ID: 906197260

View in Genome Browser
Species Human (GRCh38)
Location 1:43936732-43936754
Sequence AGCCGCAGGCGGTGGCGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 3, 2: 6, 3: 35, 4: 304}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906197260_906197275 30 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197275 1:43936785-43936807 GCAGACTGGACCCTTACCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 62
906197260_906197270 2 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197270 1:43936757-43936779 CTGGGCTGAGGGCTCGCTCCAGG 0: 1
1: 0
2: 1
3: 38
4: 314
906197260_906197274 27 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197274 1:43936782-43936804 TTTGCAGACTGGACCCTTACCGG 0: 1
1: 0
2: 0
3: 8
4: 136
906197260_906197272 16 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197272 1:43936771-43936793 CGCTCCAGGGCTTTGCAGACTGG 0: 1
1: 0
2: 1
3: 11
4: 130
906197260_906197268 -9 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197268 1:43936746-43936768 CCTGCGGCTGCCTGGGCTGAGGG 0: 1
1: 0
2: 2
3: 37
4: 425
906197260_906197266 -10 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197266 1:43936745-43936767 GCCTGCGGCTGCCTGGGCTGAGG 0: 1
1: 0
2: 9
3: 59
4: 610
906197260_906197271 3 Left 906197260 1:43936732-43936754 CCTCTCCGCCACCGCCTGCGGCT 0: 1
1: 3
2: 6
3: 35
4: 304
Right 906197271 1:43936758-43936780 TGGGCTGAGGGCTCGCTCCAGGG 0: 1
1: 0
2: 0
3: 24
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906197260 Original CRISPR AGCCGCAGGCGGTGGCGGAG AGG (reversed) Exonic
900110986 1:1005602-1005624 AGAGGCAGGCGGTGGAGGGGAGG - Intergenic
900312951 1:2043286-2043308 AGCCGAGGGCGGTGGAGGTGGGG + Intergenic
900335022 1:2158424-2158446 AGGCGCAGGCGGTGCGGGCGAGG - Intronic
900420926 1:2555612-2555634 TGCAGCAGGCGGTGCCAGAGGGG + Intergenic
900467021 1:2830861-2830883 AGCAGCAGGCGGCGGGGGCGGGG - Intergenic
900645438 1:3706760-3706782 CGCCACAGACGGTGGCGCAGGGG + Intronic
900693126 1:3993782-3993804 AATGGCAGGCGGTGGCGGGGAGG + Intergenic
900725839 1:4215972-4215994 AGAGGCAGGGGGTGGTGGAGAGG - Intergenic
901701494 1:11046949-11046971 AGGCGCAGGCGGTAGCCGGGGGG + Exonic
902690580 1:18108096-18108118 AGCTGGCGGCGGTGGCGGGGCGG - Exonic
904263237 1:29303305-29303327 GGCCGCAGCCAGTGGGGGAGTGG - Intronic
904275785 1:29383360-29383382 AGAGGCAGGAGGTGGTGGAGTGG + Intergenic
904356783 1:29945382-29945404 AGCCAGAGGCCCTGGCGGAGAGG - Intergenic
904635875 1:31880780-31880802 TGGAGCAGGAGGTGGCGGAGTGG - Intergenic
904756550 1:32771488-32771510 AGGGGCAGGGGGTGGGGGAGGGG - Exonic
904811555 1:33166328-33166350 AACCGCAGGGGGTGGGGGTGGGG - Intronic
905375011 1:37514397-37514419 AGCCGCAGGAGGGGGCGTGGAGG - Intronic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
905449151 1:38046194-38046216 GGCGGCGGGCGGTGGCGGCGCGG - Exonic
905990777 1:42335260-42335282 CGCAGGAGGCGGTGGCGGCGAGG - Intronic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
906223728 1:44103892-44103914 AGCTGCAGGCGCTGGCTGGGAGG - Intergenic
907069244 1:51519134-51519156 AGCTGAGGGCGGTGGGGGAGGGG + Intronic
907093479 1:51752234-51752256 AGCCGGGGGCGGGGGTGGAGGGG - Intronic
907320472 1:53599072-53599094 AGCCCCAGGCAGTGGGTGAGGGG + Intronic
