ID: 906196670

View in Genome Browser
Species Human (GRCh38)
Location 1:43934232-43934254
Sequence GTCCTGCACCTTGTTCTTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 174}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906196670_906196684 17 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196684 1:43934272-43934294 GCTGGTGGATGGGGAGGCAAGGG 0: 1
1: 0
2: 2
3: 65
4: 642
906196670_906196672 -6 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196672 1:43934249-43934271 CAGGACCCCGTGGTGAGTAGCGG 0: 1
1: 0
2: 1
3: 11
4: 134
906196670_906196678 2 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196678 1:43934257-43934279 CGTGGTGAGTAGCGGGCTGGTGG 0: 1
1: 0
2: 1
3: 15
4: 169
906196670_906196682 11 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196682 1:43934266-43934288 TAGCGGGCTGGTGGATGGGGAGG 0: 1
1: 0
2: 1
3: 35
4: 292
906196670_906196681 8 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196681 1:43934263-43934285 GAGTAGCGGGCTGGTGGATGGGG 0: 1
1: 0
2: 0
3: 16
4: 172
906196670_906196679 6 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196679 1:43934261-43934283 GTGAGTAGCGGGCTGGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 368
906196670_906196680 7 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196680 1:43934262-43934284 TGAGTAGCGGGCTGGTGGATGGG 0: 1
1: 0
2: 2
3: 10
4: 105
906196670_906196683 16 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196683 1:43934271-43934293 GGCTGGTGGATGGGGAGGCAAGG 0: 1
1: 0
2: 8
3: 137
4: 990
906196670_906196673 -5 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196673 1:43934250-43934272 AGGACCCCGTGGTGAGTAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 122
906196670_906196675 -1 Left 906196670 1:43934232-43934254 CCTAGAAGAACAAGGTGCAGGAC 0: 1
1: 0
2: 0
3: 21
4: 174
Right 906196675 1:43934254-43934276 CCCCGTGGTGAGTAGCGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906196670 Original CRISPR GTCCTGCACCTTGTTCTTCT AGG (reversed) Exonic
901673596 1:10869833-10869855 GTCCTGCCCCTGGTGCTCCTGGG + Intergenic
905323255 1:37132424-37132446 GTCCTGCTACTCCTTCTTCTGGG - Intergenic
906196670 1:43934232-43934254 GTCCTGCACCTTGTTCTTCTAGG - Exonic
907029680 1:51158178-51158200 GTCCTCCTCCTTGCTCTCCTTGG + Intergenic
908408928 1:63843395-63843417 GTCCTCCTCCTTGCTCTCCTTGG + Intronic
910498944 1:87866330-87866352 TTTCTCCACCTTTTTCTTCTAGG + Intergenic
912715760 1:111982610-111982632 ATCCTGCCGCTTGTTCTTGTCGG + Exonic
914387017 1:147179596-147179618 CTCCTGTGCCTTCTTCTTCTTGG - Intronic
916811347 1:168308324-168308346 GTCCAGGAACTTATTCTTCTCGG - Intronic
917578761 1:176351355-176351377 GTCCTGCAGCTTCTTTTCCTAGG - Intergenic
919450181 1:197762793-197762815 ATCATGCAACTTGTTCTTCCTGG + Intronic
1063221360 10:3971406-3971428 GTCTTGCACTTTTTTCTTCTGGG + Intergenic
1064714942 10:18167063-18167085 CACCTGCACCCTGTTCTTCAAGG + Intronic
1066065362 10:31757689-31757711 TTCCTCCACCTTCTTTTTCTTGG + Intergenic
1069789807 10:71012312-71012334 GTCCTGCCCATGGTTCTTCCAGG - Intergenic
1070490226 10:76969153-76969175 GTTCTGCAGTTTCTTCTTCTTGG - Intronic
