ID: 906198365

View in Genome Browser
Species Human (GRCh38)
Location 1:43943924-43943946
Sequence AAACTGCCTACATCCAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906198356_906198365 23 Left 906198356 1:43943878-43943900 CCTGTCTGACCTAACCTCTCTCC No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198353_906198365 29 Left 906198353 1:43943872-43943894 CCTGCCCCTGTCTGACCTAACCT No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198364_906198365 -6 Left 906198364 1:43943907-43943929 CCAGGGGACTACAAAGAAAACTG No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198362_906198365 2 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198361_906198365 9 Left 906198361 1:43943892-43943914 CCTCTCTCCCTCAAACCAGGGGA No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198357_906198365 14 Left 906198357 1:43943887-43943909 CCTAACCTCTCTCCCTCAAACCA No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198363_906198365 1 Left 906198363 1:43943900-43943922 CCTCAAACCAGGGGACTACAAAG No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198355_906198365 24 Left 906198355 1:43943877-43943899 CCCTGTCTGACCTAACCTCTCTC No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data
906198354_906198365 25 Left 906198354 1:43943876-43943898 CCCCTGTCTGACCTAACCTCTCT No data
Right 906198365 1:43943924-43943946 AAACTGCCTACATCCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906198365 Original CRISPR AAACTGCCTACATCCAACCT TGG Intergenic
No off target data available for this crispr