ID: 906198369

View in Genome Browser
Species Human (GRCh38)
Location 1:43943937-43943959
Sequence CCAACCTTGGTACTAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906198361_906198369 22 Left 906198361 1:43943892-43943914 CCTCTCTCCCTCAAACCAGGGGA No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data
906198357_906198369 27 Left 906198357 1:43943887-43943909 CCTAACCTCTCTCCCTCAAACCA No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data
906198363_906198369 14 Left 906198363 1:43943900-43943922 CCTCAAACCAGGGGACTACAAAG No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data
906198364_906198369 7 Left 906198364 1:43943907-43943929 CCAGGGGACTACAAAGAAAACTG No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data
906198362_906198369 15 Left 906198362 1:43943899-43943921 CCCTCAAACCAGGGGACTACAAA No data
Right 906198369 1:43943937-43943959 CCAACCTTGGTACTAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906198369 Original CRISPR CCAACCTTGGTACTAAGAAA GGG Intergenic
No off target data available for this crispr