 GACGGCAAACAGGGAGACACTGG - Intronic
906561121 1:46757700-46757722 GAGACCAAACAGGGAGACAAAGG + Intergenic
907309603 1:53531691-53531713 GATGTCACAGAGGGAGACACAGG + Intronic
909486537 1:76180414-76180436 GACGGGAGACAGGGAAATACTGG + Intronic
910398231 1:86812675-86812697 GAGGGCAAAGAGGGAGAAATGGG - Intergenic
910629963 1:89344304-89344326 GACAGGAAACAGGGAAATACTGG + Intergenic
910694755 1:90000346-90000368 GAAGGAAAACATGGAGACACTGG - Intronic
914916721 1:151823522-151823544 AAGGGAAGACAGGGAGACACAGG - Intronic
916740513 1:167643307-167643329 GAAGGCAAAGAGGGTGACATTGG + Intronic
922913340 1:229235325-229235347 GACAGGAGACAGGGAAACACTGG - Intergenic
923291902 1:232553506-232553528 GACAGGAAACAGGGAAATACTGG - Intronic
923315162 1:232773212-232773234 GACAGGAGACAGGGAAACACTGG + Intergenic
923824412 1:237484067-237484089 GTAGGCAAACAGGAAGACTCCGG - Intronic
924632166 1:245751479-245751501 GAAGGAAAACAGGCAGACAGAGG + Intronic
924695839 1:246398666-246398688 GAGCACAAAGAGGGAGACACTGG + Intronic
1064600117 10:16985047-16985069 GACAGCAGACAGGGAAACACTGG + Intronic
1066305044 10:34132668-34132690 GACGGGAGACAGGGAAATACTGG + Intronic
1069627962 10:69880115-69880137 GGCGGGAAACAGGGAGACACAGG - Intronic
1073454588 10:103628873-103628895 GTGGGCAATCTGGGAGACACAGG - Intronic
1074939265 10:118218760-118218782 GAGGCCACACAGAGAGACACAGG + Intergenic
1076603636 10:131675361-131675383 GACGGCCACCAGGCAGCCACAGG + Intergenic
1077261867 11:1626330-1626352 GACGGCACTCAGGTTGACACAGG - Intergenic
1079742706 11:24083485-24083507 GAAGGCAAAAAGGAAAACACAGG + Intergenic
1080327420 11:31093393-31093415 GACGGGACAAAGGGAGATACAGG + Intronic
1080758319 11:35223608-35223630 ACCGGCAAACAGGGACACACAGG + Intronic
1080797240 11:35576099-35576121 GTGGACAAACAGAGAGACACCGG - Intergenic
1081980472 11:47263037-47263059 GAGGAGAAACAGGGAGGCACAGG + Intronic
1083618980 11:64039696-64039718 GATGGTAAACAGGCAAACACAGG - Intronic
1084965473 11:72742088-72742110 GAAGGGAAAGAGGGAGACAGGGG + Intronic
1086966365 11:93032197-93032219 GAAGGCAAGCAGGGTGCCACAGG - Intergenic
1087131037 11:94669457-94669479 GAGGGCACACGGGGACACACTGG + Intergenic
1089540912 11:119188499-119188521 GACGACAGTGAGGGAGACACAGG - Exonic
1089643133 11:119860704-119860726 GAAGGAAAACAGGGAGACAGGGG - Intergenic
1089788188 11:120923091-120923113 GGTGGCAAACAGTGGGACACAGG + Intronic
1090793375 11:130112040-130112062 GACCGCATACAGGGAGATAAAGG - Intronic
1090906275 11:131077193-131077215 GAAGGCAAACAGGGAGAACAGGG - Intergenic
1091260086 11:134226758-134226780 GGCAGGAAACACGGAGACACAGG + Intronic
1091616650 12:2054756-2054778 GAGTGCAAACAGGGAGGCTCTGG - Intronic
1093576616 12:20738046-20738068 GAGAGCAGACAGGGAGAGACAGG + Intronic
1093691766 12:22116544-22116566 GACAGGAGACAGGGAGATACTGG - Intronic
1098823958 12:75269876-75269898 GAGGGCAAACATGCAGTCACTGG - Intergenic
1100617608 12:96243028-96243050 GAATGTAAAAAGGGAGACACTGG - Intronic
1102461138 12:113100225-113100247 GACTGGAAACAGGAGGACACAGG + Intronic
1102944335 12:116972608-116972630 GGCGGCATACAGGGAGACTGAGG + Intronic