912272932 1:108228962-108228984 AGCTGCAGGTGGTGGAGGAAAGG + Exonic
912295288 1:108465360-108465382 AGCTGCAGGTGGTGGAGGAAAGG - Exonic
912384473 1:109264392-109264414 GGCTGCAGGTGGTGGGGGAGGGG - Intronic
913671112 1:121097866-121097888 AGCCGGAGGCGGCGGCGGCAGGG + Intergenic
914022879 1:143885287-143885309 AGCCGGAGGCGGCGGCGGCAGGG + Intergenic
914192783 1:145425621-145425643 AGGCGCAGGCGCAGGCGCAGCGG + Intergenic
914661366 1:149793231-149793253 AGCCGGAGGCGGCGGCGGCAGGG + Intronic
914869046 1:151458597-151458619 AGGGGCGGGCGGCGGCGGAGCGG - Intronic
915326822 1:155085077-155085099 CGCCGCAGGCTGTGGGGAAGAGG - Exonic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
915528279 1:156489280-156489302 AGCAGCAGGCGCTGGGGGAGGGG + Intronic
916666929 1:166975347-166975369 GGCAGCGGGCGGCGGCGGAGCGG + Intronic
917974409 1:180229944-180229966 AGGCGGAGGCGGAGGCGGGGAGG + Intergenic
917979067 1:180258324-180258346 GGCCCCAGGAGGAGGCGGAGTGG + Intronic
918634878 1:186763948-186763970 AGAGGCAGGAGGTGGCTGAGTGG - Intergenic
922056091 1:222043813-222043835 AGCCGCAGGCTGGGCAGGAGGGG + Intergenic
922526674 1:226309346-226309368 GGCCGGAGGCGGCGGCGGAGGGG - Exonic
922586317 1:226737226-226737248 AGCCCCGGGGGCTGGCGGAGCGG - Exonic
922665680 1:227466547-227466569 AGGCACAGGCAGTGGTGGAGAGG + Intergenic
922784364 1:228275790-228275812 AGCCGCAGACGGTGGAGGAGCGG + Exonic
923744305 1:236686411-236686433 GGCCGGGGGCGGTGGCGGCGGGG + Intergenic
924948053 1:248858944-248858966 AGGCGCAGGCGCAGGCGCAGTGG - Intronic
1064179184 10:13100175-13100197 GGGCGGCGGCGGTGGCGGAGGGG - Exonic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1067051967 10:43026782-43026804 AGACCCAGGCGGTGGGGGAGGGG - Intergenic
1069961355 10:72081101-72081123 AGCCACAGGCCGTGGTGCAGGGG + Intronic
1070305092 10:75235013-75235035 AGCCCCAGGCGGGGGCGCAACGG - Intronic
1071966592 10:90858108-90858130 GGCCGGAGGCGGCGGCGGCGGGG - Intergenic
1072021838 10:91410290-91410312 GGGCGCGGGCGGGGGCGGAGTGG + Exonic
1072336715 10:94403659-94403681 AGCCGGAGCCGGAGCCGGAGCGG + Intronic
1072791823 10:98323426-98323448 GGCCACAGGCGGGGGTGGAGGGG - Intergenic
1074865483 10:117542308-117542330 AGGAGGAGGCGGTGGCTGAGGGG + Intergenic
1075519426 10:123135206-123135228 AGCCCCAGGGGGCGGGGGAGCGG + Intergenic
1076642721 10:131929704-131929726 AGCTGCCGGTGGTGGCGGGGAGG - Intronic
1078556073 11:12327186-12327208 AGCTGGAGGAGGTGGAGGAGCGG + Exonic
1079210384 11:18455798-18455820 ACCCGCACGCGGGGGCGGGGCGG + Intergenic
1081854600 11:46295631-46295653 AGCAGCAGCCGGTGGCGGCGTGG - Intronic
1081928537 11:46851071-46851093 AACCGCAGGGGGTGGGGGCGGGG - Intergenic
1083048259 11:59755390-59755412 AGGCGCCGGTGGGGGCGGAGGGG + Exonic
1083206622 11:61153717-61153739 AGACACAGGCAGTGGAGGAGAGG + Intronic
1083657089 11:64234840-64234862 AGCAGCAGGCGGCGGAGCAGAGG - Exonic
1084066148 11:66705431-66705453 ACCCGCAGCTGGTGTCGGAGCGG - Exonic
1084169246 11:67392534-67392556 TTCAGCAGGTGGTGGCGGAGCGG + Intronic
1085739973 11:79070107-79070129 AACCCCAGGCAGTGGAGGAGAGG + Intronic
1087754178 11:102037591-102037613 AGCCCCAGGTGGTGGTGGGGTGG + Intergenic
1089215988 11:116835094-116835116 AGCCGCAGGGGGTGGAGGACTGG + Intergenic
