ID: 906198362

View in Genome Browser
Species Human (GRCh38)
Location 1:43943899-43943921
Sequence TTTGTAGTCCCCTGGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906198362_906198365 2 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198362_906198367 14 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198367 1:43943936-43943958 TCCAACCTTGGTACTAAGAAAGG No data
906198362_906198370 16 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198370 1:43943938-43943960 CAACCTTGGTACTAAGAAAGGGG No data
906198362_906198369 15 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906198362 Original CRISPR TTTGTAGTCCCCTGGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr