ID: 906199992

View in Genome Browser
Species Human (GRCh38)
Location 1:43953760-43953782
Sequence CCTTGGGAGTTGGGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 610}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906199982_906199992 11 Left 906199982 1:43953726-43953748 CCTGAACTATGTTTTTAATGCTG 0: 1
1: 0
2: 0
3: 26
4: 317
Right 906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG 0: 1
1: 0
2: 1
3: 48
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906199992 Original CRISPR CCTTGGGAGTTGGGGATGGA GGG Intronic
900607015 1:3528296-3528318 CCTTGGGAGTGGGGCAGAGAGGG - Intronic
901843209 1:11966413-11966435 GGATGGGAGTTGGGGGTGGAGGG + Intronic
902780346 1:18700797-18700819 CCTTGGGAGATGGTGGTGGTGGG - Exonic
903370082 1:22829703-22829725 CTGTGGGGGTTGGGGATGGTGGG + Intronic
903499342 1:23792925-23792947 CCTTGGGGGTGGGGGAGGGGTGG + Intronic
903937397 1:26905901-26905923 CCTTGGGAGGTGGAGGTGGGTGG + Intronic
904197245 1:28795072-28795094 CTTTGGGAGGTGGAGATGGGTGG - Intergenic
904920361 1:34003165-34003187 ACCTGGGACTTGGGCATGGATGG - Intronic
904987363 1:34562897-34562919 CTTTGGGAGGTGGGGGTGGGAGG + Intergenic
905013887 1:34764083-34764105 CAAGGGGAGTTGGGGAGGGAGGG + Intronic
905159095 1:36015475-36015497 CCTTGGAGGTTGGGGATGTGGGG + Intronic
905282140 1:36856043-36856065 CCTAGGGAGCTGGGGACCGAGGG + Intronic
905414545 1:37794937-37794959 CCCTGGATGTTAGGGATGGAAGG - Intronic
905949450 1:41936374-41936396 CCCTGAGAGGTGGAGATGGAGGG + Intronic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906505221 1:46373921-46373943 CGTTGGGGGATGGGGATGGATGG + Intergenic
906639212 1:47431659-47431681 CCTTGGGTGGTGGTGGTGGATGG + Intergenic
907047331 1:51307200-51307222 CCTTGGGAGTTGGCAAGGGGTGG + Intronic
907108583 1:51906164-51906186 CCTCAGGATATGGGGATGGAAGG - Intergenic
907761013 1:57359935-57359957 GCTTGGGAGTGGGGGAAGGATGG + Intronic
907790903 1:57662437-57662459 CTTTGGGAGGTGGAGATGGGCGG - Intronic
910263727 1:85316250-85316272 CCTTCGGAGTTGGGAGGGGAAGG + Intergenic
910773991 1:90856622-90856644 CCCTGGGAGGTGGGGGTGGGGGG - Intergenic
910907954 1:92201556-92201578 AAGTGGGATTTGGGGATGGATGG - Intergenic
911038273 1:93572261-93572283 CCCCTGGATTTGGGGATGGAAGG + Intronic
912381237 1:109249376-109249398 CCTGGGGAAATTGGGATGGAGGG + Intergenic
912701773 1:111883143-111883165 CCACGGGAGTTGGGGCTGGAAGG - Intronic
914888866 1:151605230-151605252 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
915934725 1:160083865-160083887 CCTCGGGAGATGGGGAGGCACGG - Intronic
915953104 1:160203100-160203122 TTTAGGGAGTTGGGGATGGGAGG + Intergenic
916079794 1:161225293-161225315 CCTTGGGACTCAGGGAAGGAAGG + Intergenic
916951310 1:169783146-169783168 CCTTTGGGGTTGGCAATGGAGGG + Intronic
919735252 1:200945414-200945436 CCTTGTGAGTTGGAGAAGTATGG - Intergenic
919872121 1:201829582-201829604 GCCTGGGAGTGGGGGAGGGAGGG + Intronic
920076733 1:203342592-203342614 GGGTGGAAGTTGGGGATGGAGGG + Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920348980 1:205325163-205325185 CCATGGGACTTGGGGCTGGGGGG - Intergenic
920562093 1:206946239-206946261 GACTGGGAGTTGGGAATGGAGGG + Intronic
920764784 1:208821786-208821808 CCTGGGGGGTTGGGGGTGGGGGG - Intergenic
921217653 1:212951111-212951133 CCCGGGGGGTTGGGGATGGAGGG - Intronic
921864218 1:220071380-220071402 CATTGGTAATTGGGGATAGAAGG - Intronic
922185420 1:223270145-223270167 GCTTGGCAGCTGGGGATGCAGGG + Intronic
922464848 1:225839665-225839687 CCATGGGAGTTGGAGAAGGGAGG - Intronic
922545853 1:226456246-226456268 CCCTGGGAGATGGGGACAGAGGG - Intergenic
922633585 1:227140668-227140690 CCACTGGAGTTGGGGATGGGTGG + Intronic
923132576 1:231090052-231090074 CTTTGGGAGGTGGAGACGGATGG + Intergenic
923659880 1:235948876-235948898 CCTGAAGAGTTGGGGAGGGAAGG - Intergenic
923834251 1:237592387-237592409 CTTTGGGAGTTAGAGGTGGATGG + Intronic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924619454 1:245648029-245648051 CCGTTGGAGTTGGAGATGAAGGG + Intronic
924793417 1:247273497-247273519 GCTTGGGAATGGGGGAGGGATGG + Intergenic
1062812908 10:478947-478969 CCCTGGGTGCTGGGGAAGGAGGG - Intronic
1062821601 10:538263-538285 ACTTGGGAGTGGGAGGTGGAAGG - Intronic
1063144204 10:3281779-3281801 CCTTGGCTGTTGGGGTTGGATGG + Intergenic
1063568000 10:7189330-7189352 ACTTGGGAGTGAGGGGTGGATGG - Intronic
1064206522 10:13328824-13328846 GCCTGGGAGGTGGGGCTGGAAGG + Intronic
1064512240 10:16108275-16108297 TTTTGGGAGATGGGGATGTAGGG - Intergenic
1064719613 10:18215788-18215810 CCTTGGGAGTGGGCAGTGGAGGG - Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065763754 10:29007761-29007783 CCTGGGTGGTGGGGGATGGATGG + Intergenic
1066005993 10:31146616-31146638 CTTTCGGAGTTGGGAAAGGAGGG + Intergenic
1066086474 10:31976733-31976755 CCTTGGGAGTTCGAGGTGGGCGG + Intergenic
1066193732 10:33078968-33078990 ACTTGGGAGGTGGAGGTGGAAGG - Intergenic
1066403369 10:35096359-35096381 CTTTGGAAGATGGGGATAGAAGG + Intergenic
1068985373 10:63103362-63103384 CCTTTGGACTTGGCAATGGAAGG + Intergenic
1069000203 10:63254647-63254669 ACTTGGGAGGCGGGGATGGGAGG - Intronic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1070178476 10:73992910-73992932 CTTTGGGAGGCTGGGATGGAAGG + Intergenic
1070602837 10:77877776-77877798 CCCTGGAAGGTGGGGGTGGAGGG + Intronic
1070869551 10:79738624-79738646 ACTTGGGAGGTTGGGGTGGAAGG - Intergenic
1071520983 10:86331353-86331375 CCTGGGTAGTTGGGGAAGGGGGG - Intronic
1071728019 10:88218962-88218984 CCTTGAGAGCTGGGGATGTCTGG - Intergenic
1072005235 10:91239238-91239260 TATTAGGAGTTGGGGATGCAGGG - Intronic
1072642249 10:97220596-97220618 CCTTGGGGGCTGGGGAGAGAGGG + Intronic
1072788900 10:98303397-98303419 TCTGGGGAGTTGGGGAAGGCTGG + Intergenic
1072802047 10:98398890-98398912 CCTTGGGAGGTGGAGGTGGGAGG + Intronic
1073296967 10:102446434-102446456 CTTTGGGAGTTTGAGGTGGATGG + Intergenic
