ID: 906198322

View in Genome Browser
Species Human (GRCh38)
Location 1:43943704-43943726
Sequence ATGATCAGGTTCTCTGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906198322_906198331 -1 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198331 1:43943726-43943748 TTGGTTTTCAAGGGGTCTCTGGG No data
906198322_906198332 23 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198332 1:43943750-43943772 TTATGAGAAAGACAAAGCCCAGG No data
906198322_906198333 24 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198333 1:43943751-43943773 TATGAGAAAGACAAAGCCCAGGG No data
906198322_906198330 -2 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198330 1:43943725-43943747 ATTGGTTTTCAAGGGGTCTCTGG No data
906198322_906198327 -10 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198327 1:43943717-43943739 ACCTGATCATTGGTTTTCAAGGG No data
906198322_906198329 -9 Left 906198322 1:43943704-43943726 CCGAACCCAGAGAACCTGATCAT No data
Right 906198329 1:43943718-43943740 CCTGATCATTGGTTTTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906198322 Original CRISPR ATGATCAGGTTCTCTGGGTT CGG (reversed) Intergenic
No off target data available for this crispr