ID: 906201334

View in Genome Browser
Species Human (GRCh38)
Location 1:43962293-43962315
Sequence GCCACGGAGGTGGGTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906201334_906201340 -5 Left 906201334 1:43962293-43962315 CCACTTCTACCCACCTCCGTGGC 0: 1
1: 0
2: 2
3: 27
4: 250
Right 906201340 1:43962311-43962333 GTGGCCACTGCCTCAGTTTAGGG 0: 1
1: 0
2: 0
3: 14
4: 110
906201334_906201345 27 Left 906201334 1:43962293-43962315 CCACTTCTACCCACCTCCGTGGC 0: 1
1: 0
2: 2
3: 27
4: 250
Right 906201345 1:43962343-43962365 GATTATCAGCAACCTTCTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 78
906201334_906201343 5 Left 906201334 1:43962293-43962315 CCACTTCTACCCACCTCCGTGGC 0: 1
1: 0
2: 2
3: 27
4: 250
Right 906201343 1:43962321-43962343 CCTCAGTTTAGGGTCTCACCTGG 0: 1
1: 0
2: 8
3: 33
4: 215
906201334_906201339 -6 Left 906201334 1:43962293-43962315 CCACTTCTACCCACCTCCGTGGC 0: 1
1: 0
2: 2
3: 27
4: 250
Right 906201339 1:43962310-43962332 CGTGGCCACTGCCTCAGTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 152
906201334_906201346 28 Left 906201334 1:43962293-43962315 CCACTTCTACCCACCTCCGTGGC 0: 1
1: 0
2: 2
3: 27
4: 250
Right 906201346 1:43962344-43962366 ATTATCAGCAACCTTCTAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906201334 Original CRISPR GCCACGGAGGTGGGTAGAAG TGG (reversed) Intronic
900616674 1:3568619-3568641 GCAACAGAGGTGGCTCGAAGGGG - Intronic
901490751 1:9595170-9595192 ACCAATGAGGTGGGTAGAGGGGG + Intronic
901930321 1:12592944-12592966 GCCGTGGAGGTGGCGAGAAGTGG - Intronic
903977910 1:27163389-27163411 GCCATAGAGCTGGGAAGAAGAGG + Intronic
904290504 1:29482759-29482781 GCCAAGGAGGGCGGGAGAAGTGG - Intergenic
904688176 1:32275294-32275316 GCCACGGAGGTGGGTCAGTGTGG - Intronic
906201334 1:43962293-43962315 GCCACGGAGGTGGGTAGAAGTGG - Intronic
907076916 1:51587407-51587429 GTCATGGAGGTGGGTGGAAATGG - Intronic
909579467 1:77218134-77218156 GCCCAGGTGGTGGGGAGAAGAGG + Intronic
910090994 1:83464096-83464118 GCTAAGGAGGTGGGAGGAAGAGG + Intergenic
910217162 1:84854184-84854206 GCCAGGGCCGTGGGTAGAAAGGG - Intronic
911461255 1:98194005-98194027 GCAAGGGAGGTGAGTAGAAGTGG + Intergenic
913169817 1:116221953-116221975 GCCAGGGAGGAGGGTTGAAGGGG + Intergenic
915453088 1:156020554-156020576 GCCAAGGAGGAGGGGAGCAGCGG - Intronic
915568439 1:156730002-156730024 GCAACGGAGGTGGGGACAAATGG - Intronic
917804967 1:178605347-178605369 GCCAGGCAGGTAGGTAGAAGTGG - Intergenic
917813842 1:178687465-178687487 GCCACAGAGATGGGTTCAAGGGG + Intergenic
918323877 1:183391286-183391308 GACAGGTAGGTGGATAGAAGTGG - Intronic
919974684 1:202602933-202602955 GCCTGGGAGTTGGGTGGAAGGGG - Intronic
