ID: 906197481

View in Genome Browser
Species Human (GRCh38)
Location 1:43937818-43937840
Sequence CTCCATGTGGATAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906197477_906197481 -3 Left 906197477 1:43937798-43937820 CCGGTGAGCAAAGCACAGAGCTC 0: 1
1: 0
2: 1
3: 19
4: 230
Right 906197481 1:43937818-43937840 CTCCATGTGGATAAGGAGGCAGG 0: 1
1: 0
2: 4
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906197481 Original CRISPR CTCCATGTGGATAAGGAGGC AGG Intergenic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
904534215 1:31188464-31188486 CTCCATGTGGAGAAGATGGTGGG + Intronic
906197481 1:43937818-43937840 CTCCATGTGGATAAGGAGGCAGG + Intergenic
906386146 1:45370064-45370086 AACCATATGGATAAAGAGGCAGG + Intronic
908417534 1:63928045-63928067 TTCCATGAGGACAAGGATGCAGG - Intronic
910162984 1:84293865-84293887 CTCCATGTGTCAAGGGAGGCAGG + Intergenic
913405421 1:118485732-118485754 CTGCATGGAGATAAGGAGGCAGG - Intergenic
914744375 1:150490799-150490821 CTCCATTTGGATGAGGAAGCTGG + Intronic
916259642 1:162828611-162828633 CTACTTGTGCACAAGGAGGCAGG + Intronic
917443746 1:175089212-175089234 CACCAGGTGGAAAAGGATGCTGG + Intronic
919912350 1:202119265-202119287 ATCCATGAGCATAAAGAGGCTGG + Intergenic
920411316 1:205763264-205763286 CTCCATCTGGGTGGGGAGGCGGG - Intergenic
920655005 1:207868516-207868538 GTCCGTGTGGAGGAGGAGGCGGG - Intergenic
921986325 1:221316883-221316905 CTTTATGTGGATGAGAAGGCAGG - Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
923238586 1:232058767-232058789 CTCCATGGGGCTGAGCAGGCAGG + Intergenic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1066457620 10:35585592-35585614 CTCCATGTGGAATGGGATGCAGG - Intergenic
1066464452 10:35640518-35640540 CTCCATGTCGATAAGGAAGGTGG + Exonic
1071803658 10:89092920-89092942 CTCCATGTCCGTAAAGAGGCAGG + Intergenic
1072475126 10:95752457-95752479 CTCCATGTTGGTCAGGCGGCTGG - Intronic
1073243899 10:102075907-102075929 CTCCAAGGGGTCAAGGAGGCAGG + Intergenic
1073648156 10:105328508-105328530 TTCCATGTGTATATGTAGGCAGG - Intergenic
1074215519 10:111380426-111380448 CTCACTGTCTATAAGGAGGCGGG - Intergenic
1074408169 10:113199099-113199121 TTCCATGGGGAAAATGAGGCTGG - Intergenic
1075731625 10:124639869-124639891 CTCCAGGTGTAAAAGGAGGCTGG - Intronic
1077490028 11:2856840-2856862 TTCCATTTGCATAGGGAGGCTGG - Intergenic
1079287953 11:19156791-19156813 CTCCAGGGGGATAAGAAGTCAGG - Intronic
1079476991 11:20841475-20841497 CTCCAGGCTGATAAGGAGTCAGG + Intronic
1084122743 11:67078666-67078688 CCCCAGGAGGAAAAGGAGGCTGG - Intergenic
1086114794 11:83237481-83237503 CTGCATGTGGATTAGAAGGCTGG + Intronic
1086220540 11:84437797-84437819 CTCCATGTGTGTCAGGAGGAAGG + Intronic
1087650623 11:100862833-100862855 CTCCATGTTGGTCAGAAGGCTGG - Intronic
1088329468 11:108635367-108635389 CTCCAGGTGGACAAGGAAGTAGG - Intergenic
1090258853 11:125304336-125304358 CTCCAGCTGGAAAAGCAGGCAGG - Intronic
1090411910 11:126515123-126515145 ATCAAGGTGCATAAGGAGGCTGG + Intronic
