ID: 906202675

View in Genome Browser
Species Human (GRCh38)
Location 1:43970215-43970237
Sequence CAGCGAGAGACCGGGGTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906202666_906202675 20 Left 906202666 1:43970172-43970194 CCTCATGGAGTCGATGTTTAGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154
906202669_906202675 -4 Left 906202669 1:43970196-43970218 CCCTGCCGAGGCGGCGCTGCAGC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154
906202665_906202675 30 Left 906202665 1:43970162-43970184 CCAAGCTGTGCCTCATGGAGTCG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154
906202670_906202675 -5 Left 906202670 1:43970197-43970219 CCTGCCGAGGCGGCGCTGCAGCG 0: 1
1: 0
2: 4
3: 9
4: 112
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154
906202671_906202675 -9 Left 906202671 1:43970201-43970223 CCGAGGCGGCGCTGCAGCGAGAG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 906202675 1:43970215-43970237 CAGCGAGAGACCGGGGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906202675 Original CRISPR CAGCGAGAGACCGGGGTGCC AGG Exonic