ID: 906196371

View in Genome Browser
Species Human (GRCh38)
Location 1:43933012-43933034
Sequence GGCTGGGTGAGTAACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906196371_906196380 9 Left 906196371 1:43933012-43933034 CCATCCATGTTACTCACCCAGCC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 906196380 1:43933044-43933066 CCTGCCAAATTGCCATAATTAGG 0: 1
1: 0
2: 1
3: 41
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906196371 Original CRISPR GGCTGGGTGAGTAACATGGA TGG (reversed) Intergenic
900830724 1:4963435-4963457 GGCAGGGTGAGTCACACCGACGG - Intergenic
901927785 1:12577985-12578007 GGCTGGGGGTGTAACCTGGGAGG - Intronic
902510781 1:16965911-16965933 GGCTGGATGGGGAACCTGGAGGG + Intronic
902623561 1:17664249-17664271 GGCTGGGTGTGGGACATGAATGG + Intronic
902730587 1:18366129-18366151 GGCTGGGTCAGCAACATGAGAGG + Intronic
904375956 1:30082633-30082655 GTCTGGGAGAGAAAAATGGAAGG + Intergenic
905014212 1:34766126-34766148 GGTTGGGTGAGCCACATAGATGG - Intronic
906196371 1:43933012-43933034 GGCTGGGTGAGTAACATGGATGG - Intergenic
906243138 1:44254657-44254679 GGGTTGGTGAGTACCATTGAGGG - Intronic
906699646 1:47848670-47848692 TGTTGGGTTAGTAACCTGGAAGG + Intronic
910267193 1:85350323-85350345 TGCTGGGGGAGTAACAAGCAGGG - Intronic
915597613 1:156904481-156904503 GGCAGGGAGAGAAAAATGGAAGG + Intronic
916223583 1:162466971-162466993 GGCTGAGTGAGCAAGAGGGAGGG - Intergenic
917732591 1:177891243-177891265 TGCTAGGTGAGTTACAAGGAAGG - Intergenic
919384157 1:196897776-196897798 GGCTGGATGAGGAGCATGGAGGG + Intronic
919627839 1:199929609-199929631 ACATGGGTGGGTAACATGGATGG - Intergenic
920238251 1:204523973-204523995 GGCTGGGCGAGTAGTATGGCGGG + Intronic
921280109 1:213558033-213558055 GTCTGTGTGTGTAACATGGAAGG - Intergenic
922430145 1:225543570-225543592 GGCAGTGTAAGTAACATGAATGG - Intronic
923436821 1:233975348-233975370 CTCTGGCTCAGTAACATGGAGGG - Intronic
1063179801 10:3587913-3587935 GGCTGGGTGAGGACCATAGAGGG + Intergenic
1063558096 10:7099820-7099842 GGCTGGGTGGGATACATGGATGG - Intergenic
1063664843 10:8055086-8055108 GGCTGGCTGAGCAACTTGGAGGG - Intronic
1063975667 10:11413611-11413633 GGCTGGATGAGTAACCGGGTGGG + Intergenic
1066198780 10:33126903-33126925 GGGTAGGTGAGTAAAATGTATGG - Intergenic
1066488511 10:35872148-35872170 GACTGGTTCAGTAACAGGGAAGG + Intergenic
1067045870 10:42984921-42984943 GGCTCGGGGAGTGACATTGACGG - Intergenic
1067078577 10:43201688-43201710 TCCTGGGGGAGTAACATGGAAGG + Intronic
1067344625 10:45428445-45428467 GGCTGATTGATTCACATGGAAGG - Intronic
1068504128 10:57877736-57877758 AGCAGGGAGAGGAACATGGAAGG + Intergenic
1069630268 10:69893395-69893417 GGCTGGGAGTGCCACATGGATGG + Intronic
1075552908 10:123406231-123406253 TGTTGGGTGAGTAAGTTGGAGGG + Intergenic
1076241992 10:128915599-128915621 GGTTGGGTGGGTAACCAGGAAGG - Intergenic
1077304323 11:1862121-1862143 GGGTGGATGGGTAAAATGGATGG + Intronic
1078463495 11:11533084-11533106 GGGCTGGGGAGTAACATGGATGG - Intronic
1080872861 11:36252152-36252174 GGGTGGGTGGGTCACATGGTGGG + Intergenic
