ID: 906202674

View in Genome Browser
Species Human (GRCh38)
Location 1:43970208-43970230
Sequence GGCGCTGCAGCGAGAGACCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906202664_906202674 24 Left 906202664 1:43970161-43970183 CCCAAGCTGTGCCTCATGGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202663_906202674 27 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202666_906202674 13 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202665_906202674 23 Left 906202665 1:43970162-43970184 CCAAGCTGTGCCTCATGGAGTCG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202661_906202674 30 Left 906202661 1:43970155-43970177 CCACCACCCAAGCTGTGCCTCAT 0: 1
1: 0
2: 1
3: 25
4: 254
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906202674 Original CRISPR GGCGCTGCAGCGAGAGACCG GGG Exonic