ID: 906197419

View in Genome Browser
Species Human (GRCh38)
Location 1:43937461-43937483
Sequence CAGGCTGCTCACTTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4039
Summary {0: 1, 1: 0, 2: 9, 3: 253, 4: 3776}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906197419 Original CRISPR CAGGCTGCTCACTTGGGCCT GGG Intergenic
Too many off-targets to display for this crispr