1084165479 11:67373134-67373156 GGCTGGGAGAGGAAGAGGGAGGG - Intronic
1084346183 11:68550775-68550797 GGCTGGGAGATTAAGAAGGATGG - Intronic
1084971872 11:72776523-72776545 GGCTGGGTTATTAACATGATTGG - Intronic
1086291262 11:85312273-85312295 GGCTGCCTAAGTAATATGGATGG - Intronic
1086935060 11:92736320-92736342 GGCTTGGTGAGCATCTTGGAAGG - Intronic
1088102620 11:106171855-106171877 AGCTGGCAGAGGAACATGGAAGG + Intergenic
1088568167 11:111195179-111195201 GGCTGGATTTGTACCATGGATGG - Intergenic
1089805993 11:121090247-121090269 TGCTGGTTGAGTAACATAGCTGG - Exonic
1090623867 11:128587825-128587847 GCCTTGGAGAGTAACAGGGAGGG + Intergenic
1091211336 11:133864041-133864063 GGCGGGGAGATTAGCATGGATGG + Intergenic
1092023229 12:5219938-5219960 GGCTAGGTAGGTAACTTGGATGG - Intergenic
1092162138 12:6321453-6321475 GTTTGGGTGTGAAACATGGAAGG + Intronic
1092532916 12:9360251-9360273 GGCTGGGTGGGGGACATGGTGGG - Intergenic
1093644289 12:21566204-21566226 GGCTGGGTGAAAAACATGCATGG - Intronic
1096706222 12:53424081-53424103 GGCTGGGTGAGTAAGGGTGAAGG + Intronic
1097642285 12:62196947-62196969 GGCTGGGTTACTAACAGGGAGGG - Intronic
1102687139 12:114734061-114734083 GGCTGGGTGGGTCAGAAGGAGGG - Intergenic
1102919496 12:116781244-116781266 AGCAGGGTGAGAAAGATGGAGGG - Intronic
1106220858 13:27745300-27745322 GGCTGGGGGAGCAGGATGGAAGG - Intergenic
1107125729 13:36843791-36843813 CCCTGGGTGAGTACCAGGGAAGG - Intergenic
1107126897 13:36856070-36856092 GGCTGGGAGAGTTACTTGGCTGG + Intronic
1107409370 13:40144245-40144267 GTCTGGGTTTGTTACATGGAAGG + Intergenic
1108705843 13:52985345-52985367 GGCTGGGTGAAGGACAAGGAGGG + Intergenic
1112303239 13:98249579-98249601 AGCTGGGTGAAGAACATGGTGGG - Intronic
1112345399 13:98585087-98585109 GGCTGGGTGTGTGACCTGCATGG - Intergenic
1112463520 13:99623474-99623496 GACTGAGTGAGGAGCATGGAAGG - Intronic
1112650974 13:101398225-101398247 GGCAGGGAAAGTAACCTGGAGGG + Intronic
1112825915 13:103392447-103392469 GGCTGGGTGAGAAGGTTGGAGGG + Intergenic
1119649190 14:76371662-76371684 GGATGGGTGAGGGACAGGGATGG + Intronic
1119770179 14:77215718-77215740 GGCTGGGTGAGTGGGAGGGAAGG - Intronic
1121779844 14:96615278-96615300 GGCGGGGTGGGTGGCATGGAGGG + Intergenic
1122473197 14:101986239-101986261 GGCTGGGAGAATCACGTGGAGGG + Exonic
1123418087 15:20106442-20106464 GGCTGGGTGGGTGGCTTGGATGG + Intergenic
1124556595 15:30731535-30731557 GGCTGGATGAGCAACATGGGTGG - Intronic
1126300970 15:47195855-47195877 GGATGGGTGAGTAAGAGGAAAGG + Intronic
1127568377 15:60215505-60215527 GGGTGGGAGAGTAACAAGCAAGG + Intergenic
1127755495 15:62087959-62087981 GGCTTGGGGAGCAACAGGGACGG - Intergenic
1128989067 15:72243318-72243340 GCCTGGATGAGTAAAATGAATGG + Intronic
1129242970 15:74262403-74262425 GGCAGGGTGAGTCAAAGGGAGGG - Intronic
1129326624 15:74803264-74803286 GGCTGGGTGGGGAGCATGGCTGG + Intergenic
1129766835 15:78174869-78174891 TGCTGTGTGAGTGACAGGGATGG - Intronic
1131869197 15:96744107-96744129 GGCTGGGTGCGAATCATGGGTGG + Intergenic