1103126297 12:118425404-118425426 GAAGACAAACAGGAAGAAACAGG - Intergenic
1103166326 12:118773450-118773472 GACAGGAGACAGGGTGACACTGG - Intergenic
1104300875 12:127563815-127563837 ATCGGCAACCAGGGATACACTGG + Intergenic
1106088204 13:26561637-26561659 TACAGCAAACAGGGAGACTGGGG + Intronic
1106519647 13:30485390-30485412 GAAGGCAACTTGGGAGACACTGG + Intronic
1107294332 13:38893987-38894009 GACGGGAGACAGGGAAATACTGG + Intergenic
1107369708 13:39731232-39731254 GACAAGAAAAAGGGAGACACAGG - Intronic
1107408431 13:40137042-40137064 GACCCCATGCAGGGAGACACTGG + Intergenic
1107446136 13:40471749-40471771 GACCAAAAACAGGGAGACAGAGG + Intergenic
1108171634 13:47748057-47748079 GAAGGAAAGCAGGGTGACACAGG - Intergenic
1109552902 13:63928768-63928790 GACAGCAAAGAGTGATACACTGG - Intergenic
1109561602 13:64056879-64056901 GACTGCAACATGGGAGACACAGG + Intergenic
1111850314 13:93565177-93565199 GAGGGCAGAAATGGAGACACAGG - Intronic
1112061548 13:95744642-95744664 GACGGTAGAGAGGGAGACACAGG + Intronic
1112261158 13:97879731-97879753 GATGGCAAACTGGAAGCCACAGG - Intergenic
1113288271 13:108878120-108878142 GACAGGAGGCAGGGAGACACTGG + Intronic
1113750594 13:112774017-112774039 GACGGGAAGCAGGGAGGCAGCGG - Intronic
1119295592 14:73530488-73530510 GAGGGCAAAAAGGGAGAAAGGGG - Intronic
1119299240 14:73558216-73558238 GAGGGCAAAAAGGGAGAAAGGGG - Intronic
1120669782 14:87350630-87350652 GACAGGAGACAGGGAAACACTGG + Intergenic
1121456486 14:94041985-94042007 CACTGCACACAGGGAGACAGTGG - Intronic
1125761598 15:42100004-42100026 GTCGGCAGACAGGCAGAAACAGG - Intergenic
1132387112 15:101408466-101408488 CATGGCCACCAGGGAGACACAGG + Intronic
1132546760 16:536779-536801 GACGGAACACAGGGGGACCCAGG + Intronic
1133414334 16:5594562-5594584 GCAGGAAGACAGGGAGACACTGG + Intergenic
1133565178 16:6986641-6986663 GAAGGAAAAGAGGGAGACAGAGG - Intronic
1135160788 16:20094299-20094321 GAAGGAAAAAAGGGACACACTGG - Intergenic
1136040189 16:27572537-27572559 GACAGAGAAGAGGGAGACACAGG - Intronic
1136145147 16:28312135-28312157 CACGCCCAACAGGGAGACGCTGG - Intronic
1141199046 16:81883115-81883137 GTTGGCCAACAGGAAGACACAGG - Intronic
1146133203 17:30295993-30296015 GACAGCAAAGGAGGAGACACAGG - Intergenic
1146523397 17:33544887-33544909 GATGGCACACAGGGAAACTCCGG - Intronic
1147367516 17:39968873-39968895 GGTGACAAACAGGAAGACACAGG + Intronic
1147879315 17:43643673-43643695 GACCCCAAACAGGAAGACATGGG + Intronic
1149104232 17:52943133-52943155 GACAGGAGACAGGGAAACACTGG + Intergenic
1151976843 17:77488120-77488142 GATGACAACCAAGGAGACACCGG - Intronic
1153081956 18:1237794-1237816 GAGGCCACACAGGGAAACACTGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154396766 18:13997916-13997938 GATGTGAAACAGGAAGACACTGG + Intergenic
1158539200 18:58337408-58337430 GATGCCAAAGAGGGAAACACGGG - Intronic
1160858292 19:1227152-1227174 GCAGGCACACAGGGAGAGACAGG - Intronic
1164147688 19:22522167-22522189 CACGGTTTACAGGGAGACACTGG + Intronic
1165768792 19:38366601-38366623 GACTGGAAGCAGGGAGACTCTGG + Intronic
1167120461 19:47513730-47513752 GAGGGATAACAGGGAGAGACAGG - Intronic
1167131593 19:47589853-47589875 GAGGGCAAGCAGGGAGACCAGGG - Intergenic
1168073244 19:53964100-53964122 GACGGGAAAGAGGGAGAAAGAGG - Intronic
925333282 2:3075132-3075154 GAAGGGAAACAGGGAGGCACTGG - Intergenic
930656984 2:54016429-54016451 AAGGCCAAACAGGGAGAAACTGG + Intronic
937321849 2:120965702-120965724 GACGGCAAACAGGGGCATCCTGG - Intronic
938749911 2:134318448-134318470 GACGATTAACAGGAAGACACTGG - Intronic
944719996 2:202414331-202414353 GCCTGAAAACAGGGAGACAGGGG - Intronic
946987174 2:225286423-225286445 GACAGGAGACAGGGAGACATTGG + Intergenic
948686565 2:239674240-239674262 GCGGGAAAACAGGAAGACACGGG + Intergenic
1171430009 20:25077128-25077150 GACAGCAAACAGGGCAACAAGGG + Intronic
1173946826 20:46958194-46958216 GGAGGCAGAGAGGGAGACACAGG - Intronic
1174513550 20:51074298-51074320 GAAGGCAAAAAGGGAAACAAAGG + Intergenic
1178097870 21:29234868-29234890 GACAGGAAACAGGGAAATACTGG - Intronic
1180045127 21:45301702-45301724 GATGGCTCACAGGGAGGCACTGG - Intergenic
1180597452 22:16988035-16988057 GGCGGCACACAGTGAGACACCGG + Exonic
1183548338 22:38467355-38467377 GATGTTAAACAGGGACACACAGG - Intergenic
950645217 3:14372942-14372964 AACTGCACACAGGTAGACACGGG - Intergenic
952493774 3:33897998-33898020 GACGGCAAAGACGTAGACATGGG - Intergenic
953350530 3:42212155-42212177 GCCTGCAATCATGGAGACACAGG + Intronic
955663758 3:61328500-61328522 GACAGGAGACAGGGAAACACTGG - Intergenic
957883663 3:86254830-86254852 GACAGGAAACAGGGAAATACTGG - Intergenic
959486585 3:106934142-106934164 GACAGGAAACAGGGAAATACTGG + Intergenic
963598130 3:147354678-147354700 GAGGGAAAAGAGGGACACACAGG - Intergenic
968427106 4:531481-531503 GACAGCGGACAGGCAGACACCGG - Intronic
968438654 4:610037-610059 GATGGGAGACAGGGAGACACGGG + Intergenic
969622660 4:8286540-8286562 GTCTGCAGCCAGGGAGACACAGG - Exonic
971588317 4:28433192-28433214 GACAGGGAACATGGAGACACAGG - Intergenic
972210101 4:36826005-36826027 GAAAGCCAACAGAGAGACACTGG + Intergenic
977895355 4:102358404-102358426 GAAGACACACAGGGACACACAGG + Intronic
980156259 4:129110661-129110683 GAAGGCAAACAGGGAGAGGAAGG - Intronic
983888726 4:173009208-173009230 GACAGCAAGCATGGAGCCACCGG + Exonic
984562663 4:181289339-181289361 AAAGGCAAACAGTGTGACACAGG - Intergenic
985231622 4:187824481-187824503 AAAGGCAAAAAGGGAGACAGAGG + Intergenic
988019109 5:25600275-25600297 GACTGCTTACAGGGAAACACTGG - Intergenic
989541982 5:42628351-42628373 GACAGGAGACAGGGAAACACTGG - Intronic
989542257 5:42631030-42631052 GACAGGAGACAGGGAAACACTGG - Intronic
992132351 5:73705897-73705919 GACGGTAGACAGGGAGTCACTGG - Intronic
992900278 5:81288043-81288065 GAGGCCAAAAAGGAAGACACTGG + Intergenic
995494543 5:112726676-112726698 GACAGGAAACAGGGAAATACTGG - Intronic
1001085359 5:168696492-168696514 GATGGCAGAGAGGAAGACACGGG + Intronic
1002163966 5:177333202-177333224 TGCGGCAGACAGGGAGACAGAGG - Intronic
1002318635 5:178361950-178361972 GACATCACACAGGGAGTCACTGG + Intronic
1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG + Intergenic
1004545078 6:16590281-16590303 GACTGCAAACAGGAAAATACAGG + Intronic
1006075659 6:31530513-31530535 CACGGCACACATGCAGACACTGG + Intronic