1071601344 10:86960004-86960026 GGCCTGCTCCTTGGTCTTCTCGG - Exonic
1074843117 10:117374847-117374869 GAACTCCACCTTGATCTTCTTGG + Exonic
1075283300 10:121160146-121160168 ATCTTGGACCTTGATCTTCTGGG - Intergenic
1076622100 10:131796701-131796723 GTCCTCAACTTTGTTCTTCCTGG + Intergenic
1077669862 11:4147238-4147260 CTCCTGCACCAAGTTCTTCCTGG - Intergenic
1077873197 11:6280636-6280658 TTACTGCTCCTTGTTCTTCGGGG + Intergenic
1081024410 11:37992197-37992219 GTCTTGTACCTTATTCCTCTTGG - Intergenic
1081701675 11:45156407-45156429 GCCCTGCACCAGGTTCCTCTTGG + Intronic
1083494996 11:63043761-63043783 GTCCAGCACTTTTGTCTTCTTGG - Intergenic
1083849333 11:65355852-65355874 TTCCAGCACCTGGATCTTCTCGG - Exonic
1084170494 11:67398610-67398632 GTACTTCCCCTTGTTCTTGTCGG + Exonic
1084238182 11:67801559-67801581 GTCCTGCACTTGGTTTCTCTCGG - Intergenic
1084446406 11:69206089-69206111 GTCCCGCACCTTTGTCTGCTGGG + Intergenic
1086294910 11:85354468-85354490 TTCCTTCCCCTTGTTCTTCAGGG + Intronic
1087041601 11:93806396-93806418 TTCCTGCATTTTGTTCATCTAGG + Intronic
1090913517 11:131142350-131142372 GTCCAGCACCCTGTTCTGCCTGG - Intergenic
1091126790 11:133107119-133107141 GTCCTGCACAATCTTCCTCTTGG - Intronic
1091638599 12:2216578-2216600 GTCCTGAAGCCTCTTCTTCTGGG - Intronic
1096197375 12:49657326-49657348 CTCCTGCACCCTGTCCCTCTTGG - Intronic
1096756585 12:53804647-53804669 GTCCTGTGCATAGTTCTTCTTGG + Intergenic
1098361169 12:69655670-69655692 CTCCTGTAGCTTCTTCTTCTGGG + Exonic
1100803388 12:98256578-98256600 GTCATGCACCTGTTTCTTCATGG + Intergenic
1102205945 12:111090976-111090998 GTGCTTCTCCTTGATCTTCTGGG + Intronic
1105308655 13:19187244-19187266 GTCCCACACCTTCTGCTTCTGGG - Exonic
1105975132 13:25466817-25466839 GTCCTGGAGCTTGGGCTTCTGGG + Intronic
1106102504 13:26707133-26707155 GTCCTGCACCCTGAGCTGCTGGG + Intergenic
1106250528 13:27978660-27978682 GTCCTGGACCTTGCGCTTCTCGG + Intronic
1112183882 13:97110176-97110198 TTCCTGCACCGTGTTCTTTTCGG + Intergenic
1112644055 13:101309302-101309324 AGCCTGCATCTTGTTATTCTAGG + Intronic
1113143784 13:107184495-107184517 GTCCTCCACTTTGCTTTTCTAGG + Intronic
1114838549 14:26234150-26234172 TTCCTGCATCTTGGACTTCTTGG - Intergenic
1115056569 14:29135101-29135123 GTCCTGCACTTTTTTTTTTTTGG + Intergenic
1116361133 14:43999495-43999517 GTTCTTCACCTTGGTCTTCCTGG - Intergenic
1119440384 14:74624296-74624318 GTCCTTAGCCTTATTCTTCTTGG - Intergenic
1120889095 14:89475968-89475990 TTCCTGCCCCTTGTTCACCTGGG + Intronic
1121608999 14:95262921-95262943 GCCACGCAGCTTGTTCTTCTGGG + Intronic
1122562015 14:102622536-102622558 GTTTTTCACCTTGATCTTCTTGG + Intronic
1122952242 14:105051411-105051433 GTGCTTCACCTTGGCCTTCTGGG + Exonic
1124570337 15:30857042-30857064 CTCCTTCTCCTTCTTCTTCTAGG + Intergenic
1125254187 15:37744632-37744654 GTACAGCTCCTTGTTCCTCTGGG + Intergenic
1126021378 15:44405415-44405437 TTCCTGCATCTTTTTGTTCTTGG - Intronic
1127830495 15:62746287-62746309 GTCCAGCACCCTGTTCTACATGG - Intronic
1129237232 15:74230982-74231004 TTGCTGCACCTAGTTCTTGTGGG - Intergenic
1129664957 15:77574400-77574422 GTCCTGCACCTTGATCCTCAGGG - Intergenic
1131218074 15:90557230-90557252 TTCCTTAACCTTGTACTTCTAGG + Intronic
