ID: 906202674

View in Genome Browser
Species Human (GRCh38)
Location 1:43970208-43970230
Sequence GGCGCTGCAGCGAGAGACCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906202663_906202674 27 Left 906202663 1:43970158-43970180 CCACCCAAGCTGTGCCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202664_906202674 24 Left 906202664 1:43970161-43970183 CCCAAGCTGTGCCTCATGGAGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202666_906202674 13 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202665_906202674 23 Left 906202665 1:43970162-43970184 CCAAGCTGTGCCTCATGGAGTCG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140
906202661_906202674 30 Left 906202661 1:43970155-43970177 CCACCACCCAAGCTGTGCCTCAT 0: 1
1: 0
2: 1
3: 25
4: 254
Right 906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG 0: 1
1: 0
2: 1
3: 21
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906202674 Original CRISPR GGCGCTGCAGCGAGAGACCG GGG Exonic
900220416 1:1505915-1505937 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
900628569 1:3621601-3621623 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
901091495 1:6644671-6644693 TGCTCTGCAGGGAGAGAACGCGG + Exonic
902802084 1:18836884-18836906 GGGGCTGCAGCAAGTGACCTAGG - Intergenic
903925131 1:26826618-26826640 GGCGCTGCGGCGGGAGGCCGCGG + Intergenic
904534598 1:31190768-31190790 GGAGCAGCAGACAGAGACCGTGG - Intronic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
911073561 1:93851192-93851214 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
914255290 1:145957684-145957706 GGCAGTGCTGCGAGAGGCCGTGG - Exonic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
915398877 1:155608197-155608219 TGCACTGCAGCCAGAGACAGAGG - Intergenic
915891952 1:159781259-159781281 GGCGGTGCAGGGTGAGGCCGGGG - Exonic
917788396 1:178483751-178483773 GGCGCTCCAGCCAGAGACCCTGG + Intergenic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
923864069 1:237919957-237919979 GGCGCCGAGGCAAGAGACCGAGG - Intergenic
924477340 1:244393760-244393782 GGCGCTCCAGCGAGGGACTGCGG + Intergenic
1063985304 10:11495390-11495412 GGTGCTGAGGCAAGAGACCGAGG - Intronic
1064176920 10:13082981-13083003 GGTGCTGAGGCAAGAGACCGAGG - Intronic
1076419566 10:130321265-130321287 GGCACTGAGGCAAGAGACCGAGG + Intergenic
1076677317 10:132153788-132153810 GGCGCTGCAGCGGAAGATGGTGG + Exonic
1076836519 10:133023772-133023794 GGCTCAGCAGCCAGAGACCCAGG - Intergenic
1078624064 11:12937521-12937543 GGCTCTGCAGAGAGAGACTTGGG - Exonic
1083349362 11:62016316-62016338 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1083794070 11:65004472-65004494 GGTGCTGCAGACAGAGACCTGGG + Intergenic
1083853197 11:65379558-65379580 GGAGCTGCAGAGAGACACAGTGG + Exonic
1083940571 11:65893245-65893267 TGGGCTGCAGCGAGAGATTGAGG - Exonic
1084054974 11:66626153-66626175 GGCCCTGCAGAGAAAGACCTTGG - Intronic
1084558582 11:69889912-69889934 GACGCTGCAGCGGGGGACCGCGG + Intergenic
1087154033 11:94883841-94883863 GGGGCTGAAGCTAGAGAGCGAGG + Intergenic
1090382975 11:126339655-126339677 GGCGCTGCAGTGAGAGGCTAAGG + Intronic
1090806138 11:130203479-130203501 GGCGCTGAAGCAAGAGATTGGGG - Intronic
1092444103 12:8537706-8537728 GGCGCTGAGGCAAGAGACAGAGG + Intronic
1096155245 12:49338023-49338045 CGCGCTGCAGAGAGACACCCAGG + Intergenic
1097591763 12:61583134-61583156 GGCGCCGAGGCAAGAGACCGAGG - Intergenic
1102248355 12:111369042-111369064 GGCGCAGCCGCGGGAGAGCGCGG + Exonic
1102306977 12:111812367-111812389 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
1105578837 13:21675318-21675340 GCGGCAGCAGCGGGAGACCGCGG - Intronic
1115821225 14:37214464-37214486 GGTGCTGAGGCAAGAGACCGAGG + Intronic
1119539045 14:75427296-75427318 AGGGCTGCAGCCTGAGACCGCGG - Intergenic
1119620780 14:76130481-76130503 GGGTCTGCAGGGAGAGACAGTGG + Intergenic
1122119861 14:99546480-99546502 GGCCCTGCAGCAAGAGAAAGAGG + Intronic
1122736940 14:103848339-103848361 GGGACTGCAGGGAGAGACCCAGG - Intergenic
1124013793 15:25860220-25860242 GGTGCTGCAGTGAGAGATCGGGG - Intronic
1124581848 15:30962818-30962840 CTCGCTGCAGAGAGAGGCCGGGG + Intronic
1125760206 15:42091171-42091193 GGCGCCGAGGCAAGAGACCGAGG + Intronic
1127877641 15:63124392-63124414 GGCGCTGAGGCAAGAGACCGAGG - Intronic
1128139144 15:65286630-65286652 GCCGCCGAAGAGAGAGACCGAGG + Exonic
1133339536 16:5027620-5027642 GGCCCTGGAGCCAGAGCCCGGGG + Intronic
1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG + Intronic
1134400417 16:13904727-13904749 GGCGCCGAGGCAAGAGACCGAGG + Intergenic
1135427085 16:22347570-22347592 GGCGCTGGAACTAGAGGCCGAGG - Exonic
1142112751 16:88340949-88340971 GACCCTGCAGAGAGAGCCCGGGG + Intergenic
1142360283 16:89622925-89622947 GGTGTTCCAGCGAGAGACCAGGG + Intronic
1142587357 17:981810-981832 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1143164544 17:4891437-4891459 GGCTCTGCAGGGAGAGACCAGGG - Exonic
1143464401 17:7126283-7126305 GGCGCTGAGGCAAGAGACCGAGG + Intergenic
1145223524 17:21108394-21108416 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
1147145470 17:38482170-38482192 GGCCCAGCAGGGGGAGACCGAGG + Intronic
1151825712 17:76523146-76523168 CGCGCTGCAGCCTGAGACCGAGG - Intergenic
1153163162 18:2231163-2231185 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
1159914504 18:74176551-74176573 GGCTCTGCAGCGAGGGAGGGAGG - Intergenic
1160678356 19:402160-402182 GGTGCCGCAGAGAGAGGCCGAGG + Intergenic
1161384317 19:3982902-3982924 GGAGCTGCAGCTGGAGCCCGAGG - Exonic
1162290402 19:9775783-9775805 GGTGCTGAAGCAAGAGACCGAGG + Intronic
1162613072 19:11771422-11771444 GGCGCCGAGGCAAGAGACCGAGG + Intronic
1163479439 19:17546318-17546340 GGTGCTGAGGCAAGAGACCGAGG - Intronic
1163884909 19:19956808-19956830 CCCGCTGCAGCGAGAGACAAAGG + Intergenic
1165419982 19:35717881-35717903 AGCGCCGCCGCGGGAGACCGGGG - Intergenic
1166807722 19:45497040-45497062 GGCACTGCAGCGCGCGGCCGGGG + Exonic
1167227838 19:48260575-48260597 GGTGCCGAGGCGAGAGACCGAGG - Intronic
1167613653 19:50519154-50519176 GGCGCCGCAGCGAGGGCACGCGG + Exonic
1168603342 19:57738237-57738259 GGTGCTGAGGCAAGAGACCGAGG + Intronic
1168680396 19:58311206-58311228 GGCGCCGAAGCAAGAGACAGAGG - Intronic
926679402 2:15652469-15652491 GGGGCTGCAGGGAGAGACCATGG - Intergenic
932180749 2:69643826-69643848 GGCGGCGCGGCGAGGGACCGGGG + Intronic
932672921 2:73753770-73753792 GGTGCTGAGGCAAGAGACCGAGG + Intergenic
934502587 2:94871888-94871910 GGAGCTGCAGCGTGAGATGGAGG + Exonic
934778511 2:96954124-96954146 GGCCCTGGAGGGAGAGACAGAGG + Intronic
938392277 2:130915721-130915743 GGGGCCGCAGTGAGACACCGTGG - Intronic
944316533 2:198291103-198291125 TGCTCTACAGGGAGAGACCGAGG - Intronic
945649373 2:212539139-212539161 TGGGCTGCAGCTGGAGACCGCGG - Intergenic
946537414 2:220646862-220646884 GGCACTGCAGAAAGAGACCTTGG - Intergenic
947606665 2:231490495-231490517 GGTGCTGAGGCAAGAGACCGAGG - Intergenic
948622812 2:239247149-239247171 GGCCCGGCAGCGAGGGAGCGCGG - Intronic
948845619 2:240681574-240681596 GGGGCTGCAGGGAGAGCCAGGGG - Intronic
948848236 2:240693156-240693178 GGGGCTGCAGGGAGAGCCAGGGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1173904827 20:46618789-46618811 GGCACTGAAGCGAGAGACGGAGG - Intronic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1180830869 22:18905625-18905647 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
1181237365 22:21455772-21455794 GGCACTGCAGGGAGAGGCCTCGG - Intergenic
1183066552 22:35367570-35367592 GGCGCTTCAGCGAGAGGACTGGG - Intergenic
1184842344 22:47059371-47059393 GGCGCTGGTGTGAGAGGCCGGGG - Intronic
1203280957 22_KI270734v1_random:130896-130918 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
954367789 3:50155437-50155459 GGCGCAGCGGCGAGAGGTCGCGG + Exonic
955356741 3:58237992-58238014 GCCGCTGCAGGGAGACACTGGGG - Intronic
959078833 3:101779253-101779275 GGCGCTGCGGCGACCGACCGGGG + Intronic
961567745 3:127775837-127775859 GGCGCTGCTGCGAGAGACGGTGG - Intronic
962827021 3:139107744-139107766 GGTGCTGTAGCAAGAGACTGAGG + Intronic
964452629 3:156826484-156826506 GGCGCCCCAGCGAGAGCACGAGG + Exonic
967742697 3:193020887-193020909 GGAACTGGAGTGAGAGACCGTGG + Intergenic
968105563 3:195999169-195999191 GGCCCTGCAGCTGGAGACCCGGG - Intergenic
968303839 3:197636751-197636773 GGCCCTGCAGCTGGAGACCCGGG - Intergenic
968450469 4:673898-673920 CGCGCTACAGTGAGTGACCGCGG - Exonic
968529788 4:1085552-1085574 GGCCCTGCAGCCAGGGACTGCGG - Intronic
968592660 4:1466593-1466615 GGAGCTGCAGCCTGAGACCTTGG + Intergenic
971736073 4:30454260-30454282 GTCACTGCAGCCAGAGACCTTGG + Intergenic
977742534 4:100504373-100504395 GGCGCTGAGGCAAGAGACCGAGG + Intronic
980063402 4:128155823-128155845 AGGGCTGCAGCGAGAGATCGAGG + Intronic
983069516 4:163252482-163252504 GGCTCTGAAGCCAGAGAACGTGG + Intergenic
984568873 4:181365855-181365877 GCCGCGTCAGCGAGAGACTGCGG - Intergenic
987359776 5:17096340-17096362 GGCGCCGAGGCAAGAGACCGAGG - Intronic
997633703 5:135389232-135389254 GGCCCTGCAGCTACAGACAGTGG - Intronic
998347673 5:141478404-141478426 GTCGCTGCGGCGGGAGTCCGTGG - Exonic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1002616334 5:180458784-180458806 GGCGCTGCAGCCAGAGAGATGGG - Intergenic
1003551902 6:7107991-7108013 TGGGCTTCAGGGAGAGACCGAGG - Exonic
1006494627 6:34413485-34413507 GGCGATGGAGTGAGAGACCCTGG - Intronic
1006652187 6:35560674-35560696 GGCGCCGAGGCAAGAGACCGAGG - Intergenic
1007775759 6:44223587-44223609 GAAGCTGCAGCGAGAGCGCGCGG + Intronic
1011112448 6:83853548-83853570 GGCGCAGGAGGGAGAGACGGGGG - Intronic
1013322607 6:109009515-109009537 GGCGCTGCAGCCAGGAGCCGCGG - Intronic
1015127120 6:129767440-129767462 GGCGCAGCAGCGGGGGTCCGAGG - Intergenic
1016454478 6:144216380-144216402 GCCGCGGCGGCGAGAAACCGAGG + Intergenic
1017013424 6:150080833-150080855 GGCGCTGCAGTTAAAGAGCGAGG + Intergenic
1018724037 6:166596979-166597001 GGAGCTGCAGAGAGAGGCCTGGG + Intronic
1019537852 7:1538325-1538347 GGGGCCGCAGCCAGAGACCAGGG - Intronic
1019612726 7:1945093-1945115 TGCTCTGCAGAGAGAGACGGAGG - Intronic
1020118768 7:5491376-5491398 GGCGCTGCAGCGAGGGGCACTGG + Exonic
1023871973 7:44268218-44268240 TGCGCTTCAGCGAGAGGCCTTGG - Intronic
1029054949 7:97732275-97732297 GCCGCTGCGGCGAGGGACAGTGG + Intronic
1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG + Intergenic
1029549981 7:101232512-101232534 GGCGCTGCGGGGAGGGCCCGGGG + Exonic
1029562229 7:101310184-101310206 GGCGCCGAGGCAAGAGACCGAGG - Intergenic
1034674679 7:152883995-152884017 AGAGCTGCAGCGAGAGGCTGAGG + Intergenic
1036210001 8:6834310-6834332 GACGCTGCAGCTCTAGACCGCGG + Intronic
1037813455 8:22099770-22099792 TGCGCTGCTGCGGGAGGCCGTGG + Exonic
1046067427 8:109213420-109213442 GGCGCCGAGGCAAGAGACCGAGG + Intergenic
1048241103 8:132742272-132742294 GGCGCCGAGGCAAGAGACCGAGG - Intronic
1049368346 8:142251690-142251712 GGCCCTGCAGATAGAGAACGCGG - Intronic
1049368358 8:142251734-142251756 GGCCCTGCAGACAGAGATCGCGG - Intronic
1049368382 8:142251822-142251844 GGCCCTGCAGATAGAGAACGCGG - Intronic
1049368405 8:142251910-142251932 GGCCCTGCAGACAGAGAACGCGG - Intronic
1049368439 8:142252042-142252064 GGCCCTGCAGATAGAGAACGTGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049857134 8:144869570-144869592 GGTGCTGAGGCAAGAGACCGAGG + Intergenic
1049881294 8:145065820-145065842 GGTGCTGAGGCAAGAGACCGAGG + Intergenic
1053263947 9:36696857-36696879 GGCTTTGCAGGGAGAGACTGAGG + Intergenic
1055730884 9:79278363-79278385 GGCGCTGCAGCTACAGAGAGTGG - Intergenic
1059172308 9:112137224-112137246 GGCACAGCAGTGAGAAACCGAGG + Intronic
1060516586 9:124269887-124269909 GGCACTGCAGGGAGAGAGAGAGG - Intronic
1061443516 9:130623767-130623789 GGTGCTGCACCGAGAGCCCCGGG - Intronic
1061787758 9:133040798-133040820 GGTGCTGAGGCAAGAGACCGAGG + Intronic
1062183986 9:135206798-135206820 GGCGCTGAGGCAAGAGACCGAGG - Intergenic
1185619633 X:1445628-1445650 GGTGCTGAGGCAAGAGACCGAGG + Intronic
1187242149 X:17523200-17523222 GGCTCTGCAGGGAGAGAACTAGG + Intronic
1189332849 X:40153849-40153871 GGAGCCGCAGCGAGAGGCAGTGG + Intronic
1190053557 X:47169551-47169573 GGTGCTGCAGCCAGACACAGAGG - Intronic
1197137777 X:123083065-123083087 GACCCTGCAGCGAGGGAACGAGG - Intergenic
1197242650 X:124136460-124136482 GGCGCCGAGGCAAGAGACCGAGG + Intronic
1200126342 X:153816567-153816589 GGAGCTGAAGGGAGAGACGGTGG + Intronic