1091127913 11:133118478-133118500 CTCCATTTGGTCAAGGAGACAGG + Intronic
1091179213 11:133588425-133588447 CACCATGTGCATCAGAAGGCTGG - Intergenic
1092099205 12:5869373-5869395 CTCCATGGGGACAAGGATCCAGG + Intronic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1096109568 12:49020835-49020857 CTCCATCTGGACATGGGGGCAGG - Exonic
1097962384 12:65545372-65545394 CTGCATGTGGAAAAGCAGGGAGG - Intergenic
1102060914 12:109930433-109930455 ATCCATGTGCAAAAGGTGGCTGG + Exonic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104452020 12:128877460-128877482 CTTCCTGTGGAACAGGAGGCAGG - Intronic
1106794963 13:33195956-33195978 CTCCATTTGGTTAAGAAGGGAGG + Intronic
1108512409 13:51168412-51168434 CGCCATGTTGCAAAGGAGGCTGG - Intergenic
1109068087 13:57726487-57726509 CTCCATGGGGAAAAGGAAGCAGG - Exonic
1109393786 13:61726740-61726762 CTCCATGTGTCGAAGGAGGAAGG - Intergenic
1112724884 13:102291879-102291901 CACCATGTGGACAAGCAGGAGGG - Intronic
1113121540 13:106928940-106928962 CTCCAGGTGGAAAAGGAGACAGG - Intergenic
1113929414 13:113958422-113958444 CTCCAGGTGGGGACGGAGGCAGG - Intergenic
1114193595 14:20458803-20458825 CTACATGTGGATAAGGAACAAGG - Intronic
1114759729 14:25299993-25300015 CTCCATGTGGAGAAAAAAGCAGG - Intergenic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1118808508 14:69257795-69257817 CTCCATGGGGGGAAGGAGGGAGG - Intergenic
1119684839 14:76623356-76623378 CTTCATGTGGAGAAGAAGGGAGG - Intergenic
1121617638 14:95323425-95323447 CTTCATGAGGCCAAGGAGGCAGG + Intergenic
1122873612 14:104652552-104652574 CTCCATATGGAGAAGGATGCGGG - Intergenic
1123065277 14:105616016-105616038 GTCCATGTGGATAGTGAGGAAGG + Intergenic
1123931475 15:25173695-25173717 CTCCATGCGGGAAAGGAGGCAGG - Intergenic
1123947753 15:25247098-25247120 CTCCATGTAGGGAAGGAGGTAGG - Intergenic
1124069818 15:26380909-26380931 CTCCAGTAGGATCAGGAGGCAGG + Intergenic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1131676869 15:94679014-94679036 GTCCTTGTTGAAAAGGAGGCTGG - Intergenic
1132517493 16:372598-372620 CTCCATGTGGGTAAGGAGCCGGG - Exonic
1133229862 16:4361348-4361370 CTCGCTGTGGGTAAGGAGGCTGG - Exonic
1133284984 16:4686529-4686551 CTCCATCTGGACTAGGCGGCCGG + Intronic
1135671857 16:24382267-24382289 CTCCTGGTGGAGAAGGAGGAGGG - Intergenic
1140209578 16:72959858-72959880 CTCCATGTAGGTCTGGAGGCTGG + Exonic
1141444767 16:84050766-84050788 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1141445036 16:84052185-84052207 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1142766108 17:2065199-2065221 CGCCATGTGGAGGAGGAGGAGGG + Intronic
1143217808 17:5238318-5238340 CTCCATGTTGGTTAGGTGGCTGG + Intergenic
1146109535 17:30075666-30075688 GTCCATGTGGGTAAAGACGCTGG - Intronic
1146489848 17:33272963-33272985 CTCCAGGTGGAAAAGGAGGCTGG - Intronic
1147164233 17:38585011-38585033 CTCTGTGGAGATAAGGAGGCTGG + Intronic
1149684750 17:58528915-58528937 CTCCATGCGGATGAGCAGCCAGG - Intronic