920088320 1:203434125-203434147 GCCATGGGGATGGCTAGAAGTGG - Intergenic
921588152 1:216973010-216973032 GACATGGAGGTGGGGAGAAGTGG - Intronic
921945003 1:220880131-220880153 ACCACTGGGGTGGGTCGAAGCGG - Exonic
922178397 1:223215043-223215065 GGCGGGGAGGTGGGTAGAAGGGG - Intergenic
922461377 1:225816715-225816737 GCCACGGAGGCCTGGAGAAGTGG + Intronic
922556224 1:226534374-226534396 GTCACGCAGCTGGGTGGAAGTGG + Intergenic
922920208 1:229295482-229295504 GCCAGGGAGTGGGGTAGATGAGG + Intronic
923623826 1:235598181-235598203 GTCATGGAGGTGGGTAGAGCAGG - Intronic
923881747 1:238111137-238111159 GCCACGGGGATGGTGAGAAGAGG + Intergenic
1062958925 10:1558395-1558417 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1062958944 10:1558454-1558476 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1062958989 10:1558631-1558653 CCCACGGAGGGGGGCAGAGGTGG - Intronic
1063474152 10:6313944-6313966 GCCAAGGTGGTGGGCAGAGGAGG + Intergenic
1065290105 10:24221264-24221286 GCCAGTGAGGTCGGTAGAGGAGG - Intronic
1067343324 10:45421223-45421245 GCCACAGATGTAGGAAGAAGTGG - Intronic
1067816071 10:49477665-49477687 AGCAAGGAGGAGGGTAGAAGAGG - Intronic
1068710398 10:60127375-60127397 GCCACGGAAATGGGTATATGTGG + Intronic
1069579390 10:69554961-69554983 ACCAGGGAGGTGGGGAGAAGTGG - Intergenic
1069617618 10:69816192-69816214 GTCATGGAGGTGGTGAGAAGGGG + Intronic
1069634048 10:69914524-69914546 GAAATGGAGGTGGGAAGAAGAGG + Intronic
1069722716 10:70559978-70560000 CCCAGGGCGGTGGGGAGAAGGGG + Intronic
1069781771 10:70961434-70961456 GACATGGAGGTGGCCAGAAGCGG - Intergenic
1069855855 10:71440655-71440677 CCCACGGAGGAGGGTAGGAGAGG + Intronic
1070790269 10:79185051-79185073 GGCAGTGAGGTGGGTAGGAGAGG - Intronic
1072500716 10:96014998-96015020 GCCAGGGAGGTGGGGATAAGGGG - Intronic
1072743181 10:97922505-97922527 GCCAAGGAGGTGGGTGGCAGGGG + Intronic
1072784445 10:98270098-98270120 GCCAGGCAGGAGGGAAGAAGAGG - Intergenic
1072800968 10:98392245-98392267 GCCTCACAGGTGGGGAGAAGGGG - Intronic
1073300040 10:102465632-102465654 GCCAGGGAGGTGGGTGGAGTTGG + Intronic
1074562788 10:114548918-114548940 GTCACGGATGTGGTCAGAAGAGG - Intronic
1074929256 10:118106822-118106844 GGCACGGTGTTGGGTAGAAATGG + Intergenic
1075764191 10:124879643-124879665 TCCACTGGGGTGGGTAGAGGTGG - Intergenic
1076593328 10:131607109-131607131 GCCAAGGAGGTGGTGAGAAAAGG + Intergenic
1076751910 10:132547514-132547536 GCCAGGCAGGTGGGCAGAGGCGG - Intronic
1077018723 11:408037-408059 CCCAAGGTGGAGGGTAGAAGGGG - Intronic
1077162225 11:1119057-1119079 GCCTGGGAGCTGGGTAGTAGGGG + Intergenic
1077332965 11:1991334-1991356 GCCAGGGAGCGGGGTAGAGGGGG + Intergenic
1079372859 11:19866769-19866791 GTCACGGAGGTGGGCTGACGAGG - Intronic
1081199163 11:40195492-40195514 GGCAAGGATGTGGGTAGCAGAGG + Intronic
1081673616 11:44955552-44955574 GCCACAGAGCCGGTTAGAAGAGG - Intergenic
1081982489 11:47276828-47276850 GCCATGCAGGTGGGTAGCAGCGG - Exonic
1082726869 11:56746835-56746857 GCAGTGGAGGTGGGGAGAAGTGG - Intergenic
1083147440 11:60769827-60769849 GCCATGGGGGTGGGAAGAAGCGG - Intronic
1083618599 11:64038096-64038118 GCCTCGGAGATGGGGAGGAGGGG - Intronic
1083704525 11:64504825-64504847 GCCATGGAGATGGGAAGAAGTGG + Intergenic
1084148134 11:67275726-67275748 GCCAGGGGGGTCGGTAGACGTGG - Intronic
1084605458 11:70169392-70169414 GCCACAGATGTGGATAGATGGGG + Intronic
1085027523 11:73245239-73245261 GCAATGGAGGTGGGGAGAAGTGG + Intergenic
1086673455 11:89574662-89574684 GCCACGCAGGTACTTAGAAGTGG - Intergenic
1087176960 11:95104995-95105017 GGCATGGAGGTGGGTGGGAGAGG + Intronic
1088163622 11:106905072-106905094 GGCACTGAGGTGGCTAGAAAAGG + Intronic
1088676374 11:112197606-112197628 GCCATGGAGGTGGTGTGAAGTGG - Intronic
1089126682 11:116181202-116181224 GGCACTGAGGAGGGAAGAAGGGG - Intergenic
1089710370 11:120310205-120310227 GCCATGGAGGTGAGGAGGAGTGG + Intronic
1090160185 11:124484411-124484433 GCCAGGGAGAGGGGTAGAAAAGG + Intergenic
1090335139 11:125957142-125957164 GGAAGGGAGGTGGGTAGGAGAGG - Exonic
1090479413 11:127055039-127055061 GGCATGCAGGTGGGAAGAAGAGG + Intergenic
1202815948 11_KI270721v1_random:46510-46532 GCCAGGGAGCGGGGTAGAGGGGG + Intergenic
1091916533 12:4274513-4274535 GCGAGGGGGGTGGGAAGAAGAGG - Intronic
1096229878 12:49890880-49890902 GCCTCTGAGGTAGGGAGAAGGGG - Intronic
1099889587 12:88574472-88574494 GACACGGAGGTGGAAAGAGGAGG - Intronic
1101694456 12:107111803-107111825 TCCATGGAGGAGGGTGGAAGAGG - Intergenic
1102013436 12:109632790-109632812 GCCGTGGAGGTGGGCAGGAGAGG + Intergenic
1102112594 12:110376016-110376038 GCCACTGAGGAGGGTAGAGGAGG - Intronic
1104673398 12:130695795-130695817 GCAGGGGAGGTGGGAAGAAGAGG + Intronic
1105812703 13:24008883-24008905 GCCAAGGAGGAGGGAAGAGGGGG + Intronic
1105859387 13:24395459-24395481 TCCAGGGAGGTGCGCAGAAGGGG - Intergenic
1106551213 13:30772655-30772677 GCAAAGGAGGTGGGTTGCAGGGG + Intergenic
1106776086 13:33011167-33011189 AGCAGGGAGATGGGTAGAAGAGG + Intergenic
1107414922 13:40191583-40191605 GCCATGGGGGTTGGAAGAAGGGG - Intergenic
1108397676 13:50005947-50005969 GCCGCCGAGGTGGGCAGATGAGG - Intronic
1109322246 13:60825620-60825642 GCAACGGAGGAGGGAAGTAGGGG - Intergenic
1111564057 13:89991608-89991630 GACTCGGACGTGGGTGGAAGTGG - Intergenic
1112423522 13:99275636-99275658 ACCTGGGGGGTGGGTAGAAGAGG - Intronic
1112509650 13:99997945-99997967 ACCCCGGAAGTGGGTAGAGGCGG - Intergenic
1117478431 14:56119180-56119202 GCGAGGGAGGTGGGAAGACGGGG - Intronic
1119003959 14:70907738-70907760 GCTCCGGAGGTGGATAGACGGGG + Exonic
1120860928 14:89254396-89254418 GTAAGGGAGGTGGGGAGAAGGGG + Intronic
1121303240 14:92888610-92888632 GCCATGGAGGTGGAGAAAAGTGG + Intergenic
1121383969 14:93500152-93500174 GCCACGGGGATGGGTGGAAGTGG - Intronic
1121867241 14:97374025-97374047 GCCACTGTGGTGGGTGGATGAGG - Intergenic
1122082847 14:99278521-99278543 GCCGGCGGGGTGGGTAGAAGCGG - Intergenic
1122810841 14:104287220-104287242 GCCTGGGAGGTGGCTTGAAGGGG - Intergenic
1123873261 15:24597454-24597476 GCCAAGGGGGTGGGTTTAAGGGG + Intergenic
1124234570 15:27977817-27977839 GGCAGGGAGGCGGGGAGAAGAGG - Intronic
1126131781 15:45348739-45348761 GCAACCGAGGTGGCAAGAAGTGG + Intergenic
1128484375 15:68070439-68070461 GCCTCGGAAGTGGGTAGCTGAGG + Intronic
1128514447 15:68333696-68333718 GCCATGGGGGTGGGCTGAAGGGG - Intronic
1128700735 15:69802418-69802440 GCCAGGGAGCTCAGTAGAAGAGG - Intergenic
1132549500 16:548516-548538 GCCACGGTGGAGGGTTGAGGGGG - Intronic
1132654777 16:1037242-1037264 GACACGGAGGTGGGGGGCAGGGG - Intergenic
1135277911 16:21129157-21129179 GTCACGGAGGTGGGTAGGAGAGG - Intronic
1140696455 16:77539045-77539067 GAAACAGAGGGGGGTAGAAGTGG - Intergenic
1142607964 17:1092390-1092412 GCCACGGGGGTGGGCTGCAGTGG - Intronic
1144830868 17:18130553-18130575 GCCATGGGGGTGGGGAGAAGAGG + Intronic
1145878344 17:28336203-28336225 GCCGCGGAGGTGGAAAGAGGAGG - Intronic
1148887903 17:50786831-50786853 GCAGCGGAGGTGGGGAGAAGAGG - Intergenic
1149557642 17:57585547-57585569 CCCACTGAGGTGGGTGGAAAAGG - Intronic
1150861822 17:68808283-68808305 GCCACCCAGGTGGCTGGAAGTGG + Intergenic
1151228481 17:72664521-72664543 GCCATGGAAGAGGGGAGAAGTGG - Intronic
1151556607 17:74849947-74849969 GCCACGGAGGTTTGAAAAAGGGG + Intronic
1152028215 17:77825343-77825365 GCAAAAGAGGTGGGAAGAAGGGG + Intergenic
1152298932 17:79484442-79484464 GCCAGGGAGGTGGCTGGGAGAGG + Intronic
1153564928 18:6409992-6410014 GGCATGGAAGTGGGTAGAAGTGG - Intronic
1154317437 18:13315993-13316015 GCCACGGAGATGTGGAGAAAAGG + Intronic
1154486741 18:14877967-14877989 GCGATGCAGGTGGGTAGCAGGGG - Intergenic
1156310789 18:35919727-35919749 GCCATGGAGATGGTGAGAAGTGG + Intergenic
1157088453 18:44606854-44606876 CCCATGGAGTTGGGCAGAAGAGG - Intergenic
1157411745 18:47468964-47468986 GCTAAGGATGTGGGTAGATGGGG - Intergenic
1159840624 18:73394589-73394611 GTCTCCCAGGTGGGTAGAAGAGG + Intergenic
1161486582 19:4539032-4539054 GCCGCAGAGATGGGAAGAAGTGG - Intronic
1161864146 19:6821739-6821761 GCCTGGGGGCTGGGTAGAAGTGG - Intronic
1161957689 19:7505775-7505797 GCCACGGAGGAGGATCGGAGTGG - Intronic
1162105448 19:8367178-8367200 AGCACGGAGGTGGGAAGGAGCGG - Intronic
1162342438 19:10099621-10099643 GCCTGGGAGGAGGGCAGAAGGGG - Intronic
1162391856 19:10394860-10394882 GCCAGGGAGGAGGAGAGAAGTGG - Intronic
1163189197 19:15664062-15664084 GCCATGGAGGTGGGTAAAGGAGG - Intergenic
1163757575 19:19115539-19115561 GCCACAGTGGTGGGTGGGAGAGG - Intergenic
1165357229 19:35311738-35311760 GCCACAGAGGTGGGAAGGATGGG + Intronic
1165881305 19:39045940-39045962 GCCAGGGAGGTGGTAGGAAGAGG + Intergenic
1167648476 19:50718070-50718092 GCCATGGAGATGGGAAGCAGTGG + Intronic
1167649160 19:50719967-50719989 GACTCGGAGGTGGGGAGGAGTGG - Intergenic
926363209 2:12109708-12109730 GCCCCAGAGGAGGGTAGACGTGG - Intergenic
927464614 2:23327798-23327820 GCCAGGGAGCTGGGAACAAGAGG + Intergenic
928559449 2:32464062-32464084 GCCACGGATGCGGGGAGATGTGG - Intronic
928922451 2:36539658-36539680 GCCGTGGAGGTGGGGAGAAGTGG + Intronic
930246870 2:48992475-48992497 GCCAGGGAAGTGGGGAGGAGTGG + Intronic
931246646 2:60498008-60498030 CCCATGGAGGTGGGGAGATGAGG + Intronic
931456373 2:62412568-62412590 ACCCCAGAGGTGTGTAGAAGAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
933663566 2:84946614-84946636 ACCACGGAGGTGAGTGCAAGTGG - Intergenic
935752575 2:106249994-106250016 GGCAGGGAGGTGGGGAGAATAGG + Intergenic
935912995 2:107917539-107917561 GGCAGGGAGGTGGGGAGAATGGG + Intergenic
936159354 2:110072010-110072032 GACACGGAGGTGCCTGGAAGAGG - Intergenic
936185307 2:110299322-110299344 GACACGGAGGTGCCTGGAAGAGG + Intergenic
937422901 2:121773278-121773300 GCCCCGGAGGTGGGCATGAGTGG + Intergenic
938577837 2:132620534-132620556 GCCACGCAGGGGGGAAGGAGGGG - Intronic
939529327 2:143337273-143337295 GCTAGGGAGGTGGGAGGAAGGGG + Intronic
941543463 2:166815901-166815923 GCAACGTAGGTGGGGAGAGGTGG - Intergenic
946291285 2:218747398-218747420 GCCAAGGAGGTGGGAGGATGGGG - Intronic
1171177189 20:23061382-23061404 GCCAGGCCTGTGGGTAGAAGAGG - Intergenic
1172477205 20:35247911-35247933 GACAGGGAGGTGGGGAGAAATGG + Intronic
1172845861 20:37929713-37929735 GCAGTGGAGGTGGGGAGAAGGGG + Intronic
1174109603 20:48189442-48189464 ACCACGGAGCTGGGGAGATGGGG + Intergenic
1174402373 20:50282951-50282973 GCCGTGGAGGTGGGGAGACGAGG - Intergenic
1174414847 20:50359882-50359904 GCCAGGGAGGTGAGGAGATGTGG + Intergenic
1175516546 20:59574067-59574089 GGCACGGAGGAGGATGGAAGTGG - Intergenic
1175529426 20:59664294-59664316 GCCATGGAGGTGGGTTGCTGGGG - Intronic
1175597830 20:60249592-60249614 GCCACGGAGGTGAGGAGCACAGG - Intergenic
1176794561 21:13361432-13361454 GCGATGCAGGTGGGTAGCAGGGG + Intergenic
1177809131 21:25905949-25905971 GCCACGGAGGTAGGTGCAGGGGG + Intronic
1178911160 21:36674724-36674746 TCCAAAGAGGTGGGAAGAAGGGG - Intergenic
1178913259 21:36693217-36693239 GCCAGGCAGGTGGGCGGAAGGGG - Intergenic
1179183362 21:39063355-39063377 GCCACGGATGTGAGTAGTGGCGG + Intergenic
1179636312 21:42712771-42712793 GCTACTGAGGTGGGTTGAGGAGG + Intronic
1180041645 21:45283268-45283290 CCCACGGTGGTGGGGAGGAGTGG + Intronic
1181083008 22:20426365-20426387 GCCAAGGGCGTGGGTAGAGGAGG - Intronic
1181456228 22:23061606-23061628 GCCACTGTGCTGGGGAGAAGAGG + Intronic
1182145126 22:27992836-27992858 CCCAGGAAGGTGGGTGGAAGTGG + Intronic
1183121256 22:35731830-35731852 GCAACAGAGGTGGTGAGAAGTGG + Intergenic
1183505010 22:38203811-38203833 GGCAGGATGGTGGGTAGAAGGGG + Intronic
1183706635 22:39478513-39478535 ACCACGGAGGTGGGTGGCAGGGG + Intronic
1183753112 22:39733434-39733456 GCCAGGCAGATGGGAAGAAGGGG - Intergenic
1184148596 22:42625693-42625715 GTCACGGAGGAAGGTAGGAGAGG + Intronic
1184345586 22:43910649-43910671 GACACGAAGGTGGGTGGGAGTGG - Intergenic
1184609118 22:45591125-45591147 GCCACAGAGCTTGGTGGAAGGGG + Intronic
949165162 3:931598-931620 GCCATGGAGGTGGGGAGAAGTGG - Intergenic
949525246 3:4896933-4896955 GTGACTGAGGTGGGTATAAGGGG - Intergenic
950219030 3:11180313-11180335 TCCACGGACGGGGGTTGAAGGGG + Intronic
950660002 3:14461405-14461427 GGCACGGGGGTGGGCACAAGAGG - Intronic
950972669 3:17204194-17204216 GCCACTGAGGGGGAAAGAAGAGG + Intronic
951312922 3:21151590-21151612 GACATGGAGGTGGGAGGAAGTGG - Intergenic
952839353 3:37631002-37631024 GACAGGGAAGTGGGGAGAAGAGG + Intronic
952886995 3:38018080-38018102 GTCATGGGGGTGGGTAGTAGTGG + Intronic
953435642 3:42875129-42875151 GCCCCGGGAGTGGCTAGAAGTGG - Exonic
953492887 3:43365043-43365065 GCCACGGGGGAGGGTGGATGTGG - Intronic
953801229 3:46024165-46024187 GCCACAGAAGAGGGGAGAAGAGG + Intronic
954134459 3:48575612-48575634 GGCAAGGAGGTGAGCAGAAGTGG - Exonic
955161189 3:56467262-56467284 GCCACTTACGTGGGTAGAATGGG - Intronic
955324637 3:58000632-58000654 CCCACTCAGGTGGGAAGAAGAGG - Intergenic
962040593 3:131703477-131703499 CCCACGGATCTGGGGAGAAGTGG + Intronic
962700247 3:137991299-137991321 GGAACTGAGGTGGGTAGAAGTGG - Intergenic
964445431 3:156752730-156752752 GGAGCGGAGGTGGGTAGAGGAGG + Intergenic
964863582 3:161229344-161229366 GCAATGGAGGTGGTAAGAAGTGG + Intronic
965275720 3:166679322-166679344 GCCATGGAGGTAGAGAGAAGTGG - Intergenic
966740387 3:183227351-183227373 GTCTGGGAGGTGGGAAGAAGGGG + Intronic
967336246 3:188347853-188347875 GAAATGGAGGTGGTTAGAAGGGG + Intronic
968528029 4:1074415-1074437 GCCAGGAAAGTGGGTAGCAGAGG - Intronic
969465050 4:7351348-7351370 GCCACGGGGATGGGGAGAGGAGG - Intronic
972767819 4:42168011-42168033 GCAACTGAGGTGGGGAGAAATGG - Intergenic
975851504 4:78577675-78577697 GCCACGGAAGTGTGTAGATGAGG + Intronic
983289338 4:165782127-165782149 GACACTAAAGTGGGTAGAAGAGG - Intergenic
984112958 4:175643100-175643122 GCAAGGGAGGTGGGAAGAATCGG - Intronic
984592925 4:181636642-181636664 GCAGCAGAGGTGGGGAGAAGTGG - Intergenic
985297715 4:188453713-188453735 GCTACTGAGGTGGGTAGGACTGG - Intergenic
985682943 5:1265928-1265950 ACCACGGAGATGGCTAGGAGTGG - Intronic
986364310 5:7015774-7015796 GCCAGGGAGGTGGGTAAAGCAGG + Intergenic
993867120 5:93209116-93209138 GCAACAGAATTGGGTAGAAGGGG - Intergenic
994083454 5:95732150-95732172 CTCACGGAAGTGGGCAGAAGGGG - Intronic
995231950 5:109775544-109775566 GCCATGGATATGGGGAGAAGGGG - Intronic
997062335 5:130521926-130521948 GTAATGGAGGTGGGGAGAAGTGG + Intergenic
999570051 5:152909622-152909644 GCCCAGAAGGTGGGGAGAAGAGG - Intergenic
999807304 5:155094273-155094295 GCCTGGGGGGTGGGTAGAGGTGG + Intergenic
1001537557 5:172508758-172508780 GCCATGGTGGTGGGAAGAGGGGG + Intergenic
1001775712 5:174327785-174327807 CCCAGGGAGATGGGTAGAGGAGG + Intergenic
1002090598 5:176803233-176803255 GCCATGGAGCAGGGTAGAAGTGG + Intergenic
1005477316 6:26220270-26220292 ACCATGGAGGAGGGTGGAAGAGG - Intergenic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1006593831 6:35178219-35178241 TCCATGCAGGTGAGTAGAAGGGG + Intergenic
1007358767 6:41340998-41341020 GTCCAGGAGGTGGGGAGAAGGGG - Intronic
1007450079 6:41935874-41935896 GGCAGGGAGGTGGGTGGCAGCGG + Exonic
1008192891 6:48481858-48481880 TCCACGGATGGGGGTAGAGGTGG + Intergenic
1008893875 6:56529080-56529102 GCCACAGAGGTGAAAAGAAGAGG - Intronic
1011410180 6:87059633-87059655 GCCAGGGAGGTGGGGGGAGGGGG + Intergenic
1011913489 6:92472008-92472030 GGCTAGGAGGTGGGAAGAAGGGG + Intergenic
1016976739 6:149816070-149816092 GCCAGGGAGGTGGAAAGATGAGG - Intergenic
1020164323 7:5796353-5796375 GCAAGGGAGGAGGGTAGGAGAGG - Intergenic
1021519885 7:21528514-21528536 GCCACGGGGGTGAGTAGCTGAGG - Intergenic
1023967238 7:44969382-44969404 GCCAGGGATGTGGGTGGGAGGGG + Intronic
1024211793 7:47212524-47212546 TCGATGGATGTGGGTAGAAGTGG - Intergenic
1025255637 7:57382316-57382338 GCCAGGGAGGTGAGGAGATGTGG - Intergenic
1025811305 7:64877366-64877388 ACCACGGAGATGGCCAGAAGAGG + Intronic
1025852160 7:65252338-65252360 GCCGCGGCGGCGGGGAGAAGAGG - Intergenic
1026642400 7:72139305-72139327 GTGGCTGAGGTGGGTAGAAGAGG - Intronic
1026642429 7:72139425-72139447 GTGGCTGAGGTGGGTAGAAGAGG - Intronic
1028419877 7:90620906-90620928 GCCACTGTGATGGGCAGAAGTGG - Intronic
1029372105 7:100156831-100156853 GCCAAGGAGGTGAGCATAAGGGG - Exonic
1030443900 7:109624838-109624860 GCCATGGAGCTGGGGAGAGGAGG + Intergenic
1031049911 7:116934711-116934733 GGGACGGAGGAGGGAAGAAGGGG - Intergenic
1031070711 7:117158168-117158190 GTCACTGAGGCAGGTAGAAGTGG + Intronic
1033668322 7:143464891-143464913 GTAATGGTGGTGGGTAGAAGTGG + Intergenic
1034732621 7:153400964-153400986 GCCACGGAGCTGGGCAGGAGCGG - Intergenic
1036966306 8:13301905-13301927 TCCACGGAGTTGGGTAGGGGAGG - Intronic
1037905325 8:22712995-22713017 GACACGGAGGTAGGAAGAAGTGG - Intergenic
1038220590 8:25603377-25603399 GCCAAGGTGGTGTGGAGAAGGGG + Intergenic
1041157569 8:55004293-55004315 GCCAGGCAGGTGGGTACAGGTGG - Intergenic
1042452527 8:68965376-68965398 AACAAGGAGGTGAGTAGAAGCGG - Intergenic
1048599986 8:135909652-135909674 GCCAGGCAGGTGTGGAGAAGGGG - Intergenic
1048868719 8:138780076-138780098 GCCACAGAAGTGAGTAGGAGTGG - Intronic
1051144688 9:14014320-14014342 GCCATGGGGATGGGTAGGAGTGG - Intergenic
1053105443 9:35404350-35404372 GGCATGGAGATGGGTAGAGGTGG - Exonic
1053887673 9:42656744-42656766 GCGATGCAGGTGGGTAGCAGGGG - Intergenic
1054226694 9:62464194-62464216 GCGATGCAGGTGGGTAGCAGGGG - Intergenic
1057215577 9:93226625-93226647 ACCTCTGGGGTGGGTAGAAGTGG - Intronic
1058349077 9:103999714-103999736 GCCACGGAGCTGCGTAGATCCGG + Intergenic
1059309152 9:113376728-113376750 GCCCTGGAGGTGGGGAGAAAAGG - Intronic
1060480253 9:124013196-124013218 GCCGCGGAGGTGGGGAGCACGGG + Intronic
1061220024 9:129245170-129245192 GCGGGGGAGGTGGGCAGAAGAGG - Intergenic
1061779902 9:132989322-132989344 CCCAGGGAGGTGGGTACTAGGGG - Intronic
1062026881 9:134344598-134344620 GCCCGGGAGGTGGGGAGGAGAGG - Intronic
1062071114 9:134555500-134555522 GCCACAGAGCTGGGCAGAGGGGG + Intergenic
1187967592 X:24627770-24627792 GCAGCGGAGGTGGTAAGAAGTGG + Intronic
1187989964 X:24859575-24859597 GCCACAGAGGTGTGTACAAAAGG - Intronic
1191920540 X:66252063-66252085 GCAGTGGAGATGGGTAGAAGTGG + Intronic
1192246803 X:69379551-69379573 GTCAGGCAGGTGGGTGGAAGTGG - Intergenic
1192384452 X:70652054-70652076 TCCAGGGATGTGGGTAGGAGTGG - Intronic
1198581028 X:138064451-138064473 TCCAGTGAGGTGGGTGGAAGTGG + Intergenic
1199551543 X:149066732-149066754 GTGACAGAGGTGGCTAGAAGTGG - Intergenic
1199991798 X:152991681-152991703 GCCACGTAGGAAGGCAGAAGTGG + Exonic
1200080011 X:153571657-153571679 GCTCCGGAGGTGGGGAGGAGGGG - Intronic
1200931521 Y:8701310-8701332 ACCACGGAGGTGGCCAGAAGGGG - Intergenic