ID: 906193665

View in Genome Browser
Species Human (GRCh38)
Location 1:43915202-43915224
Sequence GCTGAAGAGCTGCTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906193663_906193665 0 Left 906193663 1:43915179-43915201 CCAAAGGAGCAGCAGCGGAAGAC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG 0: 1
1: 0
2: 2
3: 10
4: 235
906193662_906193665 3 Left 906193662 1:43915176-43915198 CCACCAAAGGAGCAGCAGCGGAA 0: 1
1: 0
2: 0
3: 8
4: 169
Right 906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG 0: 1
1: 0
2: 2
3: 10
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906193665 Original CRISPR GCTGAAGAGCTGCTGGTCAC TGG Intronic
902664559 1:17928277-17928299 GCTGCTGAGCTGCTGGGAACAGG + Intergenic
903037159 1:20500355-20500377 ACAGAAGAGCTGCTGATCACTGG + Exonic
903219175 1:21859565-21859587 CGGGCAGAGCTGCTGGTCACTGG - Exonic
903995166 1:27300917-27300939 GCTGCAGAGCTGCGGGTGCCTGG + Intronic
905099496 1:35506729-35506751 GATTAAGCTCTGCTGGTCACTGG + Exonic
905819497 1:40979038-40979060 GCTGCAGAGATGCTGGTGCCGGG - Intergenic
905922175 1:41727122-41727144 GATGCAGAGCTGGTGTTCACTGG + Intronic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
906634739 1:47401772-47401794 TCTGAAGAGCTGCTTGTGAGAGG + Intergenic
907044320 1:51290519-51290541 GCTGAAGAGATGCTGGAGAAAGG - Exonic
910865397 1:91783654-91783676 GCTCAAAAGTTGCTGGTCATTGG - Intronic
911403539 1:97407520-97407542 GCTGATGAGTTTCTGGCCACAGG - Intronic
911935002 1:103959654-103959676 GCAGAGGTGCTGCTGGCCACGGG - Intergenic
912370818 1:109172773-109172795 GCTGGAAAGCTGCTGGTCTTTGG - Intronic
913450073 1:118987282-118987304 GATGAAGGGCTGCCGGTCCCTGG - Intronic
915457432 1:156050254-156050276 GCTGGAGAGCTGGAGGACACTGG - Intronic
916353648 1:163880142-163880164 GCTGGTGAGATACTGGTCACAGG - Intergenic
916448015 1:164891739-164891761 GCTGAAGTGCTGCCTGTCCCAGG + Intronic
917595573 1:176526008-176526030 CCTCAAGAGCTTCAGGTCACTGG - Intronic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
922499000 1:226083311-226083333 GCTGGAGAGATGCTGGGGACCGG - Intergenic
922790215 1:228307068-228307090 GCTGCAGAGCTGCTGGTACGCGG + Exonic
923024244 1:230191902-230191924 GCTGAAGAGGTGCTGAGCATGGG - Intronic
923860159 1:237885222-237885244 GCTGAAGCGCTGGTGGTGAGAGG + Exonic
924501821 1:244645333-244645355 GCTGAAGACCTGGGAGTCACAGG + Intergenic
1065483868 10:26217926-26217948 GCTGCAGGGCTTCTGGTCGCAGG - Exonic
1067462603 10:46468720-46468742 GCTGAAGATCAGCTAGTCAGGGG + Intergenic
1067564484 10:47326775-47326797 ACTGCAGAGGTGCTGGCCACAGG - Intergenic
1067624592 10:47915917-47915939 GCTGAAGATCAGCTAGTCAGGGG - Intergenic
1069958433 10:72065728-72065750 GCTGGAGTGATGCTGGTCGCAGG + Intronic
1070432480 10:76354929-76354951 GATGAAGAGAGGCTGGTTACGGG - Intronic
1071023459 10:81084252-81084274 GTTGAAGAGCTGGTGTTTACTGG + Intergenic
1071710207 10:88042428-88042450 GCCTAAGAGCTGCTGGTTAATGG - Intergenic
1072695769 10:97601775-97601797 GCTGAAGAGGTGCTGGGACCAGG + Intronic
1075144620 10:119872652-119872674 GCTGAAGAGGAGCTGGGCGCCGG - Exonic