1132271340 15:100528698-100528720 GCCTGGGTGCGTAACAGAGAGGG - Intronic
1132307363 15:100826047-100826069 GGCTGGCAGAGGAACAGGGAGGG - Intergenic
1132604804 16:789189-789211 GGCTGGGGGAGACACATGCAGGG - Exonic
1132771870 16:1568010-1568032 GGCTGGGTGAGGACCATGCTGGG + Intronic
1134011229 16:10854637-10854659 GGCTGGGTGAGGATGAAGGATGG + Intergenic
1134196306 16:12161909-12161931 GGCTGGGTAATTTATATGGAAGG - Intronic
1135959551 16:26984394-26984416 AGCAGGCAGAGTAACATGGAAGG - Intergenic
1139391083 16:66606369-66606391 AGCTGGGTCAGTCCCATGGAAGG + Intronic
1141710897 16:85698416-85698438 GGCTGGGATAGTAAAAGGGAGGG - Intronic
1142896561 17:2982999-2983021 GCCTGGGTGAGTCACAGGGGAGG - Intronic
1143967999 17:10770665-10770687 TTCTGGGTGAGGAAGATGGATGG + Intergenic
1144307123 17:13978790-13978812 GGATGGGTGAGGCACATAGAAGG - Intergenic
1144716617 17:17440598-17440620 GGCTGGGTGAGGAAAGTGCAGGG - Intergenic
1145199387 17:20928721-20928743 GGCCGGGTAAGTATCAGGGACGG - Intergenic
1145215417 17:21047842-21047864 GGCTGTGTTAGTCTCATGGATGG - Intergenic
1145261409 17:21356922-21356944 GGGTGGGTGGGTAAGATGGATGG - Intergenic
1146789435 17:35743132-35743154 GGCTGGGAGGGTAACAAAGAGGG + Exonic
1147638272 17:41977330-41977352 AGCAGGGCAAGTAACATGGAAGG + Exonic
1149298064 17:55278771-55278793 GGCTGAGTTAGTAACACTGAAGG + Intronic
1149846032 17:60009723-60009745 GGCTCGGCTAGTAACTTGGAGGG + Intergenic
1150084381 17:62266303-62266325 GGCTCGGCTAGTAACTTGGAGGG + Intergenic
1150395614 17:64819501-64819523 TGCTGGGTGAGAACCCTGGAGGG + Intergenic
1153869561 18:9304784-9304806 GGCAGGGTGAGTAATTTGGCAGG + Intergenic
1155533019 18:26786521-26786543 AGCTGGGTGCCTGACATGGAAGG + Intergenic
1156596665 18:38555301-38555323 GGCAGGGCGAGAAAGATGGATGG - Intergenic
1157397817 18:47357433-47357455 TACTGTGAGAGTAACATGGATGG + Intergenic
1158586012 18:58735670-58735692 GGGTGGGTGGGTGGCATGGAGGG + Intronic
1160934915 19:1589895-1589917 GGCTGGGGGAGTAACAAGTGGGG + Intronic
1160970636 19:1766383-1766405 GGCTGGGCTTGTAACAGGGAGGG - Intronic
1162981532 19:14243456-14243478 GCCTGGGAGACTAACAAGGAGGG - Intergenic
1164536164 19:29087872-29087894 GGCTGGAGGAACAACATGGATGG + Intergenic
1166305216 19:41933510-41933532 GGCTGGGAGAGAGAGATGGATGG + Intergenic
925478373 2:4244214-4244236 GGCAAGGTGAGTAACAAGGGTGG + Intergenic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
927814050 2:26198493-26198515 GGTTGGATGAGAAACGTGGAAGG + Intronic
929708440 2:44240773-44240795 GGGTGGCTCAGTAAAATGGAGGG + Intronic
930095235 2:47561536-47561558 GGCCGGGTGAGCTACAGGGAAGG + Intronic
931969273 2:67567742-67567764 GGTTGGCTTAGTAACATGGTGGG - Intergenic
932340140 2:70958421-70958443 TGCTGGGTGAGGGACAGGGAGGG + Exonic
932814912 2:74853816-74853838 GGCTGGGTGTGGAAAGTGGATGG + Intronic
933515785 2:83299390-83299412 GGCTGGCTGAGGTACAAGGAAGG + Intergenic
935277326 2:101486198-101486220 GGCTGGCTGAAGAAGATGGAGGG - Intergenic
936476059 2:112840704-112840726 CCCTGGGTGGGTAAGATGGATGG + Intergenic