1131866700 15:96718585-96718607 TTCCTGCATCCTGTTCCTCTTGG - Intergenic
1135934965 16:26771762-26771784 ATCCTGCTCCTTGCTCTGCTTGG + Intergenic
1137420914 16:48333244-48333266 GTCCTGCTCCTTGTATGTCTAGG + Intronic
1140287775 16:73620977-73620999 TTCCTGCCCCTTGGTCTCCTTGG + Intergenic
1146608923 17:34287623-34287645 ATCCTGCACCCACTTCTTCTTGG - Exonic
1146829101 17:36051687-36051709 GTTCTGAACTTTGTTTTTCTTGG - Intergenic
1149895585 17:60426225-60426247 GTACTTCAGCTTCTTCTTCTGGG - Exonic
1151703920 17:75757021-75757043 GGCCTGCACCTTGAACTTGTAGG - Exonic
1152930070 17:83104875-83104897 GCCCTTCTCCTTGTTGTTCTTGG + Intergenic
1154020861 18:10663025-10663047 GTCCTGCCTCATGTTCTTCCTGG - Intergenic
1155285731 18:24287378-24287400 GTTCTGCACCTTATTCTTTGTGG - Intronic
1155925199 18:31648451-31648473 GTCCTTCACCTTGACCTTCTAGG - Intronic
1156090837 18:33466716-33466738 GTTCTGCAGCTTCTGCTTCTGGG - Intergenic
1157312122 18:46560381-46560403 GTCCTTCTCCTTCTTCTTCCGGG + Intronic
1161446781 19:4323169-4323191 GTCCAGCACCTTGACCTTGTTGG - Exonic
1161602091 19:5190520-5190542 GTCAGGCACCTGGTTCCTCTTGG - Intronic
1162352391 19:10158543-10158565 GGGCTTCACCTTGTTCTTCGTGG - Intronic
1162465709 19:10838602-10838624 GTCCTGGTCCTTGTTCTTCGTGG - Intronic
1162934744 19:13976282-13976304 TCCCTGCCACTTGTTCTTCTGGG - Intronic
1165480371 19:36059991-36060013 GTGCTGCTGCTTGTTCTCCTTGG - Exonic
1166315745 19:41988515-41988537 CTCCTTGCCCTTGTTCTTCTTGG + Exonic
1168365716 19:55785160-55785182 CTGCTGCACCATGTTCTTCCCGG - Intergenic
925011128 2:487313-487335 TCCCTGCAGCCTGTTCTTCTGGG + Intergenic
925958263 2:8990977-8990999 GTCCTCTACCTTCATCTTCTTGG + Intronic
926249205 2:11144071-11144093 GTCCTCCAGCTTCTTCTTCCGGG - Exonic
927915008 2:26930003-26930025 GTCCTGCTCCTTGTCCCTCGAGG - Intronic
928772751 2:34721178-34721200 GTTCTGCACATGGTTCATCTGGG + Intergenic
930953748 2:57177712-57177734 GTCCTGCTTCTTGTGCTTTTTGG + Intergenic
931993175 2:67811065-67811087 GTCCTGGACCTTTTTTTTGTTGG - Intergenic
934478079 2:94606052-94606074 GTCCTGTACATTGTACTTCTCGG - Intergenic
934666550 2:96175412-96175434 GTCTAGAACCTTGGTCTTCTGGG - Intergenic
934695278 2:96395575-96395597 GTTCTTCACCTTTCTCTTCTAGG - Intergenic
936900044 2:117472376-117472398 CACCTGCACCTTGCACTTCTTGG - Intergenic
938300075 2:130204293-130204315 GTCCCACACCTTCTGCTTCTGGG - Intergenic
938456639 2:131470197-131470219 GTCCCACACCTTCTGCTTCTGGG + Intronic
941002635 2:160218001-160218023 TTCCTGCTCCTTCTTTTTCTAGG + Intronic
941627723 2:167848106-167848128 GTCCTGGACCTTTTTTTTGTTGG - Intergenic
943375688 2:187073591-187073613 GTGTTGCAGCTTGTGCTTCTGGG - Intergenic
944324033 2:198382550-198382572 CTCCTGCTCCATGTTATTCTAGG - Intronic
944553331 2:200865196-200865218 GTTCTGCACCTTGATCCTCATGG + Intergenic
946668605 2:222077537-222077559 GTCGTACACCTTGTTTATCTAGG - Intergenic
948077202 2:235174165-235174187 GTTCAGCACCTTTTTCTACTAGG - Intergenic
948729467 2:239953872-239953894 GTCCTCCACCTCGCTCTTCCTGG - Intronic
1169019809 20:2321199-2321221 TTCCTGCATCTTGTTCCTCTTGG - Intronic
1170850070 20:19996731-19996753 GTCGCGCTGCTTGTTCTTCTTGG - Exonic
1171022761 20:21601763-21601785 GGGCTGCAACTTATTCTTCTAGG + Intergenic
1174647585 20:52099076-52099098 GTCCTGTCCCCTGTACTTCTTGG - Intronic
1178610561 21:34074969-34074991 GTCCCCCAGCTTGTTCTTCATGG + Intronic
1179979971 21:44890779-44890801 GTCCTGCAGCTTCCTCCTCTGGG - Intronic
1183017722 22:35003394-35003416 GGTTTGAACCTTGTTCTTCTTGG - Intergenic
1183951807 22:41356715-41356737 GACCTTCTCCTTGTGCTTCTCGG - Exonic
952797240 3:37251416-37251438 GTCCTGCTCCTCATTCTTGTTGG - Exonic
953622269 3:44543422-44543444 GTTCTACACATTGTTCTTCCAGG - Intergenic
955440170 3:58946642-58946664 GTCCTGCACATTTTTCTTCATGG - Intronic
961392208 3:126558806-126558828 GTCCTGCAGCTTGTCCTTTCTGG - Exonic
964735388 3:159911969-159911991 GTCCTCCACATTGTTCCTCATGG + Intergenic
967355770 3:188569242-188569264 GTTCTGTACCTTGTCCTTGTAGG + Intronic
967784645 3:193478633-193478655 GTCCTGGACTTTTTTTTTCTTGG - Intronic
969201594 4:5610738-5610760 CTCTTGCAGCGTGTTCTTCTTGG + Intronic
971669770 4:29542303-29542325 GTCCTGTACCTCATTCTTCCTGG - Intergenic
973703582 4:53560123-53560145 GTCCTGAAACATGCTCTTCTTGG + Intronic
974469643 4:62302249-62302271 GTACTGCTGCTTGTTCTTCAGGG - Intergenic
975171342 4:71235019-71235041 GTCCTGCACTGTGTGCTTTTAGG + Intronic
975801990 4:78069712-78069734 GCCCTTCCTCTTGTTCTTCTTGG - Intronic
976619651 4:87114917-87114939 GTCCTCCACATTGTCCTTCGCGG - Exonic
978313113 4:107408157-107408179 TTGCTGAACCTTGTTCTGCTAGG - Intergenic
979711802 4:123788638-123788660 GTCCTGCCCCTTATCCTTGTTGG - Intergenic
980186802 4:129472285-129472307 GTCCTGAACTTTTTTTTTCTTGG + Intergenic
981674004 4:147320170-147320192 CTCCTGCTCCTTGTCCCTCTAGG + Intergenic
985266530 4:188156681-188156703 GTCCTGCACCGTGTGCGTGTTGG + Intergenic
987300217 5:16590377-16590399 GACCTGCAGCTTGTCCTTCGAGG - Intronic
991584050 5:68184792-68184814 GTATTGCTCCTTGTTCTTTTGGG - Intergenic
995185900 5:109269684-109269706 TTCCTTCACCTTGTTCATCTGGG - Intergenic
995840073 5:116435672-116435694 GTCCTGGACCATGGGCTTCTGGG + Intergenic
996117639 5:119635204-119635226 ATCGTGCACCTGGTGCTTCTGGG + Intronic
997787434 5:136726293-136726315 GTCCTGCATCTTATTTCTCTTGG - Intergenic
998867848 5:146523032-146523054 GTCCTGCACTTTTTTCTGCCAGG + Intergenic
999757548 5:154676207-154676229 GGCCTCCACCTTGTTCTCCCTGG + Intergenic
999822762 5:155244748-155244770 GTCCTGGACTTTTTTCTTGTTGG + Intergenic
1002366600 5:178717378-178717400 GTCCTGAGTCTTGTTATTCTTGG - Intronic
1011461389 6:87608888-87608910 TTACTGAACCTTTTTCTTCTTGG + Intronic
1011472238 6:87719330-87719352 CTCCTTCAACTTGCTCTTCTAGG - Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1013911989 6:115286838-115286860 GTCATACTCCTTGTTCATCTGGG + Intergenic
1014446826 6:121537487-121537509 TCACTGCACCTTGATCTTCTGGG - Intergenic
1014617457 6:123620950-123620972 GTTCTGCACCTTGCTGTCCTGGG - Intronic
1014845227 6:126267824-126267846 CTCCTGTTCCTTGTTTTTCTGGG + Intergenic
1015427367 6:133087521-133087543 GTCTTGTACCTTGTGCCTCTTGG - Intergenic
1015849412 6:137556440-137556462 GTCCTGGACTTTTTTCTTGTTGG + Intergenic
1017206144 6:151806676-151806698 GTCCTACAACTCGATCTTCTCGG - Intronic
1017771242 6:157646000-157646022 GTTCTGCACGTTTCTCTTCTGGG + Intronic
1017977665 6:159372370-159372392 GTCCTTGTCCTTGTTCTTCTTGG + Intergenic
1018395505 6:163375207-163375229 GTCCTCCTCCTTGTTCCTCCCGG - Intergenic
1020410705 7:7888853-7888875 CTCCTCCTCCTTCTTCTTCTTGG - Intronic
1021592289 7:22276643-22276665 GTTCTGAATCTTGGTCTTCTAGG - Intronic
1022465965 7:30653403-30653425 CTCCTCCACCTTCTTCCTCTGGG - Exonic
1022542882 7:31154785-31154807 GTCCTGCAACATGATTTTCTAGG - Intergenic
1023129218 7:36986004-36986026 TTCCAGCACATTGTTCTTCAGGG - Intronic
1024584399 7:50828929-50828951 TACCTGCACCTTGTTGATCTTGG + Intergenic
1024984617 7:55184140-55184162 GTTCTGCCCCTTGTCTTTCTGGG + Intronic
1028102167 7:86833707-86833729 GTGGTTCACCTTTTTCTTCTTGG + Intronic
1032448984 7:132010447-132010469 TTCCTCCACCTTGTTTATCTTGG + Intergenic
1034014364 7:147566288-147566310 CTCCTCCTCCTTCTTCTTCTTGG - Intronic
1034340911 7:150354440-150354462 CTCCTGCACCTTGTGTCTCTTGG + Intergenic
1034401959 7:150868261-150868283 GTGCTGCATGTGGTTCTTCTAGG - Intergenic
1036019003 8:4821042-4821064 CCCCTCCACATTGTTCTTCTTGG - Intronic
1036020775 8:4843218-4843240 TTCCTGCATCTTGTGATTCTAGG + Intronic
1038516680 8:28193493-28193515 GTCCTTCACCTTCCTCATCTTGG + Intergenic
1042784685 8:72535298-72535320 GCCCTGCCCTTTGCTCTTCTTGG - Intergenic
1044192229 8:89332631-89332653 GTCCTGAATCTTCTTCATCTGGG + Intergenic
1045912498 8:107426606-107426628 TTCCTGGACTTTGATCTTCTAGG + Intronic
1046155349 8:110282370-110282392 GTTTTGCAATTTGTTCTTCTAGG - Intergenic
1046420592 8:113978632-113978654 GTCCTGGACATTTTTTTTCTTGG - Intergenic
1047014205 8:120705394-120705416 GTCCTGTACATTGTTTTTCTAGG - Intronic
1048275529 8:133062963-133062985 GTCCTGCTCCTTGGGCTTCCTGG + Intronic
1050698200 9:8303086-8303108 GTCCTGCTTTTAGTTCTTCTGGG + Intergenic
1053679976 9:40480056-40480078 GTCCTGTACATTGTACTTCTCGG + Intergenic
1053929972 9:43108366-43108388 GTCCTGTACATTGTACTTCTTGG + Intergenic
1054283736 9:63144879-63144901 GTCCTGTACATTGTACTTCTCGG - Intergenic
1054293058 9:63315566-63315588 GTCCTGTACATTGTACTTCTCGG + Intergenic
1054391083 9:64620059-64620081 GTCCTGTACATTGTACTTCTCGG + Intergenic
1054504645 9:65896267-65896289 GTCCTGTACATTGTACTTCTCGG - Intergenic
1056788714 9:89611395-89611417 GTCCAGAAGCTTGTTCATCTTGG + Intergenic
1058265720 9:102897291-102897313 GTCCTGCTCCTTGTACTTCCTGG - Intergenic
1058941741 9:109819578-109819600 GTCTTGCATCCTGTGCTTCTGGG - Intronic
1185547413 X:956473-956495 GTCCTCCACCTTTCTGTTCTGGG + Intergenic
1186362783 X:8860040-8860062 GCCCTGCACATTGTTTTTCTAGG + Intergenic
1187206503 X:17186794-17186816 CTCCTGTACCTTCTTGTTCTGGG + Intergenic
1194723227 X:97364831-97364853 GTCCTGCATATTTTTCTTCCTGG + Intronic
1195390007 X:104351670-104351692 GTCCCACACTTTGTGCTTCTGGG + Intergenic
1199210152 X:145198981-145199003 GTCCTGTTCCATGATCTTCTAGG - Intergenic
1199530759 X:148845012-148845034 GCCCTCCCCCTTGTTATTCTAGG + Intronic
1199856281 X:151761621-151761643 TTCCTCTACCTTGTTCATCTGGG - Intergenic
1200337461 X:155365309-155365331 TTCCTCCATCATGTTCTTCTGGG + Intergenic
1200349009 X:155475918-155475940 TTCCTCCATCATGTTCTTCTGGG - Intergenic