1075994966 10:126869826-126869848 GCTGAAGAGCTGCTGAGGCCAGG + Intergenic
1076164966 10:128274181-128274203 TCTGAAGAGCTGCTGCTTCCTGG - Intergenic
1076478087 10:130766484-130766506 GCTGCAGAGCTGGGGGTGACAGG + Intergenic
1076898177 10:133324578-133324600 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1076898186 10:133324611-133324633 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1076898195 10:133324644-133324666 GCTGCAGAGCTGCTGCTGGCTGG + Intronic
1077693010 11:4365729-4365751 GATGGAGAGATGTTGGTCACAGG + Intergenic
1078894595 11:15586833-15586855 GGGGAAGAGGTGCTGATCACAGG - Intergenic
1079009965 11:16819813-16819835 GAAGAAGAGCTGTTGGTCAAAGG + Intronic
1079837532 11:25351870-25351892 GTTGAAGAGCTGGTGTTTACTGG + Intergenic
1080200013 11:29657925-29657947 GCTGAAAGGCTGCTGGTCAAGGG - Intergenic
1081054493 11:38391799-38391821 CCTGAAGGGCTGCTTGTCATTGG + Intergenic
1081775782 11:45675149-45675171 GCTGAAGAGCAGCCGGTCCCAGG - Intergenic
1083096414 11:60255623-60255645 GCTGAAGAGATGCTAGACTCTGG + Intergenic
1083761490 11:64820973-64820995 GCTGAATTACTGCTGGGCACTGG + Intergenic
1084771393 11:71344833-71344855 GATGAAATGCTGCTGTTCACAGG - Intergenic
1087817487 11:102675797-102675819 CCTGCAGAGCTGCTGGGCTCTGG + Intergenic
1088785735 11:113180180-113180202 ATTGAACAGCTGCTGGGCACAGG + Intronic
1089146708 11:116334759-116334781 GGTAGACAGCTGCTGGTCACTGG + Intergenic
1094324654 12:29223752-29223774 TCTGAAAAGCTGCTGGTCTTGGG + Intronic
1096231249 12:49898035-49898057 GGTGAAGAGCTCATGGTCTCCGG + Exonic
1097369134 12:58754702-58754724 ACTGAAAAGATGCTGGTCATGGG + Intronic
1103890175 12:124232540-124232562 GCTGAATTACTGCTGGTGACAGG - Intronic
1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG + Intronic
1106077060 13:26469392-26469414 GCTGGAGAGATGTTGGTCAAAGG + Intergenic
1108715755 13:53076425-53076447 GCTGAAGATCTGGTGGTGAGTGG - Intergenic
1109547867 13:63851007-63851029 GCTCAAGAACTGCTAATCACAGG - Intergenic
1112043505 13:95572179-95572201 GCTCAAGAGCTTCAGGGCACAGG - Intronic
1112327249 13:98450085-98450107 GAAGCAGAGGTGCTGGTCACAGG - Intronic
1112708309 13:102097969-102097991 TCTGGAGACCTGCTGCTCACTGG + Intronic
1112904706 13:104402546-104402568 GTTGAAGAGATGTTGGTCAAAGG + Intergenic
1113543063 13:111123817-111123839 GCTCCAGAGCGGCTGGTAACTGG + Intronic
1113955491 13:114098191-114098213 GCTGATGAGCTGTTGACCACAGG - Intronic
1114203332 14:20543744-20543766 GGTGAGGAGATGTTGGTCACAGG - Intergenic
1115542079 14:34430385-34430407 ACAGAAGAACTGCTGGTCAGTGG - Intronic
1117462390 14:55958115-55958137 GCTAATGAGCTGCTGGACAATGG - Intergenic
1119737940 14:76995770-76995792 TTTGAAGAGCTGCTGGTTGCTGG - Intergenic
1121081702 14:91113987-91114009 GCTGCAGAGCTGCTGGCAGCTGG - Intronic
1121391120 14:93575771-93575793 GCTGATGTGCTGCTGTTCTCAGG + Intronic
1121439820 14:93941584-93941606 TCTGCAGAGGTGCTGGTCAAAGG + Exonic
1121455998 14:94039191-94039213 GCTGAAGAGCTGCCTGGCAGAGG + Intronic
1122175566 14:99915925-99915947 ACGGAAGGGGTGCTGGTCACTGG + Intronic
1125584820 15:40812909-40812931 GCTGGGGAGCAGCTGCTCACTGG + Intronic
1129199819 15:73992118-73992140 GCAGAAGGGCTGCTTGTCCCCGG - Exonic
1129256233 15:74335643-74335665 GCTGCTGAGCTTCTGGCCACGGG - Intronic
1129329837 15:74821336-74821358 GATGAAATGCTGCAGGTCACAGG + Intronic
1129555386 15:76502807-76502829 GCTGACCAGCTGCAGGGCACTGG + Intronic
1129669394 15:77598719-77598741 GCTGGTGAGCTGCTGGTAAGAGG + Intergenic
1132086501 15:98912400-98912422 GCTGGACAGCTGCTGGCCGCTGG - Intronic
1132786121 16:1657842-1657864 GCTGGCGAGCTGCTGGACATGGG + Intronic
1134539311 16:15052087-15052109 TCAGAAAATCTGCTGGTCACTGG - Intronic
1137768655 16:50997021-50997043 GCTGCAGAACCGCTGGTAACTGG - Intergenic
1139562833 16:67754749-67754771 GCTGAAGTGCTTCTGCTCTCTGG + Intronic
1142247756 16:88977552-88977574 GCTGAGGAGAGGCTGGTCAGAGG - Intergenic
1142345758 16:89553031-89553053 GGTGAAGAGGTGCTGGTCTCTGG - Exonic
1142425411 16:89999873-89999895 GGTGTAGAGCTGCTGCTCCCGGG - Intergenic
1143096003 17:4478698-4478720 GCTGCTGAGCAGCTGGGCACTGG + Intronic
1143129003 17:4664319-4664341 GCTGAGGAGCAGCTGCTCCCTGG + Intergenic
1144685913 17:17226215-17226237 GCTGAAGAGCTGGGGGTGGCTGG + Exonic
1148876873 17:50693096-50693118 CCTGCAGAGCTTCTGGTCTCTGG + Intergenic
1151230662 17:72682716-72682738 GGTGAAGAGCTGATGGTTACAGG - Intronic
1151455434 17:74222899-74222921 CCTGCACAGCTGCTGGGCACAGG - Intronic
1153140662 18:1968948-1968970 GCTGTTGAGCTACTGGTCATAGG - Intergenic
1153344867 18:4014415-4014437 GGTGAAGAGATGTTGGTCAAGGG + Intronic
1153757517 18:8299166-8299188 GGTGTACAGCTGCTTGTCACAGG + Intronic
1156762153 18:40605523-40605545 GCGGAGGAGCTGCTGGTCTCTGG + Intergenic
1159607232 18:70487607-70487629 ACTCATGCGCTGCTGGTCACAGG + Intergenic
1159767507 18:72508252-72508274 GCCCAACATCTGCTGGTCACTGG - Intergenic
1163726829 19:18927925-18927947 GGTAAGGAGATGCTGGTCACGGG - Intronic
925009738 2:474127-474149 GCTGAAGAACTGATGTTCAAGGG - Intergenic
925318460 2:2942515-2942537 GCAGATGAGCTCCTGGTCTCCGG + Intergenic
925398036 2:3550830-3550852 GCTGAGGCGCTGCTCGTCTCTGG - Intronic
925531114 2:4863582-4863604 GCTGAAGAGGGGATGGGCACTGG - Intergenic
929267904 2:39939781-39939803 GCTGGAGAGCTGTTTGTCTCAGG - Intergenic
932965761 2:76473060-76473082 GCTGAACAGCTGTGGGTGACAGG + Intergenic
934477542 2:94603403-94603425 GGTGGAGAGCTGATGGTGACCGG + Exonic
935595147 2:104872494-104872516 GCTGAAGAGGGGCTGGGAACGGG - Intergenic
936397924 2:112143146-112143168 GATGAAGAGCAGGTGGTCATGGG + Intronic
938226336 2:129619610-129619632 AATGAACACCTGCTGGTCACTGG + Intergenic
939727563 2:145741948-145741970 GCTTAAGAGCAGCTATTCACAGG + Intergenic
940725977 2:157336659-157336681 GCTCAAGATCTGCTGGTGAAGGG - Intergenic
943225061 2:185162559-185162581 GATGAAGAGATGTTGGTCAAGGG - Intergenic
945539550 2:211067695-211067717 GATGAAGAGAAGCTGGTCACAGG - Intergenic
948731426 2:239966250-239966272 CCCTAAGGGCTGCTGGTCACAGG + Intronic
948806319 2:240454827-240454849 GCTCCAGAGCCACTGGTCACGGG + Intronic
948977172 2:241470855-241470877 TCTGAAGAGATGCTGTTCGCAGG + Intronic
949007202 2:241656416-241656438 GCTGGGGAGCTGCTGGACAGAGG - Intronic
1169151698 20:3294602-3294624 ACTGAAGAGCTTCTGTGCACTGG + Exonic
1171173568 20:23035343-23035365 GCTGAAGAGCTGCGGGCACCGGG - Intergenic
1171363359 20:24606309-24606331 CCTGAACAGCTGATGGTCAGGGG + Intronic
1172056033 20:32155014-32155036 GCTTAAGAGCTTCTGGTCTGGGG + Intronic
1172856333 20:38006299-38006321 TCTCAAGAGCTGCTGGTCTTTGG + Exonic
1173674316 20:44820769-44820791 GCAGAAGAGCTGTTGGGTACAGG - Intergenic
1174954992 20:55088169-55088191 GATGAAGAGAGGCTGGTCAATGG - Intergenic
1176362572 21:6010219-6010241 GCTGGAGGGCTGCTGGGCTCTGG + Intergenic
1178623320 21:34195345-34195367 TCTAAAGAGCTGTTGGTCAAAGG - Intergenic
1179480251 21:41672324-41672346 GCGGCAGAGCTCCGGGTCACGGG + Intergenic
1179760946 21:43528326-43528348 GCTGGAGGGCTGCTGGGCTCTGG - Intergenic
1180214307 21:46314891-46314913 GATGCAGAGCTGCTGCACACGGG + Intronic
1180917945 22:19502036-19502058 GGTGAACATCTGATGGTCACAGG - Intronic
1181314960 22:21964938-21964960 GCTGGAAAGCTGGTGGTCTCTGG - Intronic
1181476207 22:23169170-23169192 CCTGTGGAGCTGCTGGTCCCAGG - Intergenic
1182744258 22:32593574-32593596 GCTGCAGAGATGGAGGTCACAGG + Intronic
1183196851 22:36359403-36359425 GCTGGAGAGCTGAAGGTAACAGG + Intronic
1184525571 22:45020639-45020661 GGCAAAGACCTGCTGGTCACTGG + Intergenic
950650682 3:14404767-14404789 GCTGTAGAGCTGCTGATTAGAGG + Intronic
951909200 3:27731431-27731453 GCCCAAGAGCTTCTGATCACAGG - Intergenic
953413511 3:42702814-42702836 GCTGCAGAGCTGCTGGCCACAGG + Exonic
954375954 3:50194257-50194279 GAGGAGGAGCTGCTGGTCCCTGG + Intronic
958406114 3:93760760-93760782 GATGAAGAGCGGCTGGACAGAGG + Intergenic
958406974 3:93763770-93763792 GATGAAGAGCAGCTGGGCAGAGG + Intergenic
958594118 3:96200623-96200645 GTTGAAGAGCTCCTGTTTACTGG - Intergenic
958811528 3:98865471-98865493 GCTGGAGAGATGTTGGTCAAGGG + Intronic
959395608 3:105834111-105834133 GATGAAGAGCTATTGGTCAAAGG + Intronic
959716052 3:109433880-109433902 GCTGAAGAGATACTGGTCAATGG - Intergenic
960210966 3:114965422-114965444 ACTGGGGAGCTGCTGGTCAAGGG - Intronic
961009365 3:123425618-123425640 CCAGAAGGGATGCTGGTCACAGG + Intronic
962431713 3:135326326-135326348 GCTGAAGGCCTGTGGGTCACCGG - Intergenic
962595774 3:136942125-136942147 GCTAAAGAGAGGCTGGGCACAGG - Intronic
963189351 3:142451975-142451997 GTTGAAGAGCAGATGGTCTCTGG - Intronic
968070029 3:195779026-195779048 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070108 3:195779458-195779480 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070148 3:195779650-195779672 GCTGAGGAACGGCTGGTGACAGG + Exonic
968070164 3:195779746-195779768 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070272 3:195780322-195780344 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070445 3:195781234-195781256 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070455 3:195781282-195781304 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070609 3:195782146-195782168 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070907 3:195783826-195783848 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968070975 3:195784210-195784232 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968071400 3:195786562-195786584 GCTGAGGAAGTGCTGGTGACAGG + Exonic
968653705 4:1769868-1769890 GCTGAAGGGCTGCAGGCCCCTGG - Intergenic
969169631 4:5349295-5349317 GCTGAAGTTTTGCTGGGCACTGG - Intronic
969315867 4:6381040-6381062 ACGGGAGAGCTGCTGGCCACAGG - Exonic
969565044 4:7972337-7972359 GACGAAGAGCTGCTGGTGAATGG - Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
977685502 4:99842783-99842805 CCTGAAGATCTTCTGATCACTGG - Intronic
978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG + Intergenic
978868499 4:113544996-113545018 GTTGAATAACTGCTGCTCACTGG - Intronic
980030505 4:127823987-127824009 GATGGAGAGCTACTGGTCAAAGG - Intronic
980076646 4:128301067-128301089 GCTGAGGAGATGTTGGTCAAAGG - Intergenic
981680953 4:147397195-147397217 GTTGAAGAGATGTTGGTCAAAGG + Intergenic
985526523 5:405693-405715 GCGGAGGAGCTGGTGGTCGCAGG - Intronic
989392593 5:40917243-40917265 GTTGAAGAGATGTTGGTCAAAGG - Intronic
991353033 5:65738688-65738710 GTTGGAGAGATGCTGGTCAAAGG - Intronic
993814188 5:92520636-92520658 GATGGAGAGCTGCTGATCAAAGG - Intergenic
995029478 5:107464194-107464216 GCTGAAGTGCTGCTGGTCCCGGG - Intronic
995552519 5:113294961-113294983 GCTGTCTAGCTGCTGGCCACGGG + Intronic
995708456 5:115010468-115010490 GCTGAAGAGCTGCAGGGCTGGGG + Intergenic
997212191 5:132083346-132083368 TCTAAAGGGCTGCTGGACACAGG + Intergenic
998415511 5:141943460-141943482 ACTGAAAATCTGCTGGTAACTGG + Intergenic
999178157 5:149646759-149646781 TCTGCAGAGCTGCTGGGCCCTGG - Intergenic
1001700600 5:173704036-173704058 GGTGATGAGCTGCAGGTGACAGG + Intergenic
1001932637 5:175684123-175684145 GCAGAAGAGCTGTTGGTACCCGG - Exonic
1002329808 5:178433591-178433613 CCTGGAGAGCTGCGGGTCAGAGG - Intronic
1002538899 5:179893361-179893383 GAAGAAGAGCTCCTGGTCGCGGG + Exonic
1003256447 6:4479243-4479265 TCTGAGGAGCTGCTGGTCTAGGG - Intergenic
1005428276 6:25726828-25726850 ACTGAAGAGCTGTTGAGCACTGG + Intergenic
1008572957 6:52832594-52832616 TGGGAAGAGCTGCTGGGCACTGG + Intronic
1014817774 6:125953834-125953856 GCAGAGGGGCTGCTGGCCACAGG + Intergenic
1015198099 6:130546283-130546305 GTTGAAGATCAGATGGTCACAGG - Intergenic
1016534377 6:145093994-145094016 ACAGAAGAGCTCCTGCTCACTGG - Intergenic
1018777184 6:167028312-167028334 GCTGCAGAGTTGCTGGGTACAGG + Intronic
1019335664 7:481388-481410 TCTGAAGAGCAGCTGGGCCCAGG + Intergenic
1020665507 7:11036517-11036539 GCTGAAGCACTGCTGGTGAGTGG - Exonic
1021313742 7:19120055-19120077 GATGAAGAGCTCCTGGCCATTGG + Intergenic
1022497861 7:30864585-30864607 GCTGAGGAGCTGCTGGAGAAGGG - Intronic
1024967518 7:55037265-55037287 ACTGAAAAGCTGCTGGGTACAGG + Intronic
1025980615 7:66402261-66402283 GCAGAGAAACTGCTGGTCACTGG + Intronic
1026966936 7:74446120-74446142 GCTGAAGGGGTTCTGGGCACGGG - Intergenic