1089292147 11:117443857-117443879 AGCCTGAGGCTGTGGCAGAGGGG - Intronic
1089713767 11:120336633-120336655 AGCCGCTGGCGCCGGCGGAGAGG - Intergenic
1090085387 11:123645780-123645802 AACAGCAGGTGGTGGGGGAGGGG + Intronic
1091390937 12:125743-125765 AGCTGCAGGAGGAGGAGGAGCGG + Exonic
1091399323 12:172899-172921 AGGCGCAGGCTGTGGCCCAGAGG + Intronic
1091587871 12:1826591-1826613 CCCCGCAGGCGTTGGCAGAGGGG - Intronic
1091634064 12:2184079-2184101 AGCTGCAGGCAGTGGGGGATGGG - Intronic
1091740795 12:2959334-2959356 AGCCGGAGGGAGTGGCGGCGGGG - Intronic
1092172888 12:6384444-6384466 AGCCCCAGGCGGTGAGGAAGGGG + Exonic
1092193347 12:6535200-6535222 TGCCGGAGGCCGTGGGGGAGGGG - Intronic
1092222415 12:6724093-6724115 AGCTGCCGGAGGTGACGGAGCGG + Exonic
1094536563 12:31326435-31326457 GGCTGCAGGCCGCGGCGGAGAGG + Intronic
1094833233 12:34309967-34309989 AGCCCAAGGCCGTGGGGGAGAGG - Intergenic
1097191157 12:57220270-57220292 AGCCGGAGCCGGAGGGGGAGTGG - Intronic
1098595967 12:72273146-72273168 AGCCGCCGTCGGAGGAGGAGCGG + Exonic
1101236211 12:102792855-102792877 AGCCGGAGGGGGTGGGGGAGTGG - Intergenic
1102907620 12:116688848-116688870 AGAAGCAGGCGGTGGTGGGGTGG + Intergenic
1103392470 12:120584572-120584594 AGACGCCGGCGGTGGCCGGGCGG + Intergenic
1104535223 12:129612249-129612271 AGCCGCAGGCAGTGATGGACAGG - Intronic
1104935702 12:132363251-132363273 GGACGCTGGCGGTGGGGGAGGGG + Intergenic
1106160408 13:27196311-27196333 AGGAGCAGGCGCTGGGGGAGAGG - Intergenic
1106956403 13:34942889-34942911 GGCCGCTGGCGGAGGCGGCGGGG + Exonic
1107951353 13:45465062-45465084 TGCCTGAGGCGGCGGCGGAGCGG + Exonic
1110356764 13:74575901-74575923 GGCCCCAGGCCGTGGAGGAGGGG + Intergenic
1112290895 13:98143363-98143385 ACCCGCGGGCGGCGGCGGCGCGG - Intronic
1112402075 13:99086360-99086382 AGGCGGAGGCGGAGGCGGCGGGG - Intronic
1112520304 13:100089058-100089080 AGCCGGAGGGGGTGGAGAAGGGG - Intronic
1113585150 13:111459744-111459766 AGCGGCAGGGAGTGGGGGAGAGG + Intergenic
1114623550 14:24114079-24114101 ACCCGCGGCCGGGGGCGGAGAGG + Intronic
1118797075 14:69153193-69153215 AGCTGCTGGAGGAGGCGGAGAGG - Intergenic
1119379520 14:74219597-74219619 AGCAGCAGAAGGTGGGGGAGAGG - Intergenic
1121013038 14:90533171-90533193 CGCCTCAGGCAGTGGCGGATGGG + Exonic
1121970049 14:98347746-98347768 AGAGGCAGGCGGTGGCAGATGGG - Intergenic
1122348995 14:101077118-101077140 AGCCCGAGGTGGAGGCGGAGGGG + Intergenic
1122349124 14:101077581-101077603 CCCGGCAGGCGGGGGCGGAGTGG + Intergenic
1122908774 14:104816096-104816118 AAACGCAAGCAGTGGCGGAGCGG + Intergenic
1122921770 14:104883213-104883235 AGAGGCAGGTGGGGGCGGAGCGG + Exonic
1123036556 14:105474217-105474239 GGGCGCGGGCGGGGGCGGAGCGG + Intronic
1123122193 14:105921847-105921869 AGCCCCAGGCAGTGCAGGAGTGG - Intronic
1123173747 14:106398939-106398961 ACCCCCGGGCGGTGGCGGAAGGG + Intergenic
1123182004 14:106480213-106480235 ACCCGCGGGCGGTGGCGGAAGGG + Intergenic
1202944901 14_KI270726v1_random:16517-16539 ACCCGCGGGCGGTGGCGGAAGGG - Intergenic
1123404857 15:20013412-20013434 AGCCCCAGGCAGTGCAGGAGTGG - Intergenic
1123495247 15:20817128-20817150 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1123514188 15:21020060-21020082 AGCCCCAGGCAGTGCAGGAGTGG - Intergenic
1123551736 15:21386221-21386243 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1124023248 15:25942911-25942933 GGCCGCAGGTGAAGGCGGAGCGG - Intergenic
1124656929 15:31516389-31516411 TGACCCAGGGGGTGGCGGAGAGG + Intronic
1125722987 15:41853988-41854010 GCCCGAAGGCGGTGGCTGAGGGG - Intronic
1125929499 15:43590140-43590162 GGCCGGGGGCGGTGGGGGAGTGG - Intronic
1125942666 15:43689972-43689994 GGCCGGGGGCGGTGGGGGAGTGG - Intergenic
1126034891 15:44536950-44536972 AGGCGGAGGGGGGGGCGGAGGGG - Intergenic
1127396465 15:58547378-58547400 AGATGCAGGCAGTGGAGGAGCGG + Intronic
1129115460 15:73363103-73363125 AGCCGCAGGCTGTGTTGGAGGGG - Intronic
1129356480 15:74995495-74995517 TGCTGCAGGCAGTGGCGGCGCGG + Intronic
1129540012 15:76341412-76341434 AGCCCTAGGCGGTGGGGGAGGGG + Intronic
1131106223 15:89736691-89736713 AGACGCAGGAGGTGGGGGAGTGG + Intronic
1131112978 15:89776872-89776894 AGGCGCAGACGCAGGCGGAGGGG + Exonic
1131112981 15:89776878-89776900 AGACGCAGGCGGAGGGGCAGGGG + Exonic
1131692812 15:94845082-94845104 AGCAGCGGGCGGCGGCGGCGGGG - Intergenic
1132365156 15:101251659-101251681 AGGCGCAGGCCGCGGCGGCGGGG - Exonic
1202960081 15_KI270727v1_random:113463-113485 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1132663485 16:1071607-1071629 GGCCGCAGGCTGGGGAGGAGGGG + Intergenic
1133103100 16:3491071-3491093 AGTCACATGGGGTGGCGGAGGGG - Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG + Intergenic
1136365046 16:29806071-29806093 AGGCGGCGGCGGTGGGGGAGGGG - Intergenic
1136629114 16:31479102-31479124 AGCCTCAGGTGGTGGCAGACAGG - Intergenic
1136957685 16:34803963-34803985 GGCCGCAGAGGGTGGCGCAGGGG + Intergenic
1137676129 16:50304673-50304695 AGCCCCAGGAGGTGGGGCAGAGG - Intronic
1139468888 16:67167824-67167846 AGCCACAGGCAGTGGCGGGGGGG - Exonic
1140210115 16:72962915-72962937 AGCCACAGGATGTGGCGGATTGG - Intronic
1140663994 16:77212438-77212460 AGCGGCAGTCGGGGGCGGAGCGG - Intronic
1142200310 16:88757972-88757994 AGGCACAGAGGGTGGCGGAGGGG - Intronic
1142733566 17:1879864-1879886 AGCTCCAGGAGTTGGCGGAGGGG + Intronic
1142805488 17:2369123-2369145 ATCAGCAGGCGGTTGGGGAGAGG + Intronic
1143592386 17:7893498-7893520 AGCAGCAGGGGGTGGTGGAAGGG - Exonic
1143670496 17:8392897-8392919 AGCAGAAGGCGCGGGCGGAGCGG + Exonic
1144777606 17:17792664-17792686 AGCTGCAGGCGATGTGGGAGCGG + Intronic
1145110319 17:20156294-20156316 AGCCGGAGGCGGTGGGGGAAGGG - Intronic
1145218909 17:21072800-21072822 GGCCGCAGGAGCTGCCGGAGTGG - Intergenic
1145884008 17:28370367-28370389 AGCCGCTGGAGGGGGCAGAGGGG - Exonic
1146057753 17:29589589-29589611 AGCCGCGAGCGGCGGCGGGGCGG - Intronic
1146265614 17:31450755-31450777 AGCCGAAGGCAATGTCGGAGGGG - Intronic
1146747518 17:35345625-35345647 AGCAGCAGGCGGCTGCGGAGGGG - Intergenic
1147990007 17:44326804-44326826 ACGCGCGGGCGGTGGCGGAGGGG + Intergenic
1148041148 17:44708543-44708565 AGACGTAGGCGGTGGGGGAACGG + Intergenic
1148122658 17:45222003-45222025 AGCGGCTGGCGGTGGCGGCGGGG - Exonic
1148403326 17:47386886-47386908 AGGAGCAGGCGGCGGCGGGGAGG - Intronic
1151227883 17:72660208-72660230 AACCGCAGGCGGTTGCAGTGGGG - Intronic
1151472376 17:74326278-74326300 ACCCGGAGGCGGTGGGGGTGCGG + Exonic
1151570499 17:74923265-74923287 ACCCGGGGGCGGGGGCGGAGGGG + Intergenic