1150102565 17:62437023-62437045 CTCCTTATAGATAAGGATGCTGG + Intronic
1150284726 17:63948363-63948385 CTCTCTGCTGATAAGGAGGCAGG - Intronic
1150462909 17:65367550-65367572 GTCCATGTGCACCAGGAGGCAGG + Intergenic
1150741290 17:67780923-67780945 GTCCATGTGGAAAAGGATGTTGG - Intergenic
1151197297 17:72440759-72440781 CTCCATGTGCACACTGAGGCTGG + Intergenic
1151552946 17:74832355-74832377 CACCATGAGGATATGAAGGCGGG - Intronic
1152749772 17:82057261-82057283 CTCCCTGGGGCTGAGGAGGCAGG + Exonic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1155381487 18:25227015-25227037 CTCCATGTGGTTCATGAGGGAGG + Exonic
1155916325 18:31561209-31561231 CTCAATGTGGATCAGGTGGGTGG - Intergenic
1157443200 18:47725724-47725746 GTCCATGTGTATAAGGAGGCTGG - Intergenic
1157565848 18:48678725-48678747 CTCCATGCGGAGCAGAAGGCAGG + Intronic
1157909196 18:51599192-51599214 CTTCATATGAATAAGGGGGCTGG + Intergenic
1158638712 18:59183653-59183675 CCCCATGTGAATAAAAAGGCTGG + Intergenic
1159914120 18:74173548-74173570 CTCCATGAGGAAAAGGAGGCAGG - Intergenic
1160120160 18:76122796-76122818 AGCCATGTGGAGATGGAGGCAGG - Intergenic
1160603164 18:80029914-80029936 CTCCATGAAGATAAGGTGCCTGG + Intronic
1161752444 19:6108358-6108380 GTCCTTCTGGATAAGGAGGAGGG - Intronic
1163130484 19:15269528-15269550 CTTCATGGTGACAAGGAGGCAGG - Intronic
1164234520 19:23320640-23320662 CTCCATGTGTCAAAGCAGGCAGG - Intronic
1165434663 19:35789372-35789394 CTCCCTGTGGGTCAGCAGGCTGG + Intergenic
1166566278 19:43767457-43767479 CCCTATGTGGCTAAGGGGGCGGG - Intronic
1167114891 19:47483450-47483472 CACCATGTGTGTAAGGAGGAGGG + Intronic
926372248 2:12191075-12191097 TTCCATGTGGATACCAAGGCGGG + Intergenic
927149494 2:20187541-20187563 CACCATGTGGGGAGGGAGGCCGG - Intergenic
927985721 2:27409290-27409312 CTCCATGGAGGTGAGGAGGCAGG - Exonic
928895765 2:36261223-36261245 CTCGATGGGGATAATGAGGGTGG - Intergenic
929568692 2:43006413-43006435 CTCCCTGTGCATAAGGTGGCAGG - Intergenic
929619995 2:43345030-43345052 CTTGATTTAGATAAGGAGGCTGG - Intronic
929787843 2:45004893-45004915 CTCGAGGTGGAGAAAGAGGCTGG + Intergenic
930157356 2:48119127-48119149 CTCCATCTTGAATAGGAGGCGGG + Intergenic
930548670 2:52803037-52803059 CTCCATGGGGATGAGCAAGCAGG + Intergenic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
932165916 2:69506758-69506780 CTCAATGTAGATAAGGGCGCAGG - Intronic
932873674 2:75428978-75429000 CTCCCTGTGGAAGAGGAGGCTGG + Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
936746596 2:115583807-115583829 CTCTATGAGGATAAGCATGCTGG + Intronic
939724232 2:145695369-145695391 TTCCATGTGGATAAATAGCCAGG + Intergenic
940075457 2:149736623-149736645 GTCCATCTGGCTAAGTAGGCAGG + Intergenic
940359591 2:152782987-152783009 CTACTTCTGGATAAGGAGGAAGG - Intergenic
940863370 2:158792393-158792415 CTCCATGTTGCCCAGGAGGCTGG + Intergenic
942075212 2:172351272-172351294 CTGCCTGTGGATAATGAGCCAGG + Intergenic
948083177 2:235224367-235224389 CTCCATGAATTTAAGGAGGCAGG - Intergenic