936579554 2:113685966-113685988 TTCAGGGTCAGTAACATGGACGG - Intergenic
937888338 2:126915768-126915790 GTCTAGGTGTGTAGCATGGATGG - Intergenic
938318203 2:130344586-130344608 GGCTGAGTGAGTCACAAGCATGG - Intronic
940624425 2:156154857-156154879 GGATGGATGAGTAAGATGAATGG + Intergenic
940896480 2:159085985-159086007 GGCTTGGTGAGTAATTGGGATGG + Intronic
945097447 2:206232996-206233018 TGCTGAGTGAGGTACATGGAAGG + Intergenic
1169498501 20:6136993-6137015 GGGTAGGTGAGTTAGATGGATGG - Intergenic
1170662656 20:18358192-18358214 GGCTGGGGGAGGAAGAGGGAGGG + Intergenic
1174363192 20:50041098-50041120 GGCTGAGTGGGTAACAGGGAGGG - Intergenic
1174555341 20:51391300-51391322 GGCTGGGAGATGAACATGAAAGG + Exonic
1174879986 20:54268469-54268491 GGCTGGGTGAGGAAGCTGAAAGG - Intergenic
1175137970 20:56839336-56839358 GGGTGGGTGAGTGAGATGGATGG + Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1179463124 21:41551031-41551053 GTCTGGGGCAGTGACATGGATGG + Intergenic
1181129912 22:20725118-20725140 GGCTGGCTGAGTTACATGGCTGG - Intronic
1182263020 22:29089473-29089495 GGATGGGCGAGAAACAAGGATGG - Intronic
1182555580 22:31126818-31126840 GGCTGGGTCCGTGACATGGGTGG + Intronic
1184456030 22:44609864-44609886 GGCTGGGTGATGGACATGGTGGG - Intergenic
949720703 3:6986773-6986795 GGCTGAGACAGAAACATGGAAGG - Intronic
950678082 3:14566645-14566667 TGCTTGGTGAGCAACACGGATGG - Intergenic
950730857 3:14955930-14955952 GGCTGGGTGAGTGACTAGTAGGG - Intronic
950973703 3:17216662-17216684 TGGTGGGTGGGAAACATGGAGGG - Intronic
951474982 3:23095197-23095219 GGCTGGGTTAGAGACATGCAGGG - Intergenic
953388456 3:42520610-42520632 GACTGGGTGGGGAGCATGGAGGG + Intronic
954005930 3:47590644-47590666 GCATGTGTAAGTAACATGGAGGG - Exonic
954422322 3:50425212-50425234 GGCTGGGAGGGGAACCTGGAAGG - Intronic
955874749 3:63477119-63477141 GGTTGGGCGAGTAACTGGGAGGG + Intronic
956138186 3:66119479-66119501 GGCTGTGGGAGAAACAGGGAGGG - Intergenic
957191253 3:77012576-77012598 CACTGGGTAAGTTACATGGATGG + Intronic
957784626 3:84866277-84866299 GGCTGGGGCAGGAACAAGGAGGG - Intergenic
962387308 3:134942332-134942354 GACTGGGAGAGTTACTTGGAGGG + Intronic
964569488 3:158095791-158095813 TGCTGGGTGGATAAAATGGAGGG + Intergenic
968604072 4:1523333-1523355 GGCTGGGTGACTTCCAAGGATGG - Intergenic
968761481 4:2444546-2444568 TGCTGGGTGTGGGACATGGAAGG + Intronic
969700818 4:8766591-8766613 GGCTGGGTGAGTGATTTGGAAGG + Intergenic
978531393 4:109717893-109717915 AGCTGAGAGAGTAACATGGGTGG - Intronic
980084868 4:128380598-128380620 GGCTGGCTGGGTCACATTGAAGG - Intergenic
981720540 4:147797319-147797341 GGAAGGGTGAGGAACATAGAAGG - Intronic
981782271 4:148443037-148443059 GGCTGGGAGAGGAACCTCGAGGG - Intronic
982537590 4:156626109-156626131 GCCTGGGTGATTAATATGCATGG - Intergenic
984526772 4:180867018-180867040 GCCTGGGTGGGTGCCATGGACGG - Intergenic
984770028 4:183429429-183429451 GGATGGGTGGGGTACATGGATGG - Intergenic
986892934 5:12331278-12331300 GGCTAGGTGAATAACATGCCTGG + Intergenic
990194651 5:53301042-53301064 GTCTGGGAGACTACCATGGATGG - Intergenic
990602680 5:57376902-57376924 GAGTGGGTGAGTAACATGGCAGG - Intergenic
992641891 5:78774861-78774883 AGCAGGGAGAGGAACATGGAAGG + Intergenic
996747444 5:126857455-126857477 GGCAGGGGGAGTGACAAGGAAGG + Intergenic
999365687 5:151021984-151022006 AAAGGGGTGAGTAACATGGAAGG - Intronic
1002167329 5:177356412-177356434 GCCTGGGTGAGTAACAGAGCAGG + Intergenic
1002215781 5:177631600-177631622 GGCTGGGAGAGCAGCTTGGAGGG + Intergenic
1015916171 6:138219385-138219407 AGCTGGGTGTTAAACATGGAAGG + Intronic
1017582381 6:155880274-155880296 GGTTGAGTGAGTAACATGTTTGG + Intergenic
1020943241 7:14566691-14566713 GGGGGAGTGAGTAACATGAAAGG - Intronic
1022505267 7:30905669-30905691 GGCTGGGAGAGTAAAAGGCAGGG + Intergenic
1022816980 7:33923329-33923351 GGCTGGGTGAGTATTACAGACGG - Intronic
1026177769 7:68012946-68012968 GGCTGTGTTACTAACAGGGAAGG + Intergenic
1026645186 7:72161334-72161356 GGCTGGGTGATTATCACTGAAGG - Intronic
1027862239 7:83599753-83599775 GGCTGGGTGTAAAACATGGTTGG - Intronic
1031927827 7:127654763-127654785 GGTTGGGTGAGTTACAGGCAGGG + Intronic
1032256483 7:130301231-130301253 TTCTGGGTGAGTAAAATAGAGGG - Intronic
1032600591 7:133289801-133289823 GACTGGGTGGGTAAAAGGGAAGG - Intronic
1032752472 7:134855072-134855094 GGCTGTATGAGTAACATGGCTGG - Intronic
1035705273 8:1670162-1670184 GGCTGGGTGGATATCCTGGAGGG - Intronic
1035846493 8:2871164-2871186 AGCTGGGTGGGTGACATTGATGG + Intergenic
1036594621 8:10200631-10200653 TGCTGGGTGAGTCACTGGGAGGG - Intronic
1036639787 8:10575586-10575608 GTCAGGGTGAGAAACAGGGAAGG - Intergenic
1036753319 8:11456719-11456741 GGCTGGGTAAGAGACATGGGCGG + Intronic
1040426711 8:47295456-47295478 GGCTGGGAGAGAAAAGTGGATGG - Intronic
1043814078 8:84780144-84780166 GGCTGGGTAGGTGAAATGGAAGG - Intronic
1044789104 8:95828176-95828198 GTCTGGGTGACTAACATAAAGGG - Intergenic
1045635725 8:104186627-104186649 GGCTGGGATATTAACATGAAGGG - Intronic
1049147663 8:141013483-141013505 GGCTGGGTCATTAACAAGGCAGG + Intergenic
1049493242 8:142916188-142916210 GGCTGGGTGCGCATAATGGAAGG - Intronic
1050008545 9:1160537-1160559 GGATGGTGGAGCAACATGGAAGG + Intergenic
1050771423 9:9206184-9206206 GGCTGAGTGAGTGATAGGGAAGG + Intronic
1056716138 9:89031396-89031418 GGCTGGGTGAGAGAAAGGGATGG - Intronic
1057585538 9:96325327-96325349 GGCTGAGAAAGAAACATGGATGG + Intronic
1058006288 9:99918882-99918904 GGTTGGGTGAGGAGCTTGGAGGG + Intronic
1059149251 9:111933804-111933826 GGCTGGGGGAGGAGCAAGGAAGG - Exonic
1061212473 9:129201883-129201905 GGCTGGGTGGGAGACATGTATGG + Intergenic
1187149391 X:16668233-16668255 GGCTGGGTGAGAAAGAAGGAAGG + Intronic
1187968939 X:24640325-24640347 GGCAGGGTAAGTTTCATGGAGGG - Intronic
1188959449 X:36472037-36472059 GGCTGTATGAGGAACATGGCTGG - Intergenic
1195617337 X:106922643-106922665 GCCTGGGTGAGGAGCAGGGAGGG + Intronic
1197131320 X:123008732-123008754 TTCTGGGTGAGTAGGATGGAAGG + Intergenic
1197923854 X:131626184-131626206 AGATGTGTGAGTAAAATGGAAGG + Intergenic
1199823897 X:151478389-151478411 GGCAGGCTGAGTGCCATGGAAGG - Intergenic