1073339775 10:102735791-102735813 CCTTGGGGATGGGGGATGGACGG + Intronic
1074613568 10:115043639-115043661 GTTGGGCAGTTGGGGATGGAAGG + Intergenic
1075095522 10:119468514-119468536 ACTTGGGAGCTGGGGGTGGGGGG - Intergenic
1075392839 10:122105365-122105387 CATTGGCAGTCTGGGATGGAGGG + Intronic
1075648112 10:124109659-124109681 CCCAGGGAGTTGGGGGTGGGTGG + Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1076134576 10:128036609-128036631 TCTTGGGAGCTGGGGTGGGAGGG - Intronic
1076268189 10:129127223-129127245 CCTTGGTAGCTGGGGAACGAGGG + Intergenic
1076575738 10:131465581-131465603 TATTGGGGGTTGGGGAGGGAAGG - Intergenic
1077095100 11:795825-795847 CCTTGGGGGTGGGGGATGGCTGG + Intronic
1077672078 11:4166371-4166393 TCTTGGAAGTTGGGGAGGGCAGG + Intergenic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1078571531 11:12462204-12462226 CCTAGGGATTAGGGCATGGATGG - Intronic
1078627429 11:12970454-12970476 ACTTGAGAGTGGAGGATGGAAGG + Intergenic
1078986359 11:16603519-16603541 CTTTGGGAGTGGGGGTGGGAGGG + Intronic
1079600094 11:22300671-22300693 CTTTGGGAGTTGGAGGTGGGCGG - Intergenic
1079870260 11:25789752-25789774 TCTTGGAAGTTGAGGATGGATGG - Intergenic
1080242512 11:30142934-30142956 CCTTGTGAGTTGAGAAGGGATGG + Intergenic
1080289177 11:30651779-30651801 CCTTGGGAGTGGGGGGTGCAAGG + Intergenic
1081464772 11:43306317-43306339 CTTTGGGAGTTCGAGATGGGTGG + Intergenic
1081553219 11:44133085-44133107 CCTTTGGGGTTGGGGGTGGAGGG + Intronic
1082093035 11:48105199-48105221 GCTTGGGGGATGGGGAGGGAGGG - Intronic
1082246788 11:49932622-49932644 TCTTGGGAGTAGGGTATGGCTGG - Intergenic
1083411213 11:62493712-62493734 CTTTGGGAGGTGGAGATGGGAGG - Intronic
1083827617 11:65212177-65212199 CCCTGGGAGGTTGGGAAGGAGGG + Intergenic
1084065922 11:66704545-66704567 CCTTGGGAGGTGGGGGTGGGGGG - Intronic
1084501138 11:69536118-69536140 ACTAGGGTGCTGGGGATGGATGG - Intergenic
1084943232 11:72625448-72625470 CCTGAGGAGTGGGAGATGGAGGG + Intronic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1085527680 11:77173662-77173684 CCTCGGGATCTGGGGAGGGAAGG + Intronic
1086008500 11:82069259-82069281 CCTTGGGGGATGGGTATGCATGG + Intergenic
1086554331 11:88091175-88091197 TATTGGGAGCAGGGGATGGAGGG + Intergenic
1088504310 11:110513702-110513724 CCTTCAGAGTCGGGGAGGGAAGG + Intergenic
1088594795 11:111432933-111432955 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
1089353569 11:117835396-117835418 TCTTAGAAGTTGGGGCTGGAAGG + Intronic
1089588065 11:119522533-119522555 TTTTGGAAGGTGGGGATGGATGG + Intergenic
1090066251 11:123506221-123506243 TCTTGGGAGGTGGGGCTGCAAGG - Intergenic
1090332615 11:125943399-125943421 CCTTGGGAAGGGGGGAAGGAGGG + Intergenic
1090604080 11:128403297-128403319 CCTTGAGTGTTTTGGATGGAGGG - Intergenic
1090847788 11:130545648-130545670 CCTAGGGTGTTGGGGGTGAAGGG - Intergenic
1090863492 11:130674857-130674879 TCGTGTGATTTGGGGATGGAAGG + Intronic
1090972324 11:131654304-131654326 CCTTTGGCGGTGGGGGTGGATGG - Intronic
1091527998 12:1324882-1324904 CCATGTGAGGTGGGGATGAATGG - Intronic
1091758070 12:3068513-3068535 ACTTGGGAGATGGAGATGGGAGG - Intergenic
1092162380 12:6322973-6322995 CCTGGGGAGTTGGGGCTCTAGGG - Intronic
1092884431 12:12912928-12912950 CTTTGGGAGATGGAGATGGGAGG - Exonic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1094432031 12:30380162-30380184 CCCTGGGAGTGGGGGCTGGCTGG - Intergenic
1095160235 12:38906239-38906261 ACTTGAGAGTTGGGGACGGTGGG + Intronic
1095232189 12:39752413-39752435 CCTAGGAGGTTGGGGATTGATGG - Intronic
1096080746 12:48830774-48830796 CCTTTGGAGATGGGGTGGGAAGG - Intronic
1096489588 12:52006552-52006574 CCTGGGGAGTCGGGGAGGTAGGG - Intergenic
1096528959 12:52231596-52231618 GCTTGGGCGTTGGGGAAGGAGGG + Intergenic
1097141228 12:56903735-56903757 CACTGGGACTTGGGGATAGAAGG + Intergenic
1097960707 12:65529491-65529513 TATAGGGTGTTGGGGATGGAGGG + Intergenic
1099152889 12:79137337-79137359 CTTTGGGAGGTTGGGGTGGATGG - Intronic
1099390708 12:82075218-82075240 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1099435903 12:82644558-82644580 ACTTGAGAGGTGGGCATGGAAGG + Intergenic
1101090953 12:101284764-101284786 CCTTGGGAATTAGGGGTGGGAGG - Intronic
1101671679 12:106881204-106881226 CCTTAGAAGTTGGGGGTGGGGGG + Intronic
1102030385 12:109736907-109736929 CCTAGGGAGTTGGGGCAGGGTGG - Intronic
1102100016 12:110270907-110270929 CCTTGGGGGGTGAGGAAGGAGGG + Intergenic
1102124189 12:110467231-110467253 CTTTGGGAGATGGAGGTGGACGG - Intronic
1102712829 12:114943435-114943457 AAATGGGACTTGGGGATGGAAGG - Intergenic
1102859357 12:116321974-116321996 ACTTGGGAGTTTGAGATGGGAGG - Intergenic
1103037536 12:117668364-117668386 CCTTAGGAGTTCAGGAGGGAGGG + Intronic
1103138994 12:118532597-118532619 CCCAGGGAGGTGGTGATGGAGGG - Intergenic
1103196013 12:119044341-119044363 CCTTGGGAGATGTGGAGGGCGGG + Intronic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103662625 12:122533449-122533471 CTTTGGGTGGTTGGGATGGAAGG + Intronic
1104047097 12:125171063-125171085 ACTTGGGAGTTTGAGGTGGAAGG + Intergenic
1104671274 12:130682204-130682226 CCTTGGCAGTGGGGGAAGGGAGG - Intronic
1105210662 13:18254954-18254976 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1105257820 13:18756411-18756433 CAGTGGGAGTTGGGGTTGGGGGG - Intergenic
1105259294 13:18766957-18766979 GGTTGGGGGTTGGGGATGGTTGG - Intergenic
1105264615 13:18804988-18805010 CATTGGGAGGTGGGGGTGGGAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106085744 13:26540252-26540274 CCTTGGGAGAGGGGGATGAATGG - Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107498193 13:40949227-40949249 CTTTGGGAGGTGGGGGTGGGTGG - Intronic
1107742316 13:43464420-43464442 CCTGGGGACCTGGGGAAGGAGGG + Intronic
1107830768 13:44372874-44372896 CCTGGGGAGGTAGGGGTGGAAGG - Intergenic
1112710887 13:102127956-102127978 CGCTGCGAGATGGGGATGGAGGG - Intronic
1112780185 13:102891933-102891955 CCTTGGGAGGTGGAGGTGGATGG - Intergenic
1113444077 13:110352227-110352249 CCTTGGGAGGTAGGCATAGAAGG + Intronic
1113467804 13:110524483-110524505 CCTTTGGAGTTGGTGCTTGAAGG - Intronic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114471421 14:22965569-22965591 CTTTGGGAGGTGGAGATGGGAGG - Intronic
1114494915 14:23125992-23126014 TTATTGGAGTTGGGGATGGATGG + Exonic
1114564038 14:23614882-23614904 CCCTGGGAGTTTGGGAGTGATGG + Intergenic
1116457929 14:45140795-45140817 CTTTGGGAGGTGGAGATGGGAGG + Intronic
1118159680 14:63275898-63275920 CCTTGGGACTGGGGGTTGGGGGG - Intronic
1118820807 14:69344543-69344565 GCTGGGGAGCTGGGGAAGGATGG + Intronic
1119749796 14:77069041-77069063 CCTTGGCAGATGGGGAAGGTTGG - Intergenic
1119773613 14:77235968-77235990 CCTGGGGAGATGGTGATGGGTGG + Intronic
1119852942 14:77879038-77879060 CCTTGAGAGCTGTGGATGAAGGG - Intronic
1119864045 14:77958038-77958060 CCCTGGAACTTGGGGATGAAGGG + Intergenic
1120098456 14:80416460-80416482 CTTTTGGAGGTGGGGATGGGAGG - Intergenic
1121894798 14:97636938-97636960 CCTTGAGAGATGGAGGTGGACGG - Intergenic
1122634305 14:103123046-103123068 GCTGGGGAGTTGGGGTGGGACGG + Intergenic
1123433356 15:20236872-20236894 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1124008601 15:25815094-25815116 ACCTGGTAGTAGGGGATGGAGGG - Intronic
1124213155 15:27780500-27780522 CCTTGGGAGTTGGGACAGGCAGG - Intronic
1124366190 15:29072979-29073001 CAATGGGAGTGGGGGATGCAGGG - Intronic
1124604322 15:31159777-31159799 CCTGGTGAGCTGGGTATGGATGG + Intronic
1125293166 15:38172303-38172325 ACTTGGGATTTGAGGATGGTTGG + Intergenic
1125538385 15:40455822-40455844 ATTTGGGAGTTGGGGAGGGCTGG + Intronic
1125686144 15:41564505-41564527 CCTTGGGAGGGAGGGAAGGAGGG + Intronic
1125979610 15:43988539-43988561 CCCTGGGAGTTGGGAGTGGGTGG - Intronic
1126388337 15:48117892-48117914 CTTTGGGAGTTGGGAAAGGGTGG - Intergenic
1126636603 15:50786207-50786229 CTTTGGGAGGCCGGGATGGATGG - Intergenic
1126696455 15:51329956-51329978 CCCTGGGATGTGGGGCTGGAGGG + Intronic
1126711114 15:51457061-51457083 ACTTGGGAGGTTGAGATGGAAGG + Intronic
1127055336 15:55125699-55125721 CTTTGGGAGGTGGAGAGGGAAGG - Intergenic
1127206141 15:56721212-56721234 CTTTGGGAGGTGGAGATGGGTGG - Intronic
1128104642 15:65034524-65034546 CCTTGGGGGTAGGGGCTGAAGGG + Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128997768 15:72309477-72309499 GCTTGGGAGTTGGGGAAGGTGGG + Intronic
1129177497 15:73850585-73850607 ACTTAGGAGTTGGGGAAGCAAGG + Intergenic
1129229686 15:74190087-74190109 CCTTTGGATTTTGGTATGGAGGG + Intronic
1129888120 15:79052802-79052824 TCTTGGGAATGGGGGATGGCAGG + Intronic
1129996093 15:80007553-80007575 CTTTGGGAGTTGGAGGTGGGAGG - Intergenic
1130241669 15:82199133-82199155 ACTTGGGATTTGGAGGTGGAAGG - Intronic
1130528246 15:84725325-84725347 CTTTGGTTGTTGGGGGTGGAGGG - Intergenic
1131172807 15:90190548-90190570 CCTTGGGCCTTTGGGAAGGAAGG + Intronic
1131207255 15:90460888-90460910 ACTTGGGAGGTTGAGATGGAAGG + Intronic
1131432388 15:92396980-92397002 CGGAGTGAGTTGGGGATGGAGGG - Intronic
1131506829 15:93026792-93026814 CGTTGGGAGATGGGGTGGGAAGG + Exonic
1132148438 15:99442773-99442795 CCTGGGGTGTTGGGGCTGGCAGG - Intergenic
1132699455 16:1216132-1216154 CCGTGGGGGTTGGGGGTGGCTGG - Intronic
1132973424 16:2700083-2700105 CCTTGGGAGTTCGGGTGGGGTGG + Intronic
1133730292 16:8572826-8572848 ACTTGGGATTGGGGGATGGCTGG + Intronic
1133733346 16:8594881-8594903 CTTTGGGAGTCTGAGATGGAGGG + Intergenic
1134162180 16:11900428-11900450 TGTAGGGAGTGGGGGATGGAGGG + Intronic
1134420883 16:14088039-14088061 CTTTGGGAGGTGGAAATGGATGG + Intronic
1135137990 16:19898756-19898778 CTTTGGGAGTCCGGGATGGGAGG + Intergenic
1135323697 16:21512936-21512958 TGTGGGGGGTTGGGGATGGAGGG + Intergenic
1136075065 16:27811613-27811635 AATTGGGAGCTGAGGATGGATGG - Intronic
1136469186 16:30467389-30467411 TCTTGGGATTTAGGGATGGGCGG + Intergenic
1136925178 16:34365483-34365505 GCTTGGGAGTAGGGCATGGAGGG + Intergenic
1136979395 16:35046323-35046345 GCTTGGGAGTAGGGCATGGAGGG - Intergenic
1137001704 16:35235091-35235113 CCTTGGGAGGTGGGGAAGATGGG - Intergenic
1137709118 16:50554290-50554312 TGTTGGAAGGTGGGGATGGATGG + Intronic
1137736845 16:50731059-50731081 ACTTGGGAGGCTGGGATGGAAGG + Intronic
1138920011 16:61515842-61515864 CCTTGGGGGTCGGGGAGGGGAGG + Intergenic
1139261461 16:65598678-65598700 CCTGGGGAGCTTGGCATGGAAGG - Intergenic
1139375820 16:66495627-66495649 AGGTGGGAGGTGGGGATGGATGG - Intronic
1139506139 16:67398999-67399021 CCATAGGAGTTGGGGCTGTAGGG + Intronic
1139577077 16:67848219-67848241 CCTTGGGACTAGGGGAGAGATGG + Intronic
1139645408 16:68325875-68325897 CCTTGGGACTTGGGAATGTGCGG + Intronic
1139870662 16:70106345-70106367 ACTTGAGAGTTGGTGATGGTTGG - Intergenic
1139972317 16:70783775-70783797 CCAGGGGAGAAGGGGATGGATGG + Intronic
1140036105 16:71372403-71372425 CCTTGGGTGTCTGGGATTGAGGG + Intronic
1140077359 16:71713841-71713863 CCTGGGTAGTTGGGGAATGAGGG + Intronic
1140089638 16:71827097-71827119 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
1140384787 16:74526214-74526236 ACTTGAGAGTTGGTGATGGTTGG + Intronic
1141100327 16:81193075-81193097 GCCTGAGAGTTGGGGAGGGATGG - Intergenic
1141618094 16:85221578-85221600 GCTGGGGAGTTGGGGCTGGACGG - Intergenic
1141619176 16:85227764-85227786 CCCTGGGAGATGGAGATTGATGG + Intergenic
1142256583 16:89016990-89017012 CCTTGGGGGTTGCAGATGGAGGG - Intergenic
1142470543 17:161102-161124 CCTGGGGAGATGGGGAGAGATGG - Intronic
1143167125 17:4902326-4902348 CCTAAGGGGTGGGGGATGGAAGG + Exonic
1143463183 17:7117098-7117120 CTTTGGGAGTTTGAGATGGGCGG - Intergenic
1143503780 17:7352979-7353001 CCTTGGGAATTGAGGTTGGGGGG - Exonic
1143564813 17:7715090-7715112 CCAGGGGAGATGGGGATGGGTGG + Intergenic
1144221824 17:13106665-13106687 ATTTGGGAGGTGGAGATGGAAGG + Intergenic
1144485047 17:15657343-15657365 ACTTGGGAGGTGGAGATGGGAGG - Intronic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1145113957 17:20190808-20190830 CCTTGGGGGTGGGGGATGAATGG + Intronic
1145218935 17:21072900-21072922 CCTAGGGAGTAGGGGATGTGGGG - Intergenic
1146023719 17:29301297-29301319 CTTTGGGAGGTGGAGGTGGATGG - Intergenic
1146808805 17:35887304-35887326 CTTTGGGAGTTGGAGGTGGGTGG + Intergenic
1147327108 17:39674875-39674897 CCTTGGGGGTTTGGGGTGGCAGG - Intronic
1148155769 17:45424654-45424676 ACTTGGGAGTGGGGGAAGGGTGG + Intronic
1148342849 17:46883881-46883903 CCTGGGGACTTGAGGAGGGATGG - Intronic
1148360598 17:47009451-47009473 GCTGGGGAGCTGGGGGTGGAGGG + Intronic
1148441993 17:47716221-47716243 CCTTGGAAGGTGGGTGTGGAGGG + Intergenic
1148504258 17:48114908-48114930 CTTTGGGAGGTGGAGATGGGTGG - Intronic
1148662339 17:49344926-49344948 AGGTGGGAGTTGGGGAAGGAGGG - Intronic
1149449670 17:56739808-56739830 GCTTGGGAGTGGGGGATGGAGGG - Intergenic
1149494276 17:57107125-57107147 ACTTGGGGGCTGAGGATGGATGG + Exonic
1149497165 17:57126290-57126312 CTTTGGGAGGTCGGGGTGGAAGG + Intergenic
1150209332 17:63433662-63433684 ACATGGGGGTTGGGGATGGGGGG - Exonic
1150387459 17:64773321-64773343 ACTTGGGAGTGGGGGAAGGGTGG + Intergenic
1151957007 17:77385460-77385482 CCTTGGGAGGCCGAGATGGATGG - Intronic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152511860 17:80795422-80795444 CCTTTGGTGCTGGGGAGGGAGGG - Intronic
1152568703 17:81111829-81111851 CCTAGCAACTTGGGGATGGAAGG - Intronic
1153768953 18:8400404-8400426 CCCCGGGAGTTGGGGGTGGGCGG - Intronic
1154423775 18:14256572-14256594 CATTGGGAGGTGGGGGTGGGAGG + Intergenic
1154426021 18:14272569-14272591 CAGTGGGAGTTGGGGGTGGGTGG + Intergenic
1154433233 18:14324316-14324338 CAGTGGGAGTTGGGGATGGGGGG + Intergenic
1155319157 18:24601887-24601909 ACCTGGGAGTGGGGGATGGTAGG - Intergenic
1155930551 18:31702992-31703014 CCTTTGCAGTATGGGATGGAAGG + Intergenic
1156389111 18:36634189-36634211 CCTTTGGAGTGGGAGCTGGAGGG + Intronic
1156635774 18:39027639-39027661 CTTCGGTAGTTGGGGATGGGTGG + Intergenic
1159431374 18:68357324-68357346 CACTGGGATTTGGGGATGTAAGG + Intergenic
1160701266 19:508528-508550 CTGTTGGCGTTGGGGATGGATGG + Intronic
1160749108 19:725680-725702 GCTTGGGAGGTGGGGCTGGTGGG + Intronic
1160978908 19:1807501-1807523 CCGTGGGAGCTGGGCTTGGACGG - Intronic
1161265929 19:3364597-3364619 TCTTGGGAGGTGGGGAAGGTTGG - Intronic
1161582632 19:5089031-5089053 GCTTGGGTGTGGGGGCTGGAGGG + Intronic
1161813871 19:6487168-6487190 CCTTGGGAGGCTGGGATGGGAGG - Intergenic
1161952948 19:7477731-7477753 CTTTGGGAGGTGTGGAGGGAAGG + Intronic
1161981732 19:7633551-7633573 GCTGGGGATTTGGGGATGGGGGG - Exonic
1162290922 19:9779814-9779836 CTTTGGGAGTTGGAGGTGGGTGG - Intronic
1162503449 19:11067987-11068009 CCTTGGCAGTGGGGGAGGGAAGG + Intergenic
1162815711 19:13193104-13193126 ACTTGGGAGGTTGGGATGGGAGG - Intergenic
1162928827 19:13945409-13945431 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1163129540 19:15264070-15264092 CCATGGGAGTTGGGGCTTGGCGG - Intronic
1163148754 19:15399137-15399159 CCTTGGGAGCTGGGCCTGGCGGG + Intronic
1163312572 19:16522926-16522948 CCTAGGGAGTGGGAGATGAAGGG + Intronic
1163569274 19:18070693-18070715 CTTTGGGAGGTGGAGATGGGTGG + Intronic
1163865253 19:19768184-19768206 ACTTGGGAGTCTGGGATGGGAGG + Intergenic
1165667738 19:37648243-37648265 GCTGGGAAGGTGGGGATGGAGGG - Intronic
1165670261 19:37672375-37672397 CCCTGGGAGTGAGGGAGGGATGG + Intronic
1166106095 19:40598731-40598753 CCTCGGCAGCTGGGGAGGGAAGG - Intronic
1166525008 19:43505044-43505066 CCTTGGGAGTTCAGAAAGGAAGG + Intergenic
1166746550 19:45144622-45144644 CCTGGGGAGCTGGGAGTGGACGG + Intronic
1166753124 19:45174345-45174367 CCGTGGCAGGTGGGGATGGGTGG - Intronic
1166826561 19:45613510-45613532 CTTGGGGAGATGGGGATGGACGG - Intronic
1167026536 19:46923583-46923605 CCTTGGCAATTGGGGGTGGGGGG - Intronic
1167455884 19:49596624-49596646 CCGTGGGAGGTGGGGGCGGAGGG - Exonic
1167671562 19:50856491-50856513 CCTTGGGACTGGGGGAGAGAGGG + Intronic
1167695627 19:51014181-51014203 CCCTAAGGGTTGGGGATGGAAGG + Exonic
927223152 2:20733780-20733802 CTTTGGGAGTCTGAGATGGAAGG - Intronic
928180586 2:29065644-29065666 CCTTGGGAGTGCAGAATGGAGGG + Intronic
928388365 2:30888911-30888933 AATTGGGAGGTGGGGGTGGAGGG - Intergenic
929031854 2:37656864-37656886 CCTAGTGAGTTAGAGATGGAGGG - Intronic
929183747 2:39071109-39071131 CCTTGGGAGGTGGAGGTGGGTGG - Intronic
929451443 2:42040620-42040642 CCTCTGGGGTTGGGGTTGGAGGG + Intergenic
929786577 2:44997663-44997685 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
929967072 2:46543533-46543555 ACTTGGGAGAAGGGGGTGGACGG + Intronic
931174792 2:59843090-59843112 CCTTTGGAGATGGGCATTGAAGG - Intergenic
932029991 2:68173535-68173557 CCTTGGGAGTTGGCAAAGGTGGG + Intronic
932188307 2:69717360-69717382 CTTTGGGAGTGTGGGATGAAAGG - Intronic
932360812 2:71104103-71104125 CCTTGGGACTTCAGGAAGGAAGG + Intergenic
932694438 2:73943403-73943425 CCTTGGGAGTCCGAGGTGGAAGG - Intronic
932751291 2:74373335-74373357 CCTTGGGAGTGGTGGCTGGGCGG - Intronic
933311522 2:80667145-80667167 CAGTGGGATTTGGGGATTGAAGG + Intergenic
933719698 2:85390049-85390071 CCTGGGGAAATGGGGAAGGAAGG + Intronic
933988973 2:87619917-87619939 CCTTGGGAGATGGGGGTGTCTGG + Intergenic
934475731 2:94592177-94592199 GCATGGGAGGTGGGGTTGGATGG + Intronic
934948254 2:98557851-98557873 CCTTGGCAGGCGGGGGTGGAGGG - Intronic
934975558 2:98799761-98799783 CCTTGGGATTTGGGGTTGGGTGG - Intronic
936291590 2:111228469-111228491 CCTGGGGAGCTGGGGTTGGGAGG - Intergenic
936304870 2:111330909-111330931 CCTTGGGAGATGGGGGTGTCTGG - Intergenic
937093616 2:119222645-119222667 CGGCGGGAGTTGGGGGTGGAGGG + Intergenic
937179212 2:119975218-119975240 ACTTGGGAGGTGGAGATGGGAGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937399550 2:121570186-121570208 CTTTGGGAGTTGGGTGGGGAGGG - Intronic
939605610 2:144251950-144251972 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
941862550 2:170298721-170298743 GCATGGGAGTTTTGGATGGATGG + Intronic
941904478 2:170707621-170707643 CTTTGGGAGGTGGAGGTGGACGG - Intergenic
942203567 2:173596132-173596154 GGCTGGGAGTTGGGGTTGGAGGG + Intergenic
942728179 2:179033568-179033590 GACTGGGAGTAGGGGATGGATGG + Intronic
942886459 2:180930817-180930839 ACTTGAGAGTTGGGGGTGGGAGG - Intergenic
943960942 2:194263169-194263191 CCATGGGAGGTGGGGATTGGGGG - Intergenic
944336595 2:198542005-198542027 TGTTGGGGGTGGGGGATGGAAGG - Intronic
944675365 2:202031079-202031101 CTTTGGGAGTTGGGTGTGGAAGG + Intergenic
945079385 2:206073620-206073642 CCTTGGGAGGTTGAGGTGGAAGG - Intronic
945214054 2:207414412-207414434 CTTTGGGAGGTGGAGATGGGGGG + Intergenic
945465890 2:210170893-210170915 CCTTGGCAGCTGGGGAGGGAAGG - Intronic
945775720 2:214103909-214103931 TCTGGGGAGTGGGGGTTGGAGGG + Intronic
946185033 2:217975950-217975972 GCTGGGGAGTTTGGGCTGGAGGG - Intronic
946882079 2:224186288-224186310 ATTTGGGAGATGGGGATGGTAGG + Intergenic
947549143 2:231033956-231033978 CCTTGGGAGGTTGGGGTGGGTGG - Intergenic
948206262 2:236164272-236164294 CCTTTCGAGTGGGGGAAGGAGGG - Intergenic
1169344215 20:4817625-4817647 CCTGGAGAGGTGGGGAGGGAGGG - Intronic
1169444606 20:5660818-5660840 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
1169543895 20:6631022-6631044 AATTAGGAGTAGGGGATGGAGGG - Intergenic
1170831076 20:19841189-19841211 CCTTGGGAGGCTGGGGTGGAAGG - Intergenic
1170839099 20:19909298-19909320 CCTTGGGGGTAGGGCAGGGAAGG - Intronic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1171447589 20:25215848-25215870 CATAGGGTGTTGGGGATGGGTGG + Intronic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1172147115 20:32764451-32764473 TCCTGAGATTTGGGGATGGAGGG + Intronic
1172682117 20:36724682-36724704 CTTTGGGAGGCGGAGATGGATGG + Intronic
1172786509 20:37472311-37472333 CATTGGAAGTGGGGGATTGAAGG - Intergenic
1173161755 20:40658113-40658135 CCTTGGGAGGTGTGGTTAGAGGG - Intergenic
1173931822 20:46827189-46827211 CCTTAGGTATTGGGGATGGTAGG + Intergenic
1174168701 20:48603379-48603401 CCCTGGGTGTTGGGGATGCAGGG - Intergenic
1175613356 20:60370936-60370958 TGTTGGGGGTTGGGGGTGGAAGG - Intergenic
1175726105 20:61319700-61319722 CTTTGGGAGGTGGAGGTGGATGG + Intronic
1175932257 20:62498480-62498502 GGTTGGGTGTTGGGGATGGGTGG + Intergenic
1175998572 20:62821997-62822019 CCGTGGGAGTGGGGGCTGGTGGG + Intronic
1176103997 20:63377112-63377134 CCTTGGGGGGTGGGGACAGAGGG + Intronic
1176801047 21:13431379-13431401 ACTTGGGAGTCTGGGATGGGAGG + Intergenic
1176846007 21:13877270-13877292 CAGTGGGAGTTGGGGGTGGGTGG - Intergenic
1176849693 21:13903436-13903458 CATTGGGAGGTGGGGGTGGGAGG - Intergenic
1178166952 21:29990018-29990040 TGTTGGGAGTTGGAGATGGGAGG + Intergenic
1178474712 21:32927532-32927554 ACTTGGGAGGCTGGGATGGAAGG + Intergenic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1179030941 21:37718968-37718990 CATGGGGAGATGGGGAGGGAAGG + Intronic
1179511260 21:41875278-41875300 GCTTGGGAGTTGGGGGTGGCAGG - Intronic
1179708496 21:43195894-43195916 CGGTGGGAGGTGGGGAAGGAAGG + Intergenic
1180363124 22:11917271-11917293 CAGTGGGAGTTGGGGGTGGGAGG + Intergenic
1180694234 22:17741848-17741870 CCTTGGGGGTTGGGTATGTTTGG - Intronic
1180780724 22:18517931-18517953 CCTGAGGAGGTGGGGAGGGAGGG + Exonic
1180994416 22:19958406-19958428 CTTTGGGAGGTTGGGATGGGAGG - Intronic
1181031824 22:20152036-20152058 CTTTGGGAGGTGGAGATGGGTGG - Intergenic
1181199619 22:21209568-21209590 CCTGAGGAGGTGGGGAGGGAGGG + Intronic
1181254874 22:21555989-21556011 CTTTGGGAGGCGGGGATGGGTGG + Intronic
1181400141 22:22646290-22646312 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1181649223 22:24249500-24249522 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1181702113 22:24627388-24627410 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1182848341 22:33450153-33450175 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1183302595 22:37065630-37065652 ACTTGGGATCTGGGAATGGAAGG - Exonic
1183466204 22:37981565-37981587 CCTTGGCAATGGGAGATGGAGGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184198601 22:42949047-42949069 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1184409696 22:44319407-44319429 CCTTGGCCCTTGGGGATGAAGGG + Intergenic
1184728296 22:46358594-46358616 CCTTGGGTGCTGGGGAGGGTAGG - Intergenic
1184756356 22:46518151-46518173 CTTTGGGAGGTCGAGATGGATGG - Intronic
1184817102 22:46880763-46880785 CCATGGCAGGTGGGGAAGGAGGG + Intronic
949184467 3:1173551-1173573 CCTTGGGCATTGGGATTGGATGG - Intronic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949461476 3:4299563-4299585 CTTTGGGAGGTGGAGATGGGTGG + Intronic
950175660 3:10872397-10872419 ACTTGGAAAATGGGGATGGAAGG - Intronic
951662632 3:25086690-25086712 GGTTGGGGGTTGGGGAAGGAGGG + Intergenic
951688954 3:25375366-25375388 CCTTCAGAGTTAGGGATTGATGG - Intronic
951750632 3:26031259-26031281 CCTTGGGTCTTGGGGAAAGATGG + Intergenic
951933808 3:27999751-27999773 GCTCTGGTGTTGGGGATGGAGGG + Intergenic
952024419 3:29061602-29061624 CCTTGGGAATTTGGGAGGGTGGG + Intergenic
952365900 3:32674733-32674755 CTTTGGGAGTTCGAGGTGGATGG + Intergenic
953389645 3:42526881-42526903 CCTTGGGAGTTGGGGTCGGTGGG - Intronic
953673531 3:44982320-44982342 TCCTGGCTGTTGGGGATGGATGG + Intronic
954302098 3:49705512-49705534 ACTGGGGAGTTGGGGAGGGAAGG - Exonic
954560663 3:51553581-51553603 CTTTGGGAGGTGGAGATGGGAGG + Intronic
956495464 3:69821370-69821392 CTTAGGGGGTTGGGGGTGGAGGG - Intronic
956820224 3:72947554-72947576 CTTTGGGAGGTGGAGATGGGTGG + Intronic
957187977 3:76967448-76967470 CTTTGGGAGGTGGAGGTGGATGG - Intronic
958104339 3:89053435-89053457 ATTTGGGGGATGGGGATGGAAGG + Intergenic
958940877 3:100312908-100312930 CTTTGGGAGTTGGAGGTGGGCGG + Intronic
959562217 3:107795698-107795720 CCTTGGGACTTGGGTATTGCTGG + Intronic
960266292 3:115624636-115624658 CCTGGGCAGTGGGGGAGGGAAGG - Intronic
961448833 3:126993332-126993354 CCTTGGGACTAGGGGTGGGAAGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962851698 3:139312957-139312979 CCTTTGGAGCTGGGTCTGGAAGG + Intronic
963638606 3:147831104-147831126 CTTTGGGAGGCGGGGATGGGGGG - Intergenic
965449553 3:168820648-168820670 CATTGAGTGTTAGGGATGGAAGG - Intergenic
965593444 3:170384105-170384127 CTTTGGGAGTTGGAGGTGGGAGG + Intronic
965688976 3:171335009-171335031 TTTTGGCAGTTGGGGAAGGAAGG - Intronic
967640334 3:191855165-191855187 CCTTGAGTGTGGAGGATGGAAGG + Intergenic
968778122 4:2557707-2557729 CTTTGGGAGGCTGGGATGGACGG + Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
969057962 4:4413833-4413855 ACTGGGGCGCTGGGGATGGAGGG + Intronic
969313829 4:6369872-6369894 CCTAGGGACATGGGGATGAATGG - Intronic
969413770 4:7045735-7045757 CCTTGGCAGTTGGCTTTGGACGG + Intronic
971531260 4:27692433-27692455 CCTCGGGAATTGGGGAAAGATGG + Intergenic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
972944511 4:44237420-44237442 ATTTGGGAGTTGGGAATGGGTGG + Intronic
973213593 4:47643814-47643836 CCTTTGGAAGTGGGGATGGCTGG - Intronic
973960548 4:56105388-56105410 CCTTGGGAGGTTGAGGTGGAAGG + Intergenic
974189487 4:58486347-58486369 CCTAGGGGGTGGGGGATTGATGG - Intergenic
974413417 4:61571545-61571567 CCTGGGGAGTTTGGGCTGCATGG + Intronic
975100967 4:70512620-70512642 CCTTGGGAGGTGAGCATGTACGG + Intergenic
975144192 4:70949642-70949664 CTTTGGGTGGTGGGGATGGGGGG + Intronic
975670752 4:76778463-76778485 CTTTGGGAGGCCGGGATGGATGG - Intronic
977074346 4:92433592-92433614 GCTGGGGAGTTGGGGAGGGGTGG + Intronic
978840702 4:113208744-113208766 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
981917090 4:150046375-150046397 ACTTGGGAGAAGGGTATGGAGGG - Intergenic
983869059 4:172803440-172803462 CCATGGGGGCTGGGGAGGGATGG - Intronic
984952032 4:185015118-185015140 GCTTGGGGGCAGGGGATGGATGG - Intergenic
985641033 5:1063645-1063667 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641050 5:1063694-1063716 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641067 5:1063743-1063765 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985676708 5:1235149-1235171 CCTTGGGGGTCTGGGATGGTGGG + Intronic
985779246 5:1861330-1861352 CCGCTGGAGTTGGGGATGGAGGG + Intergenic
985982878 5:3487007-3487029 CTTTGGGAGGTGGAGATGGGAGG + Intergenic
986002771 5:3643200-3643222 GCTTGGGATGGGGGGATGGAGGG - Intergenic
987064597 5:14276603-14276625 CCTTGGGAGTTGGGAGTGGGAGG + Intronic
987140968 5:14945879-14945901 GCATGGGAGGTGGGGATGCAGGG - Intergenic
987708872 5:21485002-21485024 CTTTGGGAGGTCGGGGTGGACGG + Intergenic
988450600 5:31339126-31339148 CTTTGGGAGGTGGAGATGGCCGG + Intergenic
988527246 5:31998082-31998104 CCTTGGGAGGCTGAGATGGATGG - Intronic
988750740 5:34189144-34189166 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
988811297 5:34787572-34787594 TCCTGGGAGTTGGGGAAGTAGGG + Intronic
988917228 5:35906749-35906771 CTGGGGGAGTTTGGGATGGAAGG - Intronic
989170975 5:38469967-38469989 CTTTGGGGGTGGGGAATGGAGGG + Intergenic
990661583 5:58021522-58021544 TCTTGGGATTTGGGGATTTATGG + Intergenic
990812233 5:59741111-59741133 CCTTTGGGGATGGGGACGGAAGG - Intronic
991135757 5:63180113-63180135 CTTTGGGAGTTGGAGGTGGGTGG + Intergenic
991655610 5:68901253-68901275 ACTTTGGAGGTGGGGGTGGAGGG + Intergenic
991735877 5:69631069-69631091 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991739005 5:69652357-69652379 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991759193 5:69904074-69904096 CTTTGGGAGGTCGGGGTGGACGG + Intergenic
991788143 5:70214048-70214070 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991790580 5:70232098-70232120 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991812371 5:70486708-70486730 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991815330 5:70507185-70507207 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991818466 5:70528474-70528496 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991838422 5:70779140-70779162 CTTTGGGAGGTCGGGGTGGACGG + Intergenic
991880590 5:71214412-71214434 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
991883027 5:71232433-71232455 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
992666798 5:79018280-79018302 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
993197265 5:84764811-84764833 CCCAGGTAGTTGGGTATGGAGGG - Intergenic
994420999 5:99526351-99526373 CTTTGGGAGGTCGGGGTGGACGG + Intergenic
994505760 5:100641420-100641442 CGTTGGAACTTGGGGATGCAAGG + Intergenic
995396745 5:111694985-111695007 TCCTGGGAGGTGGGGTTGGAGGG + Intronic
995938152 5:117544601-117544623 CCTGGGTAGTAGGAGATGGAAGG - Intergenic
996769288 5:127068958-127068980 TCTTTGGAGTTGAGGATGGAGGG - Intronic
997124917 5:131216391-131216413 ACTTGGGAGGCGGAGATGGAAGG + Intergenic
997226948 5:132215916-132215938 CTTTGGGAGGTGGAGATGGGTGG + Intronic
997227958 5:132223503-132223525 CTTTGGGAGGTCGAGATGGATGG - Intronic
997361326 5:133296930-133296952 CCTTGGGGGCTGGGGCTGGTGGG + Intronic
998236533 5:140402561-140402583 GCTTTGGAGTTGGGGGTGGGGGG + Intronic
998583537 5:143403929-143403951 CCTGGGGAGTTGGGGGCGGGGGG - Intronic
998619085 5:143774638-143774660 CCATCAGAGTTGGGGAGGGAAGG - Intergenic
998981279 5:147705357-147705379 CCTTGGGAGGTCGAGGTGGATGG + Intronic
999184048 5:149692188-149692210 GCTTGGGAGTTCTGGATTGAGGG - Intergenic
999401288 5:151266233-151266255 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1001242353 5:170080338-170080360 CCTTGTGGGTGGAGGATGGATGG + Intronic
1001396397 5:171421723-171421745 CATTGGGGCTTGGGGATGGAAGG + Intronic
1001459172 5:171894219-171894241 ACTTGAGGGTTGGGGATAGAGGG - Intronic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1001590152 5:172859368-172859390 CCATGGGAGTTGGGGGTGGGTGG - Intronic
1001667175 5:173442934-173442956 GGTTGGGATTTGGGGAGGGAGGG + Intergenic
1001686526 5:173598055-173598077 CCTTGGGAATAGGAGAGGGATGG - Intergenic
1002765114 6:232687-232709 CCCTGGGGGTTGGGGATGCCTGG + Intergenic
1003141862 6:3478437-3478459 CCCTGGGAGCTGCTGATGGAGGG - Intergenic
1003277422 6:4664517-4664539 CCTTGGGAAGTGGGGCTGGGTGG - Intergenic
1003286050 6:4734674-4734696 AGTTGGGGGATGGGGATGGAGGG + Intronic
1003414527 6:5896124-5896146 CCTAGGGGTTTGGGGATGGCAGG + Intergenic
1005381574 6:25240110-25240132 CTTTGGGAGTCCGAGATGGATGG - Intergenic
1005548810 6:26895449-26895471 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1007158527 6:39770174-39770196 CTTGGGGAATTGGGGGTGGAGGG - Intergenic
1007278198 6:40690996-40691018 CCGTGTGGGTTGGGGATGGGTGG + Intergenic
1007637004 6:43305708-43305730 CCATGGGGGTTGGGGAAGGTGGG - Exonic
1007715130 6:43851354-43851376 CCTGGGGAGTTGAGGATGGGTGG - Intergenic
1007754065 6:44087495-44087517 GAATGGGAGTTGGGGCTGGAGGG - Intergenic
1007926744 6:45655872-45655894 CTTTGGGGTTTGGGGAGGGAGGG - Intronic
1007936582 6:45737870-45737892 ACTTGGGATGTGGGGGTGGAAGG - Intergenic
1008418359 6:51269007-51269029 AATGTGGAGTTGGGGATGGATGG - Intergenic
1009019563 6:57936561-57936583 CTTTGGGAGGTCGGGGTGGACGG - Intergenic
1009241886 6:61194492-61194514 CCTTGGGAGTTCAGGATTAAGGG + Intergenic
1010219719 6:73437822-73437844 CTTTGGGAGATGGAGATGGGTGG + Intronic
1010800037 6:80164469-80164491 CCAGGGGAGTAGGTGATGGAGGG - Intronic
1011634477 6:89358252-89358274 CTTTGGGAGGTGGAGGTGGAGGG + Intergenic
1012160216 6:95874862-95874884 CCATGGGAGATGGGCATGGTAGG + Intergenic
1012638384 6:101577888-101577910 CCTGGGGAATGGGGAATGGATGG + Intronic
1013126014 6:107185027-107185049 ACTTGGGAGGTGGAGATGGGAGG + Intronic
1013627047 6:111948964-111948986 TCTTGAGAGTTGGGGATGTGGGG - Intergenic
1013960409 6:115892281-115892303 CCTGGACAGTTGGGGATGTATGG + Intergenic
1014689396 6:124544302-124544324 AGTTGGGAGGTGGGGGTGGAGGG - Intronic
1014927273 6:127287784-127287806 TTTTGGGAGTTGGGGTGGGAAGG + Exonic
1015186660 6:130424794-130424816 GCTTGGGAGTTGCTGATAGAAGG + Intronic
1015714421 6:136177217-136177239 CTTTGGGAGGTGGAGATGGGAGG + Intronic
1016684934 6:146870560-146870582 ACTTGGGAGGTTGAGATGGAAGG - Intergenic
1017025130 6:150174719-150174741 CTTTGGGAGGTGGAGGTGGACGG + Intronic
1017149713 6:151268035-151268057 AAATGGGAGTTGGGGATGGAAGG - Intronic
1017225678 6:152018581-152018603 GCTGGGGTGTTGGGGGTGGAAGG + Intronic
1017249258 6:152262147-152262169 TCCCAGGAGTTGGGGATGGAAGG - Exonic
1017595435 6:156023514-156023536 CCAGGGGGGTTAGGGATGGAGGG + Intergenic
1019503173 7:1375739-1375761 CCTGGGGAGGTGGGGAGGCAGGG - Intergenic
1019798091 7:3066969-3066991 CTTTTGGGGTTGGAGATGGAAGG - Intergenic
1019876622 7:3817685-3817707 CCTTGGGCATGGGGGAGGGAGGG - Intronic
1022140069 7:27486157-27486179 CCTGGGGAGTGGGGCAGGGATGG + Intergenic
1022576248 7:31499847-31499869 TGGTGGGAGTTGGGGAGGGAGGG + Intergenic
1023026962 7:36059464-36059486 CCTTGGGACTTGGGGCGGAAGGG - Intergenic
1023755325 7:43410482-43410504 ACTTGGGGGTTGGTGGTGGAAGG + Intronic
1024026187 7:45411910-45411932 CCTTGGGAGCTGGGAAGGGAGGG + Intergenic
1024210363 7:47198014-47198036 ATTTGGGAGTTGGGGAAGGAAGG - Intergenic
1024276851 7:47684417-47684439 CCTTGGGAGGTGGAGGTGGGCGG + Intergenic
1024387935 7:48774880-48774902 CCTTGGGAAATGGGGGTGGCGGG - Intergenic
1025603923 7:63025192-63025214 ACTTGGGAGTGGGGGCAGGAGGG - Intergenic
1025641870 7:63381578-63381600 ACTTGGGAGTTTGAGATGGGAGG - Intergenic
1025873717 7:65460469-65460491 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1025947130 7:66113295-66113317 CTTTGGGAGTTGGAGGTGGGAGG + Intronic
1028607013 7:92666003-92666025 CCTTGGCAGTTGGGGGTTGGGGG - Intronic
1029279193 7:99425696-99425718 CCTTGGGAGTTTTAGATGGGAGG + Intronic
1029455022 7:100665374-100665396 CCTTTGGATATGGGGAGGGAAGG + Intergenic
1030115056 7:106056619-106056641 CTTTGGGAGGCTGGGATGGATGG - Intergenic
1030317902 7:108135249-108135271 TCTTAGGCATTGGGGATGGAAGG - Intergenic
1031505172 7:122573296-122573318 CTTTGGGAGGTTGGGATGGGAGG + Intronic
1032015265 7:128375958-128375980 CTTTGGGAGGTGGAGGTGGATGG + Intergenic
1032833578 7:135652753-135652775 CCTTTGGGGTTGGGTAGGGAGGG + Intergenic
1033860688 7:145623092-145623114 CTTTGGGAGTTGGAGGTGGGTGG - Intergenic
1033988380 7:147254104-147254126 CCTGTGGAGTTGGGGGTGGAGGG - Intronic
1036063581 8:5353662-5353684 CCTTGGGAGGTGGAGGTGGGTGG - Intergenic
1036425170 8:8638715-8638737 GATTAGGAGTTGGGGAGGGAGGG + Intergenic
1036526377 8:9538625-9538647 CTTTGCAAGTTGTGGATGGATGG + Intergenic
1036641291 8:10585663-10585685 CCTTGGCAGCTGAGGATGGGAGG - Intergenic
1036783124 8:11663878-11663900 CTTTGGGAGGTGGAGATGGAGGG + Intergenic
1037624274 8:20593834-20593856 TCGGGGGAGTTGAGGATGGATGG + Intergenic
1038050277 8:23802699-23802721 CCATGGGAATTGGGAATGAAAGG - Intergenic
1038287363 8:26217528-26217550 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
1038571373 8:28665649-28665671 CTTTGGGAGGTTGAGATGGACGG - Intronic
1039521099 8:38172563-38172585 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1040040762 8:42914871-42914893 CTTTGGGAGGTGGAGATGGGCGG + Intronic
1040442329 8:47456761-47456783 CTTTGGGGGTTGGGGAAGGGTGG - Intronic
1040510332 8:48087747-48087769 CTTTGAGAGTTGGAGATGGGAGG + Intergenic
1040802416 8:51357976-51357998 ACTAGGGAGTCTGGGATGGAAGG + Intronic
1041307948 8:56482994-56483016 ACTTGGGAGTTGGAGGTGGGTGG + Intergenic
1041566544 8:59285090-59285112 CCTAGGGAGTTGGGTCTGGAAGG - Intergenic
1041881895 8:62761330-62761352 CCTGGGGAGGTGGGGGAGGACGG + Intronic
1042832601 8:73048403-73048425 CCTTGGGAGGTTGAGGTGGATGG - Intergenic
1043153230 8:76744654-76744676 CTTTGGGAGGTCGAGATGGACGG - Intronic
1044585805 8:93868419-93868441 CCTGTGGAGATGGGAATGGAGGG - Intronic
1044782653 8:95759119-95759141 GGATAGGAGTTGGGGATGGATGG + Intergenic
1044826132 8:96199185-96199207 GCTGGGGAGATGGGGAAGGAGGG - Intergenic
1044971781 8:97627008-97627030 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
1045539513 8:103069949-103069971 CCTTGGGAGGTGGAAATTGAGGG - Exonic
1046798980 8:118404089-118404111 ACTTGGGAGGTTGAGATGGAAGG - Intronic
1047375303 8:124290141-124290163 CCTTGGGAGGTTGAGGTGGAAGG + Intergenic
1047605712 8:126472235-126472257 GCTTGGAAGCTGGGGAAGGAGGG - Intergenic
1047663073 8:127059646-127059668 GCAGGGGAGTTGGGGATGGCAGG + Intergenic
1047940205 8:129822067-129822089 GCTTGGGAGTGGAGGAGGGAAGG + Intergenic
1048004388 8:130407338-130407360 TCTGGGCAGTTAGGGATGGAAGG - Intronic
1048401654 8:134076836-134076858 CCTTGGGAGGTTGAGGTGGAAGG + Intergenic
1049510047 8:143022719-143022741 CCGTAGGACTTGGGAATGGAGGG + Intronic
1050327171 9:4508918-4508940 CCTTGGGAGCTTGAGATGAAAGG + Intronic
1051206755 9:14696061-14696083 CCTTGGCAGCTTTGGATGGATGG + Intergenic
1051379516 9:16441193-16441215 ACTTGGGAGTTTGAGGTGGAAGG + Intronic
1051623994 9:19080822-19080844 CTCTGGGAGTTGGGGGTGGTGGG + Intronic
1052496434 9:29231095-29231117 GCTTGGGAGTGGGGAATGTAAGG - Intergenic
1052792613 9:32889819-32889841 GCTTGGGAGGGGGGTATGGAGGG + Intergenic
1052854326 9:33397740-33397762 GCATGGGAGCTGGGGTTGGATGG - Intronic
1052879821 9:33594483-33594505 CAGTGGGAGTTGGGGGTGGGGGG + Intergenic
1053031988 9:34788284-34788306 CCTTGGGAGGCTGAGATGGAAGG - Intergenic
1053152362 9:35751103-35751125 GCTAGGGAGTTGGGAAGGGAGGG + Intronic
1053398338 9:37795905-37795927 GCTTGGGAGTGGGGGTTGAAGGG + Intronic
1053496159 9:38549746-38549768 CAGTGGGAGTTGGGGGTGGGGGG - Intronic
1053682333 9:40493901-40493923 GCATGGGAGGTGGGGTTGGATGG - Intergenic
1053932315 9:43122227-43122249 GCATGGGAGGTGGGGTTGGATGG - Intergenic
1054281381 9:63131028-63131050 GCATGGGAGGTGGGGTTGGATGG + Intergenic
1054295433 9:63329401-63329423 GCATGGGAGGTGGGGTTGGATGG - Intergenic
1054393450 9:64633905-64633927 GCATGGGAGGTGGGGTTGGATGG - Intergenic
1054428100 9:65139119-65139141 GCATGGGAGGTGGGGTTGGATGG - Intergenic
1054502279 9:65882425-65882447 GCATGGGAGGTGGGGTTGGATGG + Intronic
1055222134 9:73948358-73948380 CTTTGGGAGTCGGAGATGGGCGG - Intergenic
1056007015 9:82283716-82283738 CCCAGGGAGTTGGGGATGATGGG - Intergenic
1056431827 9:86535524-86535546 GGTTGGGAGTGAGGGATGGAGGG - Intergenic
1056453850 9:86741694-86741716 CCCTGGTACTAGGGGATGGATGG + Intergenic
1056481071 9:87006954-87006976 TTCTGGGAGTTGGGGAAGGAAGG - Intergenic
1056517914 9:87372431-87372453 CTGTGGGAGGTGGGGTTGGAAGG - Intergenic
1056586271 9:87929560-87929582 CAGTGGGAGTTGGGGGTGGGGGG - Intergenic
1056610611 9:88123383-88123405 CAGTGGGAGTTGGGGGTGGGGGG + Intergenic
1056837786 9:89971311-89971333 ACTTAGGAGATGGGGAAGGAAGG + Intergenic
1057113290 9:92495099-92495121 CTTTGTGAAGTGGGGATGGAAGG + Intronic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057774939 9:98000220-98000242 CTTTGGGAGGTCGAGATGGAAGG - Intronic
1059175890 9:112169916-112169938 CTTTGGGAGATTGGGGTGGATGG - Intronic
1059383378 9:113945858-113945880 ATTTGGGATTTGGGGATGAAAGG + Intronic
1059473846 9:114527952-114527974 GCTGGGGAGTTGGGGGTGGCTGG + Intergenic
1060811528 9:126613623-126613645 ATTTGGGAGTTGGGGAGCGAAGG - Intergenic
1061079292 9:128360617-128360639 ACTTGGCAGTTTTGGATGGAGGG - Exonic
1185662196 X:1736306-1736328 CTTTGGGAGGTTGAGATGGAAGG - Intergenic
1185878131 X:3715720-3715742 CCCTGTGAGTTAGGCATGGAAGG + Intergenic
1186355643 X:8787163-8787185 CCTTGGGAGTCTGAGATGGGAGG + Intergenic
1186402103 X:9269507-9269529 CCATGGGCGGTGGGCATGGAGGG + Intergenic
1186515071 X:10160891-10160913 CCTTGGCTGTTGGGGAGGGACGG + Intronic
1186559915 X:10600463-10600485 ACTTGGGGGTTGGGGAAGGTGGG + Intronic
1187362932 X:18644824-18644846 TCTTGGGAGGTGGAGATGCAGGG - Intronic
1187878570 X:23825126-23825148 ACTTGGGAGTCTGAGATGGAAGG - Intergenic
1188002491 X:24995373-24995395 TCTGGGGAGTTGGGGCTGGAAGG + Intronic
1188003161 X:25000913-25000935 CATGGGTAGTTGGTGATGGAAGG + Intergenic
1189212832 X:39299308-39299330 TGTGGGGTGTTGGGGATGGAGGG - Intergenic
1189774316 X:44456499-44456521 CCTTGGGAGGTTGGGATAGAAGG - Intergenic
1191931642 X:66379928-66379950 TCTTGTGAGTTGGGGCTGGGTGG + Intergenic
1192534298 X:71914067-71914089 GTGTGGGAGATGGGGATGGAAGG + Intergenic
1194292917 X:92097301-92097323 ACTTGGGAGGTTGAGATGGAAGG + Intronic
1194518419 X:94888154-94888176 CCTGGGGATTTGGAGATGCAAGG + Intergenic
1195067470 X:101250592-101250614 ACTGGGGAGTGGGGGAGGGAAGG + Intronic
1195528024 X:105916428-105916450 TATTGTGAGTTGGGGCTGGAGGG - Intronic
1195683082 X:107563255-107563277 CCTTGGGTGTGGGGGCAGGAGGG + Intronic
1196574504 X:117302409-117302431 CCTTGGGAGTTGAGTATTGCTGG + Intergenic
1198823734 X:140677120-140677142 TCTTGTGAGTTGGGGTTAGAGGG + Intergenic
1199401225 X:147401248-147401270 CTCGGGGAGTTGGGGATTGATGG - Intergenic
1199661496 X:150054846-150054868 ACTGGGGAGTGGGGGATTGAGGG + Intergenic
1199940307 X:152619716-152619738 TGTTGGTAGTTGGGGCTGGAAGG + Intergenic
1200039669 X:153355992-153356014 CCTGGGGAGTTGGGGAGTGGAGG - Intronic
1200071073 X:153529702-153529724 GCTGGGGAGTTGGGGTTGAACGG - Intronic
1200106373 X:153715523-153715545 CCTTGTGAGTGGGGGGTTGAGGG - Exonic
1200420475 Y:2960242-2960264 CCTTGGGATTTGGGGTTAGTGGG + Intronic
1200610423 Y:5321853-5321875 ACTTGGGAGGTTGAGATGGAAGG + Intronic
1201382918 Y:13403797-13403819 GCTTGGGAGTCTGAGATGGAAGG + Intronic
1201675775 Y:16582740-16582762 CATAGGGAGTTGGAGATGTAGGG - Intergenic