1027219066 7:76202419-76202441 CCTGTGGAGATGCTGGTCACTGG + Intronic
1027629394 7:80583856-80583878 ACTCAAGAGCTCCTGGTCATGGG + Intronic
1028983895 7:96995354-96995376 GCTCTGGAGCTGCTGTTCACAGG + Intergenic
1031834685 7:126668499-126668521 GGTGGGGAGCTGCTGCTCACAGG - Intronic
1032097761 7:128947906-128947928 GTAGAAGCGCTGCTTGTCACTGG - Exonic
1033154374 7:138944202-138944224 GCTGGAGAGATGTTGGTCAAAGG - Intronic
1033165493 7:139035694-139035716 GCAGAAGTGCAGCTGGTCGCAGG + Exonic
1033538508 7:142334135-142334157 GCTGGGGAGATGCTGGTCAAAGG + Intergenic
1034749821 7:153558240-153558262 ACTGAGGTGCTGGTGGTCACAGG + Intergenic
1036589251 8:10153013-10153035 GATGAAGAGCTGCTGTTTAAAGG + Intronic
1037968578 8:23154224-23154246 GTTGGAGAGATGCTGGTCAAAGG + Intronic
1039743273 8:40401387-40401409 GCTGCTAAGCTGCTGGTTACAGG - Intergenic
1041360441 8:57047312-57047334 GCTGAAGAGCTGCTGAAAAGTGG - Intergenic
1041433226 8:57807965-57807987 AATGAAGAGCTGTTGGTCAAAGG + Intergenic
1041774930 8:61513551-61513573 CCTGAAGAGTTGCTGAGCACAGG - Intronic
1042526139 8:69766799-69766821 CCTCAAGAGATGCTGGTCAGTGG + Intronic
1045356226 8:101391590-101391612 GCTTGAGAGATGTTGGTCACTGG - Intergenic
1046977854 8:120302530-120302552 GCTGAAGATCAGATGGTCATAGG + Intronic
1049162465 8:141106094-141106116 GGAGAAGAGCTGCTGCTCAAGGG - Intergenic
1049344634 8:142131903-142131925 TCCGGAGAGCTGCTGGGCACAGG - Intergenic
1049392471 8:142379337-142379359 AGTGCAGAGCTGCTGCTCACTGG - Intronic
1049417867 8:142503780-142503802 GGAGAAGAGCTGCTGGACCCTGG + Intronic
1050899180 9:10923600-10923622 GCTAAAGAGGTGCTGGTGAAAGG - Intergenic
1053218834 9:36294614-36294636 GGTTAAGAGCAGCTGGTGACCGG + Intronic
1053476422 9:38385221-38385243 GCTCAAGAACTGCTGAACACAGG + Intergenic
1053680526 9:40482704-40482726 GGTGGAGAGCTGATGGTGACCGG - Intergenic
1053930515 9:43111015-43111037 GGTGGAGAGCTGATGGTGACCGG - Intergenic
1054283186 9:63142231-63142253 GGTGGAGAGCTGATGGTGACCGG + Intergenic
1054293611 9:63318219-63318241 GGTGGAGAGCTGATGGTGACCGG - Intergenic
1054391632 9:64622708-64622730 GGTGGAGAGCTGATGGTGACCGG - Intergenic
1054504095 9:65893620-65893642 GGTGGAGAGCTGATGGTGACCGG + Exonic
1055423582 9:76169766-76169788 GAGAAAGAGCTGCTGGTGACTGG + Exonic
1056769801 9:89468810-89468832 ACTGAAGTCCTGCAGGTCACTGG + Intronic
1060780623 9:126409650-126409672 GCTGGAGGGGTGCTGGTGACTGG - Intronic
1187116021 X:16352108-16352130 GCTGAAAAGGAGCCGGTCACAGG + Intergenic
1189449395 X:41113552-41113574 GCTGAAAAGATGCTGCTTACTGG + Intronic
1191645145 X:63471975-63471997 GCTGAAAAGCCTCTTGTCACAGG + Intergenic
1194031291 X:88819082-88819104 GCTGAAGATCAGATGGTCACAGG + Intergenic
1194410048 X:93546294-93546316 GCTGAAGAGCAGATGGTTATAGG - Intergenic
1195646213 X:107233469-107233491 GATGAAGAGATGCAGGTCAAAGG - Intronic
1195828794 X:109032869-109032891 ACTGAAGAGCTCTTGGTCCCTGG - Intergenic
1196515691 X:116607199-116607221 GTTGAAGAGCTAGTGTTCACTGG + Intergenic
1199972833 X:152873256-152873278 GCTGATGAGCTGCGGGATACCGG - Intergenic