ID: 906202663

View in Genome Browser
Species Human (GRCh38)
Location 1:43970158-43970180
Sequence TCCATGAGGCACAGCTTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906202663_906202668 6 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202668 1:43970187-43970209 GTTTAGCAGCCCTGCCGAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 72
906202663_906202667 3 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202667 1:43970184-43970206 GATGTTTAGCAGCCCTGCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 58
906202663_906202673 26 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG 0: 1
1: 0
2: 1
3: 7
4: 88
906202663_906202674 27 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202663_906202672 25 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202672 1:43970206-43970228 GCGGCGCTGCAGCGAGAGACCGG 0: 1
1: 1
2: 4
3: 30
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906202663 Original CRISPR TCCATGAGGCACAGCTTGGG TGG (reversed) Exonic