1008376997 6:50803120-50803142 GAGGGAAAACAGAGAGGCACAGG - Intergenic
1009753845 6:67909326-67909348 GATGGCAAACAGTGAGAGCCAGG - Intergenic
1011083901 6:83517629-83517651 GACACACAACAGGGAGACACTGG - Intronic
1015905553 6:138113231-138113253 GAGATCAAGCAGGGAGACACAGG - Intergenic
1017823250 6:158064001-158064023 GAAGGTGGACAGGGAGACACTGG + Intronic
1018526099 6:164710993-164711015 GACAGGAGACAGGGAGATACTGG - Intergenic
1020075167 7:5253099-5253121 GACTCCAAACAGGGAGAATCGGG - Intergenic
1023674337 7:42614734-42614756 GGCGGCAGACAGGCAGAGACAGG - Intergenic
1024929952 7:54659212-54659234 TCCAGCAAACTGGGAGACACAGG + Intergenic
1026082963 7:67238654-67238676 GGCAGTAAACATGGAGACACGGG + Exonic
1026359585 7:69591378-69591400 GAAGACGAACAGGGAGACAACGG - Intergenic
1026694096 7:72575351-72575373 GGCAGTAAACATGGAGACACGGG - Exonic
1026951990 7:74353855-74353877 GTCGGCACACAGGGAGACTCAGG - Intronic
1029578010 7:101416579-101416601 GATGGAAAACAGGCAGAAACAGG - Intronic
1029600587 7:101561078-101561100 TTCAGCAAACAGGGAGACCCGGG + Intergenic
1031247134 7:119328240-119328262 GATGGCAAACTGGGAGGAACTGG + Intergenic
1033918971 7:146363845-146363867 GAGGGAGAACAGGGAGCCACTGG + Intronic
1034175069 7:149093267-149093289 GAGGCCAAACACTGAGACACCGG + Intergenic
1035236779 7:157502470-157502492 GAGGGGAAACAGGGAAACAGAGG + Intergenic
1035376600 7:158410876-158410898 GACCCCAGACACGGAGACACAGG + Intronic
1037624175 8:20593124-20593146 GACAGGAAACAGGGAAACATTGG - Intergenic
1038611043 8:29060398-29060420 GACGGAAAAGAGGTAGACAAGGG - Intronic
1039659428 8:39446968-39446990 GACTGCAGAAAGGGAAACACAGG + Intergenic
1043999838 8:86865765-86865787 GACAGGAGACAGGGAAACACTGG - Intergenic
1046941819 8:119938856-119938878 GAAGGCAGAGAGGGAGAAACGGG - Intronic
1049636094 8:143690232-143690254 GAAGGCAGAAAGGCAGACACGGG - Intronic
1049816626 8:144606039-144606061 GAGGGCGAACAGGAGGACACAGG + Intergenic
1050512299 9:6408732-6408754 GACTGCAAACAGGTAGAGAGTGG + Intergenic
1055020894 9:71668449-71668471 TAGAGCATACAGGGAGACACAGG - Intergenic
1055538905 9:77279630-77279652 GACAGCAGACAGGGAAATACTGG - Intronic
1056091962 9:83214817-83214839 GACAGTAGACAGGGAAACACTGG + Intergenic
1056559868 9:87720841-87720863 GATGGCTGACAGGCAGACACAGG - Intergenic
1060069203 9:120531772-120531794 GAAGGTAAAGAGGGAGACAAAGG + Intronic
1060281462 9:122218537-122218559 GACTGGAAACAGGGAGACCGGGG - Intronic
1062117605 9:134817802-134817824 GAAGGCAGACAGGGAGAGAAAGG + Exonic
1062131017 9:134893149-134893171 GAAGGCAAGCAGGGAGTAACAGG + Intergenic
1062459333 9:136656375-136656397 GACTGGGAACAGGGAGACCCCGG + Intergenic
1186534593 X:10333273-10333295 AACAGCAGAGAGGGAGACACTGG - Intergenic
1188117639 X:26264196-26264218 GACAGGAGACAGGGAGACACTGG - Intergenic
1188477679 X:30604462-30604484 GACGGCAAGCAGGGAGCAAATGG - Intergenic
1197863971 X:130998700-130998722 GAAGGAAAACAGGGAGACTGAGG - Intergenic
1199198243 X:145057490-145057512 GACAGACAACAGTGAGACACTGG - Intergenic
1202360444 Y:24104197-24104219 TATGACAAACAGGGTGACACAGG + Intergenic
1202510334 Y:25565921-25565943 TATGACAAACAGGGTGACACAGG - Intergenic