1151660683 17:75516542-75516564 AGCGGCAGGCGGCGGCGGGATGG + Exonic
1151854329 17:76710608-76710630 AGGAGCAGGCGGTGGAGGCGAGG - Exonic
1152291541 17:79442733-79442755 AGCTGCAGGCAGAGCCGGAGGGG + Intronic
1153967678 18:10196372-10196394 AGCCACAGGCGGTGCCCAAGTGG + Intergenic
1154452645 18:14489602-14489624 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1158646728 18:59254957-59254979 AGCGGGAGGCGGAGGGGGAGTGG - Intergenic
1158967828 18:62637995-62638017 AGCCTTAGGCTGTGGCAGAGGGG + Intergenic
1160989343 19:1854145-1854167 GGCAGCAGGGGGTGGTGGAGAGG + Exonic
1161063784 19:2227905-2227927 AGGCGGAGGCGGAGGCGGAGGGG - Intronic
1162731421 19:12721215-12721237 GGCCACAGGCGGCGGCGGCGGGG + Intronic
1162860017 19:13499435-13499457 AGTCGCAGGGGGTGGTGGGGGGG + Intronic
1162860540 19:13503637-13503659 AGCGGAGGGCGGTGGCGGGGTGG - Intronic
1163005507 19:14394648-14394670 AGTCCCCGGCGATGGCGGAGAGG - Intronic
1163020021 19:14476906-14476928 AGCCGCTTGCGGTGGTGAAGGGG - Intergenic
1163113781 19:15177586-15177608 AGCTGCAGGCGGGGTCGCAGCGG + Exonic
1163484503 19:17577870-17577892 CGCCGCAGGGGGTGGTGGAATGG + Intronic
1163527821 19:17831780-17831802 AGCCGCAGGCTCTGGCGGCCTGG + Exonic
1163586893 19:18169120-18169142 AGCCGAAGCCGGTGGCCGTGCGG - Exonic
1165179292 19:33954034-33954056 AGCCCCAGGTGGTGGCAGAGTGG - Intergenic
1166231615 19:41428159-41428181 AGACCCAGGCAGAGGCGGAGAGG + Intronic
1166521956 19:43486630-43486652 TGCAGCAGGCCATGGCGGAGAGG - Exonic
1167261603 19:48462080-48462102 GGGCGCGGGCGGTGGCGGGGCGG - Exonic
1167379948 19:49132993-49133015 CTCCGCAGGCGCTGGCGCAGCGG + Exonic
926205268 2:10831011-10831033 AGCCACAGGGGCTGGCGGGGAGG + Intronic
926758091 2:16252088-16252110 GGCGGCAGGCAGTGACGGAGAGG - Intergenic
927677507 2:25117187-25117209 AGCCGCAGGCAGGGGCTGACGGG - Intronic
927680012 2:25132882-25132904 GCCTGCAGGAGGTGGCGGAGAGG - Exonic
929011223 2:37447259-37447281 GGCGGCGGGCGGTGGCGGGGGGG + Intergenic
929897660 2:45975967-45975989 AGCCACAGGGGGTGGCTTAGAGG - Intronic
930021344 2:47003867-47003889 AGCTGCTGGAGGTGGTGGAGTGG + Intronic
934059958 2:88284280-88284302 AGGGCCAGGCGGAGGCGGAGGGG - Intergenic
935418233 2:102841111-102841133 AGCTGCAGGCGGAGGCGGATCGG + Intronic
938757450 2:134393851-134393873 AGCAGCAGGTGGTGGGGGTGGGG - Intronic
939570869 2:143838534-143838556 AGCAGCAGGGGATGGCGGAGTGG - Intergenic
940829946 2:158456655-158456677 CGCGGGAGGGGGTGGCGGAGAGG - Exonic
941104837 2:161340988-161341010 AGGAGCAGGCGGTGGAGGCGAGG - Intronic
941666484 2:168247737-168247759 AGCGGGAGGGGGCGGCGGAGAGG - Exonic
941819164 2:169827656-169827678 AGCTGCAGGCGCTGCTGGAGCGG + Exonic
942944333 2:181656872-181656894 AGACGGAGGCGGCGGCCGAGCGG - Exonic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
946325400 2:218982277-218982299 AGCCACAGGCGGGAGCGGGGAGG + Intronic
947566723 2:231198825-231198847 AGCATCCGGCGGCGGCGGAGCGG - Intronic
948046634 2:234951062-234951084 GGCCCCAGGCAGTGGCGCAGTGG + Intergenic
948782339 2:240329511-240329533 GGCCGCAGAGGGTGGAGGAGGGG + Intergenic
948801585 2:240435739-240435761 AGCCGGCGGCGGCGGCGGCGCGG - Exonic
948829010 2:240588440-240588462 AGCAGCAGGCAGTGAGGGAGAGG + Intronic
948840690 2:240647372-240647394 AGCAGCTGCCGGTGGCGGCGCGG + Intergenic
949044010 2:241862366-241862388 AGGAGCAGGCGGTGGGGGAAGGG - Intergenic
1172100957 20:32483711-32483733 AGCAGGAGGAGGTGGCGGAGGGG + Intronic
1172277243 20:33686349-33686371 AGCGGCGGCCGGGGGCGGAGCGG - Exonic
1174910616 20:54603892-54603914 AGCCTCAGGGGGAGGGGGAGGGG + Intronic
1175470264 20:59222419-59222441 TGGCGCCGGCGGGGGCGGAGGGG - Intronic
1175888036 20:62303213-62303235 AGCCGCAGGCGGAACCGGGGCGG - Intronic
1175991992 20:62794315-62794337 AGGCGGAGGCAGAGGCGGAGCGG + Intergenic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176443388 21:6798682-6798704 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1176717407 21:10364687-10364709 AGCCCCAGGTGGTGGTGGGGGGG - Intergenic
1176821556 21:13663729-13663751 AGCCGCAGGCTGTGGCCGAGGGG - Intergenic
1177834017 21:26170422-26170444 GTCCGCAAGCGGGGGCGGAGAGG + Intronic
1177834080 21:26170687-26170709 AGACGGCGGCGGTGGCGGCGCGG - Intronic
1179558483 21:42195628-42195650 AGCAGCAGGCTGTGGGTGAGAGG + Intergenic
1179873902 21:44257852-44257874 AGCCCCAGGAGCTGGGGGAGAGG - Intronic
1179912256 21:44456465-44456487 AGACGCAGGAGGGAGCGGAGAGG - Intronic
1180298633 22:11017607-11017629 AGCCCCAGGTGGTGGTGGGGGGG - Intergenic
1180600936 22:17015306-17015328 AGCCCCAGGTGGTGGTGGCGGGG + Intergenic
1180705776 22:17808902-17808924 AGCTGCAGCAGGTGGAGGAGAGG - Exonic
1180833760 22:18919603-18919625 AGGCGCAGGGGGTGGGAGAGTGG + Intronic
1181066072 22:20306651-20306673 AGGCGCAGGGGGTGGGAGAGTGG - Intergenic
1182338003 22:29598151-29598173 AGCCCACGGCGGTGGCAGAGAGG + Intergenic
1182586335 22:31346136-31346158 AGGCGAAGGCGGCGGCGGCGGGG + Exonic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1203283846 22_KI270734v1_random:144901-144923 AGGCGCAGGGGGTGGGAGAGTGG + Intergenic
951140108 3:19148429-19148451 AGCAGCTGGCGGGGGTGGAGGGG + Intergenic
953610883 3:44446308-44446330 AGCCGCAGGCTATGGTGCAGAGG + Exonic
953998179 3:47536487-47536509 AGCCGGAGCCGGTGGCAGAAGGG + Intergenic
954063574 3:48088742-48088764 AGCCGCAGGCGGGGTCCGATTGG - Intronic
954063670 3:48089076-48089098 AGCCGCGGGCGGTTGGGGCGAGG + Exonic
956978989 3:74614673-74614695 AGCCGGAGCCGGAGCCGGAGTGG - Intergenic
959991793 3:112639024-112639046 AGGGCCAGGTGGTGGCGGAGGGG - Exonic
961413159 3:126737812-126737834 AGCGGCAGGGTGTGGCGGTGGGG + Intronic
962720993 3:138174721-138174743 AGACGCTGGCGCTGGCAGAGCGG - Exonic
962809005 3:138946188-138946210 CGCCGCAGGCGGGTGCGGCGTGG - Exonic
968556561 4:1248867-1248889 GGCCGCGGGCGGGGGCGGGGCGG - Intronic
968603963 4:1522817-1522839 AGCCACAGGCAGAGGGGGAGGGG - Intergenic
968658401 4:1788449-1788471 AGCAGCAGGAGGTGGTGGTGGGG - Intergenic
972774324 4:42227517-42227539 AGCAGCAGGGGGTGAGGGAGAGG - Intergenic
973644532 4:52936726-52936748 AGCTGAAGGAGGTGGAGGAGTGG - Intronic
974385607 4:61200336-61200358 AGGCGCAGCCGGGGCCGGAGCGG - Intergenic
975166713 4:71186586-71186608 AGCCCCCGGCGGAGGCGGCGCGG + Intergenic
975832319 4:78382547-78382569 AGCCTGAGGTGGTGGTGGAGAGG + Intronic
976107924 4:81639559-81639581 GGCAGCAGGGGGTGGGGGAGGGG + Intronic
976178906 4:82380967-82380989 AGCCGCAGGCTGGAGCAGAGTGG - Intergenic
976223246 4:82775043-82775065 AGTGGCAGGCTGTGGGGGAGAGG - Intronic
978126960 4:105146604-105146626 CGGCGCAGGCCGGGGCGGAGCGG + Exonic
979547213 4:121951761-121951783 AGCCGCGGGAGGTGGTGAAGGGG - Intergenic
983649794 4:170026512-170026534 AGCCGCGGGCGGGGGCAGCGGGG + Intronic
984699283 4:182808072-182808094 AGCGCCATGGGGTGGCGGAGTGG - Intergenic
985252979 4:188042016-188042038 AGCCGCTGGCGGTGGAGAGGAGG + Intergenic
985555578 5:556320-556342 AGACGCAGCGGGTGGGGGAGCGG + Intergenic
985903235 5:2813558-2813580 AGGCGCAGGCGGTGGCAGGGAGG - Intergenic
986941307 5:12953705-12953727 AGCTGCTGGGGGTGGTGGAGAGG - Intergenic
990041572 5:51383472-51383494 AGCCGGCGGAGTTGGCGGAGCGG - Exonic
990349068 5:54897757-54897779 ATACTCAGGCGGTGGAGGAGGGG - Intergenic
990376215 5:55173341-55173363 GGCCGGAGGCGGTGGCGGGGCGG - Intergenic
992939692 5:81750598-81750620 AGCCGCCGGGGGTGGCGGGAGGG - Intronic
997226868 5:132215453-132215475 AGCTGCAGGCCCAGGCGGAGAGG + Intronic
998200437 5:140114142-140114164 AGCGGCAGGCGGCGGCGGCGCGG + Exonic
999868592 5:155728168-155728190 AGCCGCGGGTGGGGGCGGCGGGG - Intergenic
1001276262 5:170353864-170353886 AGCCGCTCATGGTGGCGGAGGGG - Intronic
1002029355 5:176416507-176416529 AGCCGGGCCCGGTGGCGGAGAGG - Exonic
1002160717 5:177312514-177312536 ATGCGCAGGCGCCGGCGGAGGGG + Intronic
1002792514 6:446593-446615 AGCAGCAGGCGCCGGGGGAGGGG - Intergenic
1004426655 6:15511408-15511430 TGCTGGAGGCGGTGGCTGAGTGG - Intronic
1004663345 6:17729030-17729052 AGCCGGCGGTGGTGGCGGCGGGG - Intergenic
1005135970 6:22570078-22570100 AGGAGGAGGCGGAGGCGGAGAGG + Exonic
1005802382 6:29440397-29440419 AGCAGCAGTGGGTAGCGGAGGGG - Exonic
1005994798 6:30924536-30924558 AGCTGCAGGCGCTGGGGTAGGGG - Exonic
1007390238 6:41546500-41546522 CGGCGCAGGCGGCGGCGGCGCGG + Exonic
1007390454 6:41547175-41547197 AGCCGGAGGCCGGGGCGGGGAGG + Intronic
1007702133 6:43771587-43771609 AGCCGGAGGAGGAGGCCGAGGGG + Intronic
1007785202 6:44275895-44275917 CGCGGCAGGCGGTGGGTGAGCGG - Exonic
1013099455 6:106974813-106974835 GGCGGCGGGCGGCGGCGGAGGGG - Intronic
1015828253 6:137338979-137339001 AGCAGCAAGAGGTGGTGGAGTGG + Intergenic
1015910102 6:138161614-138161636 GGCCGCGGGCGGAGTCGGAGCGG - Intergenic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017163938 6:151390838-151390860 AGCAGCAGGAGGCGGCGGCGAGG + Intronic
1017672414 6:156779290-156779312 AGTCCCAGGCGGCGGCGGCGGGG + Exonic
1017916499 6:158835741-158835763 AGCAGCAGGACGAGGCGGAGTGG - Intergenic
1019011126 6:168844281-168844303 AGCCGGCGTCGGTGGCGGGGAGG - Intergenic
1019393759 7:805373-805395 AACCCCAGGCGGGGGCAGAGCGG - Intergenic
1019508152 7:1403769-1403791 AGCCACAGGCGGTTGTGGAGGGG + Intergenic
1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG + Intronic
1019647429 7:2138618-2138640 TGCTGCAGGCGATGGCGGTGTGG - Intronic
1020275488 7:6622242-6622264 AGCCGCAGGGGGCGGCGGAGCGG + Exonic
1023255834 7:38311457-38311479 TGCCGGAGGCGGTGGCTGTGTGG - Intergenic
1023955723 7:44885363-44885385 CGCGGCGGGCGGTGGCGGCGAGG - Intergenic
1024048163 7:45599404-45599426 AGCAGAAGGCGGTGACTGAGGGG - Intronic
1024957032 7:54933258-54933280 GGCCGCAGCTGGTGGCAGAGAGG + Intergenic
1025929411 7:65982197-65982219 CGCCGCAGACGGTGGCCGAGCGG - Exonic
1026657939 7:72273436-72273458 AGCGGCGGGCGGGGGCGGTGGGG + Intronic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027361739 7:77416425-77416447 AGCAGCAGGGGGCGGGGGAGAGG - Intergenic
1028888131 7:95957440-95957462 AGCAGCAGGAGGAGGAGGAGGGG - Intronic
1029375641 7:100175570-100175592 ACCTGCAGGCGGAGGCGGCGGGG + Exonic
1029562048 7:101309071-101309093 AGCCGCCAACGGTGGCGGAAAGG - Intergenic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1033248146 7:139736063-139736085 AGTCACAGGAGGTGGCTGAGAGG + Intronic
1034241917 7:149617386-149617408 AGCAGGAGGCGGTTGGGGAGTGG + Intergenic
1035620373 8:1032237-1032259 AGCCACGGGTGGTGGCGGTGGGG - Intergenic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1045021224 8:98045887-98045909 CGCCGGAGGCTGAGGCGGAGAGG + Intronic
1045287577 8:100805257-100805279 AGCGGCAGGGGGTGGGGGAGTGG - Intergenic
1047100159 8:121667530-121667552 AGCCCCCGGCGGGGGCGGGGCGG + Intergenic
1047732418 8:127737896-127737918 AGCCGCGGGAGGTGGCGGTGAGG - Intronic
1048227608 8:132603849-132603871 TGCCAAAGGCGGGGGCGGAGTGG + Intronic
1048705552 8:137149223-137149245 AGCCTGGGGCGGTGGAGGAGTGG + Intergenic
1049385570 8:142341403-142341425 AAGCGCAGGCAGTGGTGGAGAGG + Intronic
1049654156 8:143790412-143790434 AGCTGGAGGCGGTGCAGGAGAGG + Intergenic
1049682335 8:143925063-143925085 AGCAGCAGGCCGAGGCCGAGCGG - Exonic
1049707315 8:144048929-144048951 AGGCGCGGGCGGAGGCAGAGGGG - Intergenic
1049724198 8:144137942-144137964 ACCTGCAGGCGGCGGCGGTGCGG + Exonic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1050176754 9:2876537-2876559 AGCCGCGGGCTGTGACGCAGAGG - Intergenic
1052362208 9:27573430-27573452 AGGCGCAGGCGGTGGCGAGTGGG - Intronic
1053397412 9:37787139-37787161 ACCCGAAGGCGGTGGCTGGGCGG + Intronic
1054727841 9:68669452-68669474 AGCCGCAGGAAGTGACTGAGAGG + Intergenic
1054738502 9:68780360-68780382 AGCAGCAGGCCGTGGCGGCTCGG - Exonic
1056475424 9:86947331-86947353 TGCCGCGGGCGGAGGGGGAGGGG - Intergenic
1056752535 9:89362928-89362950 AGCTGCAGGCAGTGGGGCAGAGG - Intronic
1057847757 9:98538667-98538689 AGTCGGAGGGGGTGGTGGAGGGG - Intronic
1060402329 9:123356114-123356136 AGGAGGAGGCGGTGGCGGGGAGG + Intergenic
1060849193 9:126860677-126860699 TGGCGCCGGCGGCGGCGGAGGGG + Intronic
1060974218 9:127755108-127755130 AGCAGCAGGCGGCGGCCGACAGG + Intronic
1061151255 9:128829543-128829565 AGCCGCAGGGGGTTCCGGAGAGG + Intronic
1061472118 9:130835196-130835218 AGGCGCAGGCGGCGGCGGGGCGG + Intronic
1062332426 9:136050652-136050674 AGCCCCCGGCGGGGGAGGAGGGG - Intronic
1062544105 9:137054048-137054070 AGCCGGAGGCGGAGGCGGGCGGG + Intergenic
1203525813 Un_GL000213v1:85845-85867 AGCCGCAGGCTGTGGCCGAGGGG + Intergenic
1203563495 Un_KI270744v1:75705-75727 AGACCCAGGCGCTGGCGCAGGGG + Intergenic
1186425621 X:9463201-9463223 ACCAGCAGGCGGTGGGGGAAGGG + Intergenic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic
1198480245 X:137034061-137034083 GGGCGCAGGCGGGGGCCGAGGGG - Intergenic
1199628816 X:149762206-149762228 AGCCGAGGGGGGTGTCGGAGGGG + Intergenic
1200084943 X:153599338-153599360 AGGCGCAGGCGCAGGCGCAGAGG + Intronic
1200161796 X:154013392-154013414 AGCTGCAGGCAGTGGTGGCGGGG - Exonic
1201739733 Y:17311108-17311130 AGCAGCAGGAGGAGGAGGAGGGG - Intergenic