1172596102 20:36152384-36152406 CTCCATCTGGTTGAGGAGGGTGG + Intronic
1173135186 20:40433212-40433234 CTCCATGTGGCCAAGGTGGGAGG + Intergenic
1175175269 20:57108041-57108063 CTCCATGAGGACGAGGACGCGGG - Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1176659887 21:9624277-9624299 ATTCCTGTGGAGAAGGAGGCTGG + Intergenic
1177959821 21:27649630-27649652 CTCCATGTGGAATTGGAGGAGGG - Intergenic
1181318892 22:21989712-21989734 CTCCATGCAGATAAGCAAGCTGG - Intergenic
1182647973 22:31825847-31825869 TACCATGTGGAAGAGGAGGCAGG - Intronic
950445510 3:13035189-13035211 CTGGATGTGGATTAGGAGCCGGG - Intronic
950448082 3:13049569-13049591 TTGCGTCTGGATAAGGAGGCAGG - Intronic
953454611 3:43031773-43031795 CACCCTGTTGCTAAGGAGGCTGG + Intronic
953729497 3:45434764-45434786 TTCCAGGTGGATATGGAGTCCGG + Intronic
955003589 3:54949317-54949339 CTAGGTGTGGATAAGGAGGGAGG + Intronic
955069541 3:55560626-55560648 CTCCATGTGGACACGGAGTGTGG - Intronic
959690607 3:109193477-109193499 CTCCCAGTGGATAAGGAGGATGG + Intergenic
963004672 3:140715337-140715359 CTCCATGTGGAAAAGGCTGGTGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968944277 4:3655379-3655401 CCCCAGCTGGATAAGGAGCCCGG + Intergenic
969664101 4:8547148-8547170 TTCCATGAGGACATGGAGGCTGG + Intergenic
970511831 4:16788814-16788836 TTCCAGGAGTATAAGGAGGCAGG - Intronic
977014847 4:91679215-91679237 ATGCACGTGGCTAAGGAGGCTGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977564693 4:98568993-98569015 CTCACTGTGGAGAAGGATGCAGG + Intronic
982276293 4:153639923-153639945 ATCCATGTGGATAGGCAGTCAGG + Intergenic
986207930 5:5643787-5643809 CTCCGAGTGGGTCAGGAGGCTGG - Intergenic
987119220 5:14750835-14750857 CTCCTATGGGATAAGGAGGCTGG + Intronic
987213210 5:15706068-15706090 CTGAGTGTGAATAAGGAGGCAGG + Intronic
987359873 5:17097113-17097135 CTCAAGGTGGATAAATAGGCAGG + Intronic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
995301591 5:110590965-110590987 CTCCATGTGTCTAGGGAGGGAGG - Intronic
995500143 5:112795458-112795480 CTCCAGGAAGAGAAGGAGGCTGG - Intronic
999519245 5:152333526-152333548 CTCCATGTGGTACAGGAGGCTGG + Intergenic
1002881105 6:1253483-1253505 CTCCAAGTGGCTGTGGAGGCCGG - Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1006954157 6:37852197-37852219 CTCCATGGGGGTGAGGAGGATGG + Intronic
1010154839 6:72780506-72780528 CACCAGGTGGACAAGGAGTCTGG + Intronic
1010457688 6:76077243-76077265 ATGAATGTGGATAAGGATGCAGG - Intergenic
1011519919 6:88194254-88194276 CACCCTCTGGATAAGGAGGTCGG + Intergenic
1013102463 6:106998403-106998425 CTCCATGGGGAAAGGGAGACAGG + Intergenic
1016769044 6:147828264-147828286 CTCCATGTGAATAATCAGGAAGG + Intergenic
1017010435 6:150059672-150059694 CTCCATGGAAATAAGGAAGCTGG + Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1019145844 6:169975230-169975252 CTCGATGTGGAAGAGGAGTCAGG - Intergenic
1020567270 7:9813399-9813421 TACCATGTGGATAAGGGTGCAGG + Intergenic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1031966307 7:128030735-128030757 TTCCATCTGGAGAAGGAGGTGGG + Exonic
1032031772 7:128490217-128490239 CTCCTTATAGATAAGGATGCTGG + Intronic
1032222796 7:130007203-130007225 CTCCAGGTGGGAAAGGTGGCTGG - Intergenic
1032704203 7:134408086-134408108 GGCCAAGTGGATAAGGAGGTAGG + Intergenic
1033066916 7:138164811-138164833 CTACATGTGCATTAGGAGGATGG - Intergenic
1033192671 7:139296356-139296378 CTTCATGTGCAAAAGCAGGCAGG + Intronic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1035219392 7:157396876-157396898 TCCCATGTAGAAAAGGAGGCGGG - Intronic
1039525269 8:38209027-38209049 CTCCATAAGGATAATGGGGCAGG - Exonic
1040881193 8:52206511-52206533 CTCCGTGTGGAACATGAGGCTGG - Intronic
1041840631 8:62266600-62266622 CTCCATCTGAGTCAGGAGGCGGG + Intronic
1042217991 8:66445651-66445673 CACCATGTGGAAAAGGGGGAAGG + Intronic
1042536015 8:69859983-69860005 CTCCATAAGGATAATGGGGCAGG + Intergenic
1043012187 8:74894668-74894690 TTCCTTGTAGATAAGGAGGGAGG - Intergenic
1043535215 8:81195980-81196002 CTCCATATTGAAAATGAGGCTGG + Intergenic
1044675137 8:94720450-94720472 CACCACGGGGATAAAGAGGCAGG + Intronic
1044928010 8:97225322-97225344 CTCCTTGTGAAGAAAGAGGCAGG - Intergenic
1045901530 8:107287132-107287154 CTCAATGTGAATAAAGAGGCTGG + Intronic
1046056447 8:109084301-109084323 CTCCACCTGGTTTAGGAGGCTGG - Intergenic
1046612951 8:116445904-116445926 CTCCATTGGTATAAAGAGGCTGG + Intergenic
1046745289 8:117869197-117869219 CTCATGGTGGATATGGAGGCAGG - Intronic
1047711912 8:127561051-127561073 ATCCATGTGGATAAAGTGACTGG - Intergenic
1048497630 8:134948260-134948282 TTCCACGTGGATAATGAGGTTGG + Intergenic
1049008685 8:139873259-139873281 ATCCATGAGGAAAATGAGGCTGG - Intronic
1049218039 8:141416747-141416769 CTCCAGGTGGGCAAGCAGGCTGG - Intronic
1049311712 8:141937082-141937104 CTCGAAGTGGATAGGTAGGCAGG + Intergenic
1049545341 8:143228276-143228298 CTCCTTGTGGAAGGGGAGGCAGG - Intergenic
1056456380 9:86764820-86764842 CTCGATGTGGATCAGCAGGAAGG + Intergenic
1056823589 9:89861299-89861321 CTCCATGTGGAAAAGGGAGAAGG + Intergenic
1057561746 9:96133242-96133264 CTCCCTGAGGACAAGCAGGCAGG + Intergenic
1058725070 9:107795141-107795163 CTCCATGTGAATATGGCAGCAGG + Intergenic
1059407905 9:114113287-114113309 CTCCATGCAGATAAGGCGGGTGG - Intergenic
1059670235 9:116484311-116484333 CTACCTCTGGAAAAGGAGGCTGG - Intronic
1059671379 9:116495713-116495735 CTCCATCTAAATAAGAAGGCTGG + Intronic
1061702369 9:132425413-132425435 CAGCATGGGGATAAGGAGGGGGG - Intronic
1062079860 9:134618114-134618136 CTCCCTGGGGGAAAGGAGGCTGG - Intergenic
1203637450 Un_KI270750v1:126121-126143 ATTCCTGTGGAGAAGGAGGCTGG + Intergenic
1185784207 X:2876117-2876139 ATCCAGGTGGATAAGGAATCTGG + Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1192695814 X:73414805-73414827 CTCCATGTATATTTGGAGGCTGG - Intergenic
1197650088 X:129054811-129054833 CTCCATGGACATAAGGAAGCAGG - Intergenic
1198958739 X:142161331-142161353 ATCCATGTGGAGAGGGAGACAGG - Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic