HTGT WGE

Individual CRISPR Summary

ID: 906202666

 View in Genome Browser
Species Human (GRCh38)
Location 1:43970172-43970194
Sequence TGCTAAACATCGACTCCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906202666_906202668 -8 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202668 1:43970187-43970209 GTTTAGCAGCCCTGCCGAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 72
906202666_906202675 20 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154
906202666_906202672 11 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202672 1:43970206-43970228 GCGGCGCTGCAGCGAGAGACCGG 0: 1
1: 1
2: 4
3: 30
4: 94
906202666_906202673 12 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG 0: 1
1: 0
2: 1
3: 7
4: 88
906202666_906202674 13 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906202666 Original CRISPR TGCTAAACATCGACTCCATG AGG (